[ { "_id": "3a899e363ecc3c434605c0c4513b9408", "header": [ "season", "tropical lows", "tropical cyclones", "severe tropical cyclones", "strongest storm" ], "rows": [ [ "1990 - 91", "10", "10", "7", "marian" ], [ "1991 - 92", "11", "10", "9", "jane - irna" ], [ "1992 - 93", "6", "3", "1", "oliver" ], [ "1993 - 94", "12", "11", "7", "theodore" ], [ "1994 - 95", "19", "9", "6", "chloe" ], [ "1995 - 96", "19", "14", "9", "olivia" ], [ "1996 - 97", "15", "14", "3", "pancho" ], [ "1997 - 98", "10", "9", "3", "tiffany" ], [ "1998 - 99", "21", "14", "9", "gwenda" ], [ "1999 - 00", "13", "12", "5", "john / paul" ] ], "title": "", "original_id": "29ba53ce7ca43a979263ed36798f62a3" }, { "_id": "9e7f4648bfb107b55e191d8b5e73cc0e", "header": [ "rank", "route", "avg daily flts", "of airlines", "distance (km)", "market share leader" ], "rows": [ [ "1", "seoul ( gmp ) - jeju ( cju )", "159", "7", "451", "korean air" ], [ "2", "rio de janeiro ( sdu ) - são paulo ( cgh )", "125", "4", "359", "tam" ], [ "3", "mumbai ( bom ) - new delhi ( del )", "123", "8", "1138", "jet airways" ], [ "4", "tokyo ( hnd ) - sapporo ( cts )", "119", "4", "822", "all nippon airways" ], [ "5", "monte carlo ( mcm ) - nice ( nce )", "117", "2", "18", "heli air monaco" ], [ "6t", "madrid ( mad ) - barcelona ( bcn )", "116", "4", "484", "iberia" ], [ "6t", "melbourne ( mel ) - sydney ( syd )", "116", "8", "705", "qantas" ], [ "8", "kahului ( ogg ) - honolulu ( hnl )", "98", "4", "163", "hawaiian airlines" ], [ "9t", "johannesburg ( jnb ) - cape town ( cpt )", "92", "6", "1270", "south african airways" ], [ "9t", "fukuoka ( fuk ) - tokyo ( hnd )", "92", "3", "881", "japan airlines" ] ], "title": "", "original_id": "1aba704991b72a8107475d7fea800b42" }, { "_id": "cd341c61d3c27c8b2430bb5f8db897dd", "header": [ "country", "un budget", "international trade (millions of usd) 2011", "gdp (nominal) (millions of usd) 2011", "gdp (ppp) (millions of usd) 2011", "population" ], "rows": [ [ "italy", "4.999%", "1050100", "2198730", "1846950", "60849247" ], [ "canada", "3.207%", "910200", "1736869", "1396131", "34953100" ], [ "spain", "3.177%", "715200", "1493513", "1413468", "46163116" ], [ "mexico", "2.356%", "678200", "1154784", "1661640", "112336538" ], [ "south korea", "2.260%", "1084000", "1116247", "1554149", "50004441" ], [ "turkey", "0.617%", "373800", "778089", "1073565", "74724269" ], [ "argentina", "0.287%", "136300", "447644", "716419", "40117096" ], [ "indonesia", "0.238%", "335100", "845680", "1124649", "237641326" ], [ "colombia", "0.144%", "92760", "327626", "471890", "46748000" ], [ "pakistan", "0.082%", "58000", "210566", "488580", "180991000" ], [ "costa rica", "0.034%", "24460", "40947", "55020", "4301712" ], [ "malta", "0.017%", "9200", "8896", "10757", "417617" ], [ "san marino", "0.003%", "6201", "2048", "1136", "32404" ] ], "title": "", "original_id": "39c3b24be6bcb3e279ecccea6b641efc" }, { "_id": "0fd34a0fb2f14722cdcd704f35f9726f", "header": [ "Row Header", "Position", "Age", "Air Group or Subsidiary Officer Since" ], "rows": [ [ "Bradley D. Tilden", "Chairman and Chief Executive Officer of Alaska Air Group, Inc., Chairman of Alaska Airlines, Inc., Chairman of Horizon Air Industries, Inc.", "58", "1994" ], [ "Brandon S. Pedersen", "Executive Vice President/Finance and Chief Financial Officer of Alaska Air Group, Inc. and Alaska Airlines, Inc., and Treasurer of Alaska Air Group, Inc. and Alaska Airlines, Inc.", "52", "2003" ], [ "Kyle B. Levine", "Vice President Legal, General Counsel and Corporate Secretary of Alaska Air Group, Inc. and Alaska Airlines, Inc. and Chief Ethics and Compliance Officer of Alaska Air Group, Inc.", "47", "2016" ], [ "Benito Minicucci", "President and Chief Operating Officer of Alaska Airlines, Inc.", "52", "2004" ], [ "Gary L. Beck", "President and Chief Executive Officer of Horizon Air Industries, Inc.", "71", "2018" ], [ "Andrew R. Harrison", "Executive Vice President and Chief Commercial Officer of Alaska Airlines, Inc.", "49", "2008" ], [ "Shane R. Tackett", "Executive Vice President, Planning and Strategy of Alaska Airlines, Inc.", "40", "2011" ], [ "Andrea L. Schneider", "Vice President People of Alaska Airlines, Inc.", "53", "1998" ], [ "Diana Birkett-Rakow", "Vice President External Relations of Alaska Airlines, Inc.", "41", "2017" ] ], "title": "", "original_id": "e067a40ab6736ac5a004d9dc69f2d5c0" }, { "_id": "5764357c431875dc08cb39fe9b3f1d03", "header": [ "Club", "Season", "League", "League", "League", "National Cup", "National Cup", "League Cup", "League Cup", "Europe", "Europe", "Total", "Total" ], "rows": [ [ "Club", "Season", "Division", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals" ], [ "Liverpool", "1990–91", "First Division", "2", "0", "1", "0", "0", "0", "0", "0", "3", "0" ], [ "Liverpool", "1991–92", "First Division", "30", "5", "8", "3", "5", "3", "8", "0", "51", "11" ], [ "Liverpool", "1992–93", "Premier League", "31", "4", "1", "0", "5", "2", "3", "1", "40", "7" ], [ "Liverpool", "1993–94", "Premier League", "30", "2", "2", "0", "2", "0", "0", "0", "34", "2" ], [ "Liverpool", "1994–95", "Premier League", "40", "7", "7", "0", "8", "2", "0", "0", "55", "9" ], [ "Liverpool", "1995–96", "Premier League", "38", "6", "7", "2", "4", "1", "4", "1", "53", "10" ], [ "Liverpool", "1996–97", "Premier League", "37", "7", "2", "0", "4", "2", "8", "1", "51", "10" ], [ "Liverpool", "1997–98", "Premier League", "36", "11", "1", "0", "5", "0", "4", "1", "46", "12" ], [ "Liverpool", "1998–99", "Premier League", "28", "4", "0", "0", "0", "0", "3", "1", "31", "5" ], [ "Liverpool", "Liverpool Total", "Liverpool Total", "272", "46", "29", "5", "33", "10", "30", "5", "364", "66" ], [ "Real Madrid", "1999–2000", "La Liga", "30", "3", "10", "0", "0", "0", "7", "1", "47", "4" ], [ "Real Madrid", "2000–01", "La Liga", "26", "2", "6", "0", "0", "0", "10", "0", "42", "2" ], [ "Real Madrid", "2001–02", "La Liga", "23", "2", "2", "0", "0", "0", "13", "2", "38", "4" ], [ "Real Madrid", "2002–03", "La Liga", "15", "1", "4", "1", "0", "0", "6", "2", "25", "4" ], [ "Real Madrid", "Real Madrid Total", "Real Madrid Total", "94", "8", "22", "1", "0", "0", "36", "5", "152", "14" ], [ "Manchester City", "2003–04", "Premier League", "22", "0", "3", "0", "1", "0", "4", "0", "30", "0" ], [ "Manchester City", "2004–05", "Premier League", "13", "0", "1", "0", "0", "0", "0", "0", "14", "0" ], [ "Manchester City", "Manchester City Total", "Manchester City Total", "35", "0", "4", "0", "1", "0", "4", "0", "44", "0" ], [ "Career Total", "Career Total", "Career Total", "401", "54", "52", "6", "37", "10", "70", "10", "560", "80" ] ], "title": "", "original_id": "b71bb2ae2d5e19e17c816355f55ec3d8" }, { "_id": "88df92949481d5ca24d8a8c77109978f", "header": [ "Unnamed: 0", "1994 general", "1995 regional", "1996 general", "1999 european", "2000 regional", "2001 general", "2004 european", "2005 regional", "2006 general", "2008 general", "2009 european", "2010 regional", "2013 general" ], "rows": [ [ "piedmont", "with fi", "3.0", "4.4", "3.3", "4.5", "3.5", "5.0", "4.6", "6.2", "5.2", "6.1", "3.9", "1.2" ], [ "lombardy", "with fi", "2.2", "4.6", "3.5", "4.1", "3.4", "3.6", "3.8", "5.9", "4.3", "5.0", "3.8", "1.1" ], [ "veneto", "with fi", "3.6", "5.4", "5.4", "6.8", "5.0", "5.0", "6.4", "7.8", "5.6", "6.4", "4.9", "1.7" ], [ "emilia - romagna", "with fi", "4.8", "4.8", "2.7", "3.7", "3.4", "2.8", "3.9", "5.8", "4.3", "4.7", "3.8", "1.1" ], [ "tuscany", "with fi", "2.5", "4.8", "3.2", "4.2", "3.3", "3.3", "3.7", "5.9", "4.2", "4.6", "4.8", "1.1" ], [ "lazio", "with fi", "4.2", "4.7", "4.8", "6.7", "4.8", "7.1", "7.8", "6.9", "4.8", "5.5", "6.1", "1.5" ], [ "campania", "with fi", "9.7", "8.0", "6.8", "8.5", "7.5", "7.0", "6.7", "6.8", "6.5", "8.7", "9.4", "3.6" ], [ "apulia", "with fi", "5.6", "7.6", "6.0", "6.2", "6.8", "8.1", "7.8", "7.8", "7.9", "9.1", "6.5", "2.0" ], [ "calabria", "with fi", "9.0", "9.0", "9.4", "13.3", "9.5", "9.6", "10.4", "7.7", "8.2", "9.3", "9.4", "4.1" ], [ "sicily", "with fi", "19.0 (1996)", "8.1", "7.9", "24.3 (2001)", "14.4", "14.0", "18.7 (2006)", "10.0", "9.4", "11.9", "12.5 (2008)", "2.8" ] ], "title": "", "original_id": "f19e3c32d88171eb59e66dc31967bf2d" }, { "_id": "1df5376e585ac01f2f4b45ce50af5281", "header": [ "#", "Mayor", "Taking Office", "Leaving" ], "rows": [ [ "1", "Vivian Burrill", "1901", "1902" ], [ "2", "Arthur Dufresne", "1902", "1902" ], [ "3", "Beaudry Leman", "1902", "1908" ], [ "1", "Vivian Burrill", "1908", "1913" ], [ "4", "Joseph-Auguste Frigon", "1913", "1915" ], [ "5", "Edmond Thibaudeau", "1915", "1917" ], [ "4", "Joseph-Auguste Frigon", "1917", "1918" ], [ "6", "Napoléon Désaulniers", "1918", "1920" ], [ "7", "Joseph-Alexis Dufresne", "1920", "1928" ], [ "6", "Napoléon Désaulniers", "1928", "1930" ], [ "8", "Albert Gigaire", "1930", "1936" ], [ "9", "Lucien Bourassa", "1936", "1937" ], [ "10", "Alexandre Gélinas", "1937", "1938" ], [ "11", "J.A. Bilodeau", "1938", "1946" ], [ "12", "François Roy", "1946", "1954" ], [ "13", "Gaston Hardy", "1954", "1957" ], [ "14", "Armand Foucher", "1957", "1963" ], [ "15", "Gérard Dufresne", "1963", "1966" ], [ "16", "Maurice Bruneau", "1966", "1970" ], [ "17", "Dominique Grenier", "1970", "1986" ], [ "18", "Roland Désaulniers", "1986", "1994" ], [ "19", "Lise Landry", "1994", "2009" ], [ "20", "Michel Angers", "2009", "Current" ] ], "title": "", "original_id": "06cf0ed5987ea6984c584de1d8eda280" }, { "_id": "53298410d7d3058ba8cf9077048cc8ba", "header": [ "Name", "Position", "Length\n[km]", "Drainage basin area\n[km2]", "Confluence\n[by Lahn-km]", "Mouth elevation\n[m above MSL]" ], "rows": [ [ "Feudinge (Rüppersbach)", "left", "6.3", "21.2", "9.8", "388" ], [ "Ilse", "right", "8.4", "11.8", "10.5", "382" ], [ "Banfe", "right", "11.5", "38.9", "18.5", "326" ], [ "Laasphe", "left", "8.3", "19.6", "19.4", "324" ], [ "Perf", "right", "20.0", "113.1", "24.7", "285" ], [ "Dautphe", "left", "8.8", "41.8", "37.5", "245" ], [ "Wetschaft", "left", "29.0", "196.2", "56.3", "192" ], [ "Ohm", "left", "59.7", "983.8", "58.7", "188" ], [ "Allna", "right", "19.1", "92.0", "77.1", "172" ], [ "Zwester Ohm", "left", "20.0", "69.5", "84.0", "165" ], [ "Salzböde", "right", "27.6", "137.8", "87.4", "164" ], [ "Lumda", "left", "30.0", "131.5", "93.6", "160" ], [ "Wieseck", "left", "24.3", "119.6", "102.2", "155" ], [ "Bieber", "right", "13.6", "34.7", "105.1", "151" ], [ "Kleebach", "left", "26.9", "164.6", "106.2", "150" ], [ "Wetzbach", "left", "11.7", "32.9", "119.6", "147" ], [ "Dill", "right", "55.0", "717.7", "120.4", "147" ], [ "Solmsbach", "left", "24.6", "112.5", "128.1", "141" ], [ "Iserbach (Möttbach)", "left", "19.2", "31.2", "131.4", "139" ], [ "Ulmbach", "right", "22.9", "60.9", "138.2", "135" ], [ "Kallenbach", "right", "14.6", "84.7", "141.3", "132" ], [ "Weil", "left", "46.6", "247.9", "149.4", "130" ], [ "Kerkerbach", "right", "20.7", "70.2", "176.0", "112" ], [ "Emsbach", "left", "39.1", "321.8", "181.0", "110" ], [ "Elbbach", "right", "40.7", "323.7", null, "109" ], [ "Aar", "left", "49.7", "312.6", null, "103" ], [ "Dörsbach", "left", "32.0", "114.0", null, "94" ], [ "Gelbach (Aubach)", "right", "39.7", "221.2", null, "93" ], [ "Mühlbach", "left", "32.1", "171.9", null, "85" ], [ "Emsbach", "right", "11.5", "29.4", null, "75" ] ], "title": "", "original_id": "9a6f45b58f3230e8a11f4f7cd5afa465" }, { "_id": "650821059ba289f10b7849e521df4010", "header": [ "election", "leader", "of seats won", "of national votes", "% of national vote", "of prefectural votes", "% of prefectural vote" ], "rows": [ [ "1956", "ichirō hatoyama", "61", "11356874", "39.7%", "14353960", "48.4%" ], [ "1959", "nobusuke kishi", "71", "12120598", "41.2%", "15667022", "52.0%" ], [ "1962", "hayato ikeda", "69", "16581637", "46.4%", "17112986", "47.1%" ], [ "1965", "eisaku satō", "71", "17583490", "47.2%", "16651284", "44.2%" ], [ "1968", "eisaku satō", "69", "20120089", "46.7%", "19405546", "44.9%" ], [ "1971", "eisaku satō", "62", "17759395", "44.5%", "17727263", "44.0%" ], [ "1974", "kakuei tanaka", "62", "23332773", "44.3%", "21132372", "39.5%" ], [ "1977", "takeo fukuda", "63", "18160061", "35.8%", "20440157", "39.5%" ], [ "1980", "masayoshi ōhira", "69", "23778190", "43.3%", "24533083", "42.5%" ], [ "1983", "yasuhiro nakasone", "68", "16441437", "35.3%", "19975034", "43.2%" ], [ "1986", "yasuhiro nakasone", "72", "22132573", "38.58%", "26111258", "45.07%" ], [ "1989", "sōsuke uno", "36", "17466406", "30.70%", "15343455", "27.32%" ], [ "1992", "kiichi miyazawa", "68", "20528293", "45.23%", "14961199", "33.29%" ], [ "1995", "yōhei kōno", "46", "10557547", "25.40%", "11096972", "27.29%" ], [ "1998", "keizō obuchi", "44", "17033851", "30.45%", "14128719", "25.17%" ], [ "2001", "junichiro koizumi", "64", "22299825", "41.04%", "21114727", "38.57%" ], [ "2004", "junichiro koizumi", "49", "16797686", "30.03%", "19687954", "35.08%" ], [ "2007", "shinzō abe", "37", "16544696", "28.1%", "18606193", "31.35%" ], [ "2010", "sadakazu tanigaki", "51", "14071671", "24.07%", "19496083", "33.38%" ], [ "2013", "shinzō abe", "65", "18460404", "34.7%", "22681192", "42.7%" ] ], "title": "", "original_id": "463ca07b585e49a35a8e1e657c4b9cf2" }, { "_id": "b3b254dd52a414c4103c1c63cf19554f", "header": [ "season", "series", "team", "races", "wins", "poles", "flaps", "podiums", "points", "position" ], "rows": [ [ "2008", "formula bmw europe", "räikkönen robertson racing", "15", "0", "0", "1", "1", "158", "6th" ], [ "2008", "formula bmw pacific", "motaworld racing", "1", "0", "0", "0", "1", "0", "nc" ], [ "2008", "formula bmw world final", "josef kaufmann racing", "1", "0", "0", "0", "1", "0", "2nd" ], [ "2009", "formula bmw europe", "mücke motorsport", "16", "4", "5", "4", "6", "233", "4th" ], [ "2010", "gp3 series", "mw arden", "16", "0", "0", "0", "0", "0", "31st" ], [ "2011", "gp3 series", "rsc mücke motorsport", "16", "0", "0", "1", "2", "19", "11th" ], [ "2011", "adac gt masters", "vulcan racing - mintgen motorsport", "6", "0", "0", "0", "0", "0", "nc" ] ], "title": "", "original_id": "1feeafc0b774633c4b7070d7295d0b2a" }, { "_id": "845482366ba4bac92ea34feeba688f0e", "header": [ "test", "subject", "mean score", "standard deviation", "number of students" ], "rows": [ [ "sat subject test in literature", "literature", "576", "111", "120004" ], [ "sat subject test in united states history", "us history", "608", "113", "126681" ], [ "sat subject test in world history", "world history", "607", "118", "19688" ], [ "sat subject test in mathematics level 1", "mathematics", "610", "100", "82827" ], [ "sat subject test in mathematics level 2", "mathematics", "654", "107", "176472" ], [ "sat subject test in biology e / m", "biology", "e - 605 m - 635", "110 108", "86206 in total , 40076 (e) 46130 (m)" ], [ "sat subject test in chemistry", "chemistry", "648", "110", "76077" ], [ "sat subject test in physics", "physics", "656", "105", "49608" ], [ "sat subject test in chinese with listening", "chinese", "758", "67", "7294" ], [ "sat subject test in french", "french", "622", "123", "10391" ], [ "sat subject test in french with listening", "french", "646", "117", "2370" ], [ "sat subject test in german", "german", "622", "135", "777" ], [ "sat subject test in german with listening", "german", "611", "122", "770" ], [ "sat subject test in modern hebrew", "modern hebrew", "623", "140", "491" ], [ "sat subject test in italian", "italian", "666", "122", "737" ], [ "sat