Update README.md
Browse files
README.md
CHANGED
|
@@ -39,29 +39,61 @@ A small snippet of code is given here in order to retrieve both logits and embed
|
|
| 39 |
from transformers import AutoTokenizer, AutoModel
|
| 40 |
import torch
|
| 41 |
|
| 42 |
-
|
| 43 |
-
|
| 44 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 45 |
|
| 46 |
# Choose the length to which the input sequences are padded. By default, the
|
| 47 |
# model max length is chosen, but feel free to decrease it as the time taken to
|
| 48 |
# obtain the embeddings increases significantly with it.
|
| 49 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 50 |
|
| 51 |
# Create a dummy dna sequence and tokenize it
|
| 52 |
sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"]
|
| 53 |
-
|
| 54 |
|
| 55 |
-
#
|
| 56 |
-
attention_mask =
|
| 57 |
outs = model(
|
| 58 |
-
|
| 59 |
attention_mask=attention_mask,
|
| 60 |
output_hidden_states=True
|
| 61 |
)
|
| 62 |
|
| 63 |
-
|
|
|
|
|
|
|
| 64 |
probabilities = torch.nn.functional.softmax(logits, dim=-1)
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 65 |
```
|
| 66 |
|
| 67 |
|
|
|
|
| 39 |
from transformers import AutoTokenizer, AutoModel
|
| 40 |
import torch
|
| 41 |
|
| 42 |
+
features = [
|
| 43 |
+
"protein_coding_gene",
|
| 44 |
+
"lncRNA",
|
| 45 |
+
"exon",
|
| 46 |
+
"intron",
|
| 47 |
+
"splice_donor",
|
| 48 |
+
"splice_acceptor",
|
| 49 |
+
"5UTR",
|
| 50 |
+
"3UTR",
|
| 51 |
+
"CTCF-bound",
|
| 52 |
+
"polyA_signal",
|
| 53 |
+
"enhancer_Tissue_specific",
|
| 54 |
+
"enhancer_Tissue_invariant",
|
| 55 |
+
"promoter_Tissue_specific",
|
| 56 |
+
"promoter_Tissue_invariant",
|
| 57 |
+
]
|
| 58 |
+
|
| 59 |
+
tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/segment_nt_30kb", trust_remote_code=True)
|
| 60 |
+
model = AutoModel.from_pretrained("InstaDeepAI/segment_nt_30kb", trust_remote_code=True)
|
| 61 |
|
| 62 |
# Choose the length to which the input sequences are padded. By default, the
|
| 63 |
# model max length is chosen, but feel free to decrease it as the time taken to
|
| 64 |
# obtain the embeddings increases significantly with it.
|
| 65 |
+
# The number of DNA tokens (excluding the CLS token prepended) needs to be dividible by
|
| 66 |
+
# 2 to the power of the number of downsampling block, i.e 4.
|
| 67 |
+
max_length = 12 + 1
|
| 68 |
+
|
| 69 |
+
assert (max_length - 1) % 4 == 0, (
|
| 70 |
+
"The number of DNA tokens (excluding the CLS token prepended) needs to be dividible by"
|
| 71 |
+
"2 to the power of the number of downsampling block, i.e 4.")
|
| 72 |
|
| 73 |
# Create a dummy dna sequence and tokenize it
|
| 74 |
sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"]
|
| 75 |
+
tokens = tokenizer.batch_encode_plus(sequences, return_tensors="pt", padding="max_length", max_length = max_length)["input_ids"]
|
| 76 |
|
| 77 |
+
# Infer
|
| 78 |
+
attention_mask = tokens != tokenizer.pad_token_id
|
| 79 |
outs = model(
|
| 80 |
+
tokens,
|
| 81 |
attention_mask=attention_mask,
|
| 82 |
output_hidden_states=True
|
| 83 |
)
|
| 84 |
|
| 85 |
+
# Obtain the logits over the genomic features
|
| 86 |
+
logits = outs.logits.detach()
|
| 87 |
+
# Transform them in probabilities
|
| 88 |
probabilities = torch.nn.functional.softmax(logits, dim=-1)
|
| 89 |
+
print(f"Probabilities shape: {probabilities.shape}")
|
| 90 |
+
|
| 91 |
+
# Get probabilities associated with intron
|
| 92 |
+
idx_intron = features.index("intron")
|
| 93 |
+
probabilities_intron = probabilities[:,:,idx_intron]
|
| 94 |
+
print(f"Intron probabilities shape: {probabilities_intron.shape}")
|
| 95 |
+
|
| 96 |
+
|
| 97 |
```
|
| 98 |
|
| 99 |
|