subject test in japanese with listening", "japanese", "684", "113", "1966" ], [ "sat subject test in korean with listening", "korean", "767", "57", "4273" ], [ "sat subject test in latin", "latin", "611", "107", "3010" ], [ "sat subject test in spanish", "spanish", "647", "117", "37762" ], [ "sat subject test in spanish with listening", "spanish", "663", "107", "6399" ] ], "title": "", "original_id": "d4089b01cb0b1550e4df597512eb8eea" }, { "_id": "93fe4a560a112116321e93d709fca347", "header": [ "rank", "name", "city", "region", "height (m)", "height (ft)", "floors", "estimated completion" ], "rows": [ [ "1", "leadenhall building", "london", "greater london", "225", "737", "48", "2014" ], [ "2", "52 - 54 lime street", "london", "greater london", "190", "623", "38", "2017" ], [ "3", "100 bishopsgate", "london", "greater london", "172", "564", "40", "2015" ], [ "4", "1 blackfriars", "london", "greater london", "163", "535", "52", "2018" ], [ "5", "20 fenchurch street", "london", "greater london", "160", "525", "36", "2014" ], [ "6", "baltimore tower", "london", "greater london", "150", "495", "45", "2016" ], [ "7", "providence tower", "london", "greater london", "136", "446", "44", "2015" ], [ "8", "one the elephant", "london", "greater london", "133", "436", "37", "2016" ], [ "9", "25 churchill place", "london", "greater london", "130", "427", "23", "2014" ], [ "10", "lots road tower 1", "london", "greater london", "122", "400", "37", "2015" ], [ "11", "lexicon tower", "london", "greater london", "115", "377", "35", "2016" ] ], "title": "", "original_id": "b6ce5ae3244350599a7403a76a1f1c69" }, { "_id": "f95435f1c13e957ec422fae63190de40", "header": [ "Unnamed: 0", "airdate", "episode", "rating", "share", "rating / share (1849)", "viewers (millions)", "rank (timeslot)", "rank (night)" ], "rows": [ [ "1", "february 14 , 2010", "nanna is kickin' your butt", "5.1", "8", "2.8 / 7", "9.07", "1", "1" ], [ "2", "february 21 , 2010", "when the cow kicked me in the head", "5.2", "8", "2.9 / 7", "9.11", "1", "1" ], [ "3", "february 28 , 2010", "run like scalded dogs!", "5.8", "9", "3.2 / 8", "10.24", "2", "4" ], [ "4", "march 7 , 2010", "we are no longer in the bible belt", "4.5", "7", "2.6 / 7", "8.05", "2", "4" ], [ "5", "march 14 , 2010", "i think we 're fighting the germans , right", "5.8", "10", "3.0 / 9", "10.1", "1", "3" ], [ "6", "march 21 , 2010", "cathy drone", "6.9", "11", "3.8 / 9", "11.99", "1", "4" ], [ "7", "march 28 , 2010", "anonymous", "7.2", "11", "3.9 / 10", "12.73", "1", "3" ], [ "8", "april 4 , 2010", "you 're like jason bourne , right", "5.2", "9", "2.7 / 8", "9.14", "1", "3" ], [ "9", "april 11 , 2010", "dumb did us in", "6.9", "11", "3.4 / 10", "11.88", "1", "3" ], [ "10", "april 25 , 2010", "i feel like i'm in , like , sicily", "6.3", "10", "3.2 / 9", "10.69", "1", "3" ], [ "11", "may 2 , 2010", "they don't even understand their own language", "6.0", "10", "3.0 / 9", "10.29", "1", "3" ] ], "title": "", "original_id": "8e11fccdc147a157e7d7e9471759e877" }, { "_id": "4950fa7cbc0b68c3fce3c8be226e070c", "header": [ "inegi code", "municipality", "municipal seat", "area (km 2 )", "population (2005)", "population density ( / km 2 )", "human development index (2000)" ], "rows": [ [ "1", "amealco de bonfil", "amealco", "682.1", "56457", "82.8", "0.6803" ], [ "2", "pinal de amoles", "pinal de amoles", "705.37", "25325", "35.9", "0.6659" ], [ "3", "arroyo seco", "arroyo seco", "731.17", "12493", "17.1", "0.7029" ], [ "4", "cadereyta de montes", "cadereyta", "1131.0", "57204", "50.6", "0.7074" ], [ "5", "colón", "colón", "807.15", "51625", "64.0", "0.7036" ], [ "6", "corregidora", "el pueblito", "245.8", "104218", "424.0", "0.8535" ], [ "7", "ezequiel montes", "ezequiel montes", "298.28", "34729", "116.4", "0.7534" ], [ "8", "huimilpan", "huimilpan", "388.4", "32728", "84.3", "0.6824" ], [ "9", "jalpan de serra", "jalpan", "1185.1", "22025", "18.6", "0.7178" ], [ "10", "landa de matamoros", "landa de matamoros", "840.1", "18905", "22.5", "0.6606" ], [ "11", "el marqués", "la cañada", "787.4", "79743", "101.3", "0.7295" ], [ "12", "pedro escobedo", "pedro escobedo", "290.9", "17007", "58.5", "0.7598" ], [ "13", "peñamiller", "peñamiller", "694.9", "56553", "81.4", "0.7023" ], [ "14", "querétaro", "santiago de querétaro", "759.9", "734139", "966.1", "0.856" ], [ "15", "san joaquín", "san joaquín", "499.0", "7634", "15.3", "0.6593" ], [ "16", "san juan del río", "san juan del río", "799.9", "208462", "260.6", "0.8035" ], [ "17", "tequisquiapan", "tequisquiapan", "343.6", "54929", "159.9", "0.7827" ] ], "title": "", "original_id": "767d183aa02457793092c2e983eeb612" }, { "_id": "1c3be4cbea489e57e8f1d8b0f8247b84", "header": [ "rank", "peak", "country", "island", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "1", "puncak jaya (carstensz pyramid)", "indonesia", "new guinea", "4884", "4884", "0" ], [ "2", "mount arfak", "indonesia", "new guinea", "2940", "2761", "179" ], [ "3", "puncak mandala", "indonesia", "new guinea", "4760", "2760", "2000" ], [ "4", "mount kobowre", "indonesia", "new guinea", "3750", "2217", "1533" ], [ "5", "mount gauttier", "indonesia", "new guinea", "2230", "2007", "223" ], [ "6", "mount wondiwoi", "indonesia", "new guinea", "2180", "1985", "195" ], [ "7", "bon irau", "indonesia", "new guinea", "2500", "1900", "600" ], [ "8", "mount cycloop", "indonesia", "new guinea", "2000", "1876", "124" ], [ "9", "undundi - wandandi", "indonesia", "new guinea", "3640", "1740", "1900" ], [ "10", "mount kumawa", "indonesia", "new guinea", "1680", "1636", "44" ], [ "11", "angemuk", "indonesia", "new guinea", "3949", "1565", "2384" ] ], "title": "", "original_id": "2438086f1b3d0cb3f63d46f4c9eb8dbf" }, { "_id": "d8c72aead83246984f406579eb7be4de", "header": [ "Color", "Pin (Tip)", "Pin (Ring)", "Color.1" ], "rows": [ [ "White/Blue", "26", "1", "Blue/White" ], [ "White/Orange", "27", "2", "Orange/White" ], [ "White/Green", "28", "3", "Green/White" ], [ "White/Brown", "29", "4", "Brown/White" ], [ "White/Slate", "30", "5", "Slate/White" ], [ "Red/Blue", "31", "6", "Blue/Red" ], [ "Red/Orange", "32", "7", "Orange/Red" ], [ "Red/Green", "33", "8", "Green/Red" ], [ "Red/Brown", "34", "9", "Brown/Red" ], [ "Red/Slate", "35", "10", "Slate/Red" ], [ "Black/Blue", "36", "11", "Blue/Black" ], [ "Black/Orange", "37", "12", "Orange/Black" ], [ "Black/Green", "38", "13", "Green/Black" ], [ "Black/Brown", "39", "14", "Brown/Black" ], [ "Black/Slate", "40", "15", "Slate/Black" ], [ "Yellow/Blue", "41", "16", "Blue/Yellow" ], [ "Yellow/Orange", "42", "17", "Orange/Yellow" ], [ "Yellow/Green", "43", "18", "Green/Yellow" ], [ "Yellow/Brown", "44", "19", "Brown/Yellow" ], [ "Yellow/Slate", "45", "20", "Slate/Yellow" ], [ "Violet/Blue", "46", "21", "Blue/Violet" ], [ "Violet/Orange", "47", "22", "Orange/Violet" ], [ "Violet/Green", "48", "23", "Green/Violet" ], [ "Violet/Brown", "49", "24", "Brown/Violet" ], [ "Violet/Slate", "50", "25", "Slate/Violet" ] ], "title": "", "original_id": "1e0891ff9db2d97d00d2b1f5d12142cd" }, { "_id": "40a5d87e10b3e61f7cb3383e343344dd", "header": [ "Year", "Single", "US Chart position", "Label", "Catalogue No." ], "rows": [ [ "1942", "\"Cow-Cow Boogie\"", "9", "Capitol", "102" ], [ "1942", "\"Mr. Five by Five\"", "10", "Capitol", "115" ], [ "1943", "\"Get On Board Little Chillun\"", "17 (R&B)", "Capitol", "133" ], [ "1943", "\"Shoo Shoo Baby\"", "4", "Capitol", "143" ], [ "1944", "\"No Love, No Nothin’\"", "4", "Capitol", "143" ], [ "1944", "\"Tess' Torch Song\"", "11", "Capitol", "151" ], [ "1944", "\"Milkman, Keep Those Bottles Quiet\"", "7", "Capitol", "151" ], [ "1944", "\"The Patty Cake Man\"", "10", "Capitol", "163" ], [ "1945", "\"Captain Kidd\"", "17", "Capitol", "193" ], [ "1946", "\"Buzz Me\"", "15", "Capitol", "226" ], [ "1946", "\"The House of Blue Lights\"", "8 (R&B)", "Capitol", "251" ], [ "1952", "\"The Blacksmith Blues\"", "3", "Capitol", "1922" ], [ "1952", "\"Oakie Boogie\"", "23", "Capitol", "2072" ], [ "1953", "\"40 Cups of Coffee\"", "26", "Capitol", "2539" ] ], "title": "", "original_id": "60effd85ac81cca8bbca69134e0b73a5" }, { "_id": "7f44733802c769610d2d5322e681352a", "header": [ "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "germany", "7", "4", "5", "16" ], [ "france", "1", "4", "1", "6" ], [ "united states", "1", "2", "1", "4" ], [ "netherlands", "1", "1", "3", "5" ], [ "united kingdom", "1", "1", "1", "3" ], [ "switzerland", "1", "-", "1", "2" ], [ "denmark", "1", "-", "-", "1" ], [ "new zealand", "1", "-", "-", "1" ], [ "belgium", "-", "1", "-", "1" ], [ "spain", "-", "1", "-", "1" ], [ "australia", "-", "-", "1", "1" ], [ "sweden", "-", "-", "1", "1" ] ], "title": "", "original_id": "d36f751dac69318f27f101ed13b4710a" }, { "_id": "7511b8a0bc286bbed5e31d3e7877a09b", "header": [ "region", "total population", "manchu", "percentage in manchu population", "regional percentage of population" ], "rows": [ [ "total", "1335110869", "10410585", "100", "0.77" ], [ "total (in all 31 provincial regions)", "1332810869", "10387958", "99.83", "0.78" ], [ "northeast", "109513129", "6951280", "66.77", "6.35" ], [ "north", "164823663", "3002873", "28.84", "1.82" ], [ "east", "392862229", "122861", "1.18", "0.03" ], [ "south central", "375984133", "120424", "1.16", "0.03" ], [ "northwest", "96646530", "82135", "0.79", "0.08" ], [ "southwest", "192981185", "57785", "0.56", "0.03" ], [ "liaoning", "43746323", "5336895", "51.26", "12.2" ], [ "hebei", "71854210", "2118711", "20.35", "2.95" ], [ "jilin", "27452815", "866365", "8.32", "3.16" ], [ "heilongjiang", "38313991", "748020", "7.19", "1.95" ], [ "inner mongolia", "24706291", "452765", "4.35", "2.14" ], [ "beijing", "19612368", "336032", "3.23", "1.71" ], [ "tianjin", "12938693", "83624", "0.80", "0.65" ], [ "henan", "94029939", "55493", "0.53", "0.06" ], [ "shandong", "95792719", "46521", "0.45", "0.05" ], [ "guangdong", "104320459", "29557", "0.28", "0.03" ], [ "shanghai", "23019196", "25165", "0.24", "0.11" ], [ "ningxia", "6301350", "24902", "0.24", "0.4" ], [ "guizhou", "34748556", "23086", "0.22", "0.07" ], [ "xinjiang", "21815815", "18707", "0.18", "0.09" ], [ "jiangsu", "78660941", "18074", "0.17", "0.02" ], [ "shaanxi", "37327379", "16291", "0.16", "0.04" ], [ "sichuan", "80417528", "15920", "0.15", "0.02" ], [ "gansu", "25575263", "14206", "0.14", "0.06" ], [ "yunnan", "45966766", "13490", "0.13", "0.03" ], [ "hubei", "57237727", "12899", "0.12", "0.02" ], [ "shanxi", "25712101", "11741", "0.11", "0.05" ], [ "zhejiang", "54426891", "11271", "0.11", "0.02" ], [ "guangxi", "46023761", "11159", "0.11", "0.02" ], [ "anhui", "59500468", "8516", "0.08", "0.01" ], [ "fujian", "36894217", "8372", "0.08", "0.02" ], [ "qinghai", "5626723", "8029", "0.08", "0.14" ], [ "hunan", "65700762", "7566", "0.07", "0.01" ], [ "jiangxi", "44567797", "4942", "0.05", "0.01" ], [ "chongqing", "28846170", "4571", "0.04", "0.02" ], [ "hainan", "8671485", "3750", "0.04", "0.04" ], [ "tibet", "3002165", "718", "<0.01", "0.02" ], [ "active servicemen", "2300000", "22627", "0.24", "1.05" ] ], "title": "", "original_id": "3ba617b11797d522d5c51bdb6d6cd313" }, { "_id": "0bafc43820077767aab46745b3d89eb0", "header": [ "rank", "rank fortune 500", "name", "headquarters", "revenue (millions)", "profit (millions)", "employees", "industry" ], "rows": [ [ "1", "17", "sinopec", "beijing", "131636.0", "3703.1", "681900", "oil" ], [ "2", "24", "china national petroleum", "beijing", "110520.2", "13265.3", "1086966", "oil" ], [ "3", "29", "state grid corporation", "beijing", "107185.5", "2237.7", "1504000", "utilities" ], [ "4", "170", "industrial and commercial bank of china", "beijing", "36832.9", "6179.2", "351448", "banking" ], [ "5", "180", "china mobile limited", "beijing", "35913.7", "6259.7", "130637", "telecommunications" ], [ "6", "192", "china life insurance", "beijing", "33711.5", "173.9", "77660", "insurance" ], [ "7", "215", "bank of china", "beijing", "30750.8", "5372.3", "232632", "banking" ], [ "8", "230", "china construction bank", "beijing", "28532.3", "5810.3", "297506", "banking" ], [ "9", "237", "china southern power grid", "guangzhou", "27966.1", "1074.1", "178053", "utilities" ], [ "10", "275", "china telecom", "beijing", "24791.3", "2279.7", "400299", "telecommunications" ], [ "11", "277", "agricultural bank of china", "beijing", "24475.5", "728.4", "452464", "banking" ], [ "12", "290", "hutchison whampoa", "hong kong", "23661.0", "2578.3", "220000", "various sectors" ], [ "13", "299", "sinochem corporation", "beijing", "23109.2", "344.7", "20343", "various sectors" ], [ "14", "307", "baosteel", "shanghai", "22663.4", "1622.2", "91308", "steel" ], [ "15", "342", "china railway engineering", "beijing", "20520.4", "142.6", "275866", "railway" ], [ "16", "384", "china railway construction", "beijing", "18735.7", "70.2", "245540", "railway" ], [ "17", "385", "first automotive works", "changchun", "18710.7", "70.0", "136010", "automobile" ], [ "18", "396", "china state construction", "beijing", "18163.2", "281.3", "294309", "construction" ], [ "19", "402", "saic motor", "shanghai", "18010.1", "89.7", "72416", "automobile" ], [ "20", "405", "cofco limited", "beijing", "17953.2", "281.0", "82481", "various sectors" ], [ "21", "435", "china minmetals", "beijing", "16902.2", "154.4", "32594", "metal trading" ], [ "22", "457", "jardine matheson", "hong kong / hamilton", "16281.0", "1348.0", "240000", "various sectors" ], [ "23", "469", "china national offshore oil", "beijing", "16038.9", "3007.1", "44000", "oil" ], [ "24", "488", "china ocean shipping", "beijing", "15413.5", "1092.9", "79616", "shipping" ] ], "title": "", "original_id": "e64c2ddce62c76ba41e5c576b72b1ac4" }, { "_id": "49aab8952a096ac2b5fdfdfe7287bca6", "header": [ "rank by average", "place", "couple", "total points", "number of dances", "average" ], "rows": [ [ "1", "1", "brooke & derek", "433", "16", "27.1" ], [ "2", "2", "warren & kym", "397", "16", "24.8" ], [ "3", "3", "lance & lacey", "392", "16", "24.5" ], [ "4", "5", "maurice & cheryl", "252", "11", "22.9" ], [ "5", "4", "cody & julianne", "292", "13", "22.5" ], [ "6", "8", "toni b & alec", "134", "6", "22.3" ], [ "7", "6", "susan & tony d", "192", "9", "21.3" ], [ "8", "10", "misty & maksim", "63", "3", "21.0" ], [ "9", "12", "ted & inna", "37", "2", "18.5" ], [ "10", "11", "kim k & mark", "54", "3", "18.0" ], [ "11", "9", "rocco & karina", "89", "5", "17.8" ], [ "12", "7", "cloris & corky", "121", "7", "17.3" ] ], "title": "", "original_id": "521d1b7034109e2055b6a1c236319eb3" }, { "_id": "a7d4bfc6aa0179a57447a059ae3d06e7", "header": [ "rank", "city", "population", "area (km 2 )", "density (inhabitants / km 2 )", "altitude (mslm)" ], "rows": [ [ "1st", "alessandria", "94191", "203.97", "461.8", "95" ], [ "2nd", "casale monferrato", "36039", "86.32", "417.5", "116" ], [ "3rd", "novi ligure", "28581", "54.22", "527.1", "197" ], [ "4th", "tortona", "27476", "99.29", "276.7", "122" ], [ "5th", "acqui terme", "20426", "33.42", "611.2", "156" ], [ "6th", "valenza", "20282", "50.05", "405.2", "125" ], [ "7th", "ovada", "11912", "35.33", "337.2", "186" ], [ "8th", "serravalle scrivia", "6445", "16.02", "402.3", "225" ], [ "9th", "arquata scrivia", "6260", "30.36", "206.2", "248" ], [ "10th", "castelnuovo scrivia", "5473", "45.42", "120.5", "85" ] ], "title": "", "original_id": "1274eebbc02e9c74547f94c43fbd5cdb" }, { "_id": "dfc463b445679f6a3bccf5a573602c53", "header": [ "region of ussr", "number of families", "number of people", "average family size", "% of total deportees" ], "rows": [ [ "amur oblast", "2028", "5451", "2.7", "5.8" ], [ "irkutsk oblast", "8475", "25834", "3.0", "27.3" ], [ "krasnoyarsk krai", "3671", "13823", "3.8", "14.6" ], [ "novosibirsk oblast", "3152", "10064", "3.2", "10.6" ], [ "omsk oblast", "7944", "22542", "2.8", "23.8" ], [ "tomsk oblast", "5360", "16065", "3.0", "16.9" ] ], "title": "", "original_id": "dd391b7413df643849f40644296aab34" }, { "_id": "27c21efdb35cc2a37c60eacba8cc72a4", "header": [ "index", "organization", "year", "rank", "out of" ], "rows": [ [ "bribe payers index", "transparency international", "2011", "19", "28" ], [ "corruption perceptions index", "transparency international", "2012", "37", "176" ], [ "democracy index", "economist intelligence unit", "2010", "36", "167" ], [ "ease of doing business index", "world bank", "2012", "16", "185" ], [ "economic freedom index", "fraser institute", "2010", "15", "144" ], [ "economic freedom index", "the heritage foundation", "2013", "20", "177" ], [ "global competitiveness report", "world economic forum", "20122013", "13", "144" ], [ "global peace index", "institute for economics and peace", "2011", "27", "153" ], [ "globalization index", "at kearney / foreign policy magazine", "2006", "35", "62" ], [ "press freedom index", "reporters without borders", "2013", "47", "179" ], [ "property rights index", "property rights alliance", "2008", "28", "115" ] ], "title": "", "original_id": "9f6acb3e258123c6d0841b052d95505f" }, { "_id": "aa2b4321fcb97aaa6b241da874ae2f49", "header": [ "year", "indians admitted", "pakistanis admitted", "sri lankans admitted", "bangladeshis admitted", "nepalis admitted" ], "rows": [ [ "2000", "26122", "14201", "5849", "2715", "247" ], [ "2001", "27901", "15353", "5520", "3393", "273" ], [ "2002", "28838", "14173", "4968", "2615", "418" ], [ "2003", "24595", "12351", "4448", "1896", "440" ], [ "2004", "25573", "12793", "4134", "3374", "594" ], [ "2005", "22141", "13575", "4690", "3940", "714" ], [ "2006", "30746", "12329", "4490", "3838", "640" ], [ "2007", "26047", "9545", "3934", "2735", "564" ], [ "2008", "24548", "8051", "4508", "2716", "639" ], [ "2009", "26117", "6213", "4270", "4270", "627" ], [ "2010", "30252", "4986", "4181", "4364", "1502" ], [ "2011", "24965", "6073", "3104", "2449", "1249" ], [ "2012", "28943", "9931", "3152", "2449", "1311" ] ], "title": "", "original_id": "651dfed1dce61e46914adf0a239b0c9a" }, { "_id": "03fbc7be5d0984924abcd6660b3a1e05", "header": [ "states", "males (%)", "males rank", "females (%)", "females rank" ], "rows": [ [ "india", "12.1", "14", "16.0", "15" ], [ "punjab", "30.3", "1", "37.5", "1" ], [ "kerala", "24.3", "2", "34.0", "2" ], [ "goa", "20.8", "3", "27.0", "3" ], [ "tamil nadu", "19.8", "4", "24.4", "4" ], [ "andhra pradesh", "17.6", "5", "22.7", "10" ], [ "sikkim", "17.3", "6", "21.0", "8" ], [ "mizoram", "16.9", "7", "20.3", "17" ], [ "himachal pradesh", "16.0", "8", "19.5", "12" ], [ "maharashtra", "15.9", "9", "18.1", "13" ], [ "gujarat", "15.4", "10", "17.7", "7" ], [ "haryana", "14.4", "11", "17.6", "6" ], [ "karnataka", "14.0", "12", "17.3", "9" ], [ "manipur", "13.4", "13", "17.1", "11" ], [ "uttarakhand", "11.4", "15", "14.8", "14" ], [ "arunachal pradesh", "10.6", "16", "12.5", "19" ], [ "uttar pradesh", "9.9", "17", "12.0", "18" ], [ "jammu and kashmir", "8.7", "18", "11.1", "5" ], [ "bihar", "8.5", "19", "10.5", "29" ], [ "nagaland", "8.4", "20", "10.2", "22" ], [ "rajasthan", "8.4", "20", "9.0", "20" ], [ "meghalaya", "8.2", "22", "8.9", "26" ], [ "orissa", "6.9", "23", "8.6", "25" ], [ "assam", "6.7", "24", "7.8", "21" ], [ "chattisgarh", "6.5", "25", "7.6", "27" ], [ "west bengal", "6.1", "26", "7.1", "16" ], [ "madhya pradesh", "5.4", "27", "6.7", "23" ], [ "jharkhand", "5.3", "28", "5.9", "28" ] ], "title": "", "original_id": "b6219d257925aa2abc3e4511e5a2ac16" }, { "_id": "ae75b33db4efba6c307e1e829e429595", "header": [ "Age Group", "Both Gender", "%", "Male", "%", "Female", "%" ], "rows": [ [ "All Ages", "32,512", "100.00", "16,390", "50.41", "16, 122", "49.59" ], [ "Under 1", "1,053", "3.24", "531", "3.24", "522", "3.24" ], [ "1 - 2", "1,281", "3.94", "654", "3.99", "627", "3.89" ], [ "3 - 4", "1,889", "5.81", "970", "5.92", "919", "5.70" ], [ "5 - 6", "1,892", "5.82", "990", "6.04", "902", "5.60" ], [ "7 - 9", "2,877", "8.85", "1,480", "9.03", "1,397", "8.67" ], [ "10 - 14", "4,428", "13.62", "2,293", "13.99", "2,135", "13.24" ], [ "15 - 17", "2,396", "7.37", "1,260", "7.69", "1,136", "7.04" ], [ "18 - 21", "2,656", "8.17", "1,287", "7.85", "1,370", "8.50" ], [ "22 - 35", "5,673", "17.45", "2,840", "17.33", "2,833", "17.57" ], [ "36 - 45", "3,352", "10.31", "1,660", "10.13", "1,692", "10.49" ], [ "46 - 59", "2,923", "8.99", "1,442", "8.80", "1,481", "9.18" ], [ "60 & above", "2,091", "6.43", "982", "5.99", "1,109", "6.88" ], [ "TOTAL", "32,512", "100.00", "16,390", "100.00", "16,122", "100.00" ] ], "title": "", "original_id": "b24100d2cb5ed9ab25a7fdadf8258089" }, { "_id": "4d9509c8294a9d2ed84fcf4dfbe622b7", "header": [ "driver", "car", "make", "points", "laps", "winnings" ], "rows": [ [ "kasey kahne", "9", "dodge", "185", "334", "530164" ], [ "matt kenseth", "17", "ford", "175", "334", "362491" ], [ "tony stewart", "20", "chevrolet", "175", "334", "286386" ], [ "denny hamlin", "11", "chevrolet", "165", "334", "208500" ], [ "kevin harvick", "29", "chevrolet", "160", "334", "204511" ], [ "jeff burton", "31", "chevrolet", "150", "334", "172220" ], [ "scott riggs", "10", "dodge", "146", "334", "133850" ], [ "martin truex jr", "1", "chevrolet", "147", "334", "156608" ], [ "mark martin", "6", "ford", "143", "334", "151850" ], [ "bobby labonte", "43", "dodge", "134", "334", "164211" ], [ "jimmie johnson", "48", "chevrolet", "130", "334", "165161" ], [ "dale earnhardt jr", "8", "chevrolet", "127", "334", "154816" ], [ "reed sorenson", "41", "dodge", "124", "334", "126675" ], [ "casey mears", "42", "dodge", "121", "334", "150233" ], [ "kyle busch", "5", "chevrolet", "118", "334", "129725" ], [ "ken schrader", "21", "ford", "115", "334", "140089" ], [ "dale jarrett", "88", "ford", "112", "334", "143350" ], [ "jeff green", "66", "chevrolet", "114", "334", "133833" ], [ "clint bowyer", "7", "chevrolet", "106", "333", "116075" ], [ "robby gordon", "7", "chevrolet", "103", "333", "109275" ], [ "david stremme", "40", "dodge", "100", "333", "127033" ], [ "jeff gordon", "24", "chevrolet", "97", "332", "148411" ], [ "joe nemechek", "1", "chevrolet", "94", "332", "129070" ], [ "tony raines", "96", "chevrolet", "91", "332", "97075" ], [ "terry labonte", "44", "chevrolet", "88", "332", "95975" ], [ "michael waltrip", "55", "dodge", "85", "331", "108833" ], [ "travis kvapil", "32", "chevrolet", "82", "331", "105122" ], [ "scott wimmer", "4", "chevrolet", "79", "330", "94075" ], [ "dave blaney", "22", "dodge", "76", "330", "92475" ], [ "sterling marlin", "14", "chevrolet", "73", "329", "89325" ], [ "jeremy mayfield", "19", "dodge", "70", "328", "116891" ], [ "kevin lepage", "61", "ford", "67", "328", "85800" ], [ "elliott sadler", "38", "ford", "69", "286", "113558" ], [ "kurt busch", "2", "dodge", "61", "286", "124633" ], [ "jj yeley", "18", "chevrolet", "63", "270", "118075" ], [ "carl edwards", "99", "ford", "60", "256", "101175" ], [ "jamie mcmurray", "26", "ford", "52", "254", "127100" ], [ "mike garvey", "151", "chevrolet", "49", "251", "79125" ], [ "kyle petty", "45", "dodge", "46", "248", "87000" ], [ "ryan newman", "12", "dodge", "43", "200", "124283" ], [ "derrike cope", "74", "dodge", "pe", "169", "78760" ], [ "greg biffle", "16", "ford", "42", "81", "98860" ], [ "brian vickers", "25", "chevrolet", "34", "24", "86847" ] ], "title": "", "original_id": "1307e6264752997dde75a6bd237b9e28" }, { "_id": "6b542652fc6f945ef14213675f0526c8", "header": [ "# in office", "Governor", "Days", "Rank" ], "rows": [ [ "11", "Calvin L. Rampton", "4,382", "1" ], [ "14", "Mike Leavitt", "3,957", "2" ], [ "17", "Gary Herbert", "3,544", "3" ], [ "1", "Heber Manning Wells", "3,283", "4" ], [ "7", "Henry H. Blood", "2,926", "5" ], [ "9", "J. Bracken Lee", "2,926", "5" ], [ "12", "Scott M. Matheson", "2,926", "5" ], [ "3", "William Spry", "2,919", "8" ], [ "6", "George Dern", "2,919", "8" ], [ "8", "Herbert B. Maw", "2,919", "8" ], [ "10", "George Dewey Clyde", "2,919", "8" ], [ "13", "Norman H. Bangerter", "2,919", "8" ], [ "16", "Jon Huntsman, Jr.", "1,681", "13" ], [ "2", "John Christopher Cutler", "1,463", "14" ], [ "4", "Simon Bamberger", "1,463", "14" ], [ "5", "Charles R. Mabey", "1,463", "14" ], [ "15", "Olene S. Walker", "425", "17" ] ], "title": "", "original_id": "c5e88a53c5cf14366e0d42de7eb6ab13" }, { "_id": "acb071f988c7614978818a7021575eda", "header": [ "-", "Theme", "Films", "Participants", "Cities", "Countries", "Jury" ], "rows": [ [ "2011", "Small things in life", "86", "620", "14", "1", "Sanjay Gadhvi, Ashish Kakkad" ], [ "2012", "Ingredients of good living", "121", "1,510", "22", "1", "Shoojit Sircar, Vikramaditya Motwane, Komal Nahta, Rajesh Mapuskar" ], [ "2013", "India can change", "322", "4,270", "44", "3", "Tigmanshu Dhulia, Nikhil Advani, Bejoy Nambiar" ], [ "2014", "Progress has many meanings", "619", "10,600", "122", "11", "Shyam Benegal, Hansal Mehta, Omung Kumar, Umesh Shukla" ], [ "2015", "There is a twist in the end", "700+", "14,400", "184", "18", "Ketan Mehta, Onir, Raja Sen, Guneet Monga" ], [ "2016", "Top of the world", "1,220", "23,600", "242", "20", "Madhur Bhandarkar, Sriram Raghavan, Nagesh Kukunoor, Vetrimaaran" ], [ "2017", "Everything is connected", "1,503", "29,000", "262", "18", "Ram Madhvani, Aniruddha Roy Chowdhury, Vipul Amrutlal Shah" ], [ "2018", "Professional Category - A story of Change Amateur Category - Experience Change Mobile Category - Precaution is better than Cure", "1,550", "32,000", "300", "30", "Sudhir Mishra, Milan Luthria, RS Prasanna" ] ], "title": "", "original_id": "4ee382645d542fe6e3f05e71925c5cb8" }, { "_id": "cf3dd648ee072f0feb478f7861bb8fc1", "header": [ "year", "theme", "artist", "mintage", "issue price" ], "rows": [ [ "2002", "15th anniversary loonie", "dora de pãdery - hunt", "67672", "39.95" ], [ "2004", "jack miner bird sanctuary", "susan taylor", "46493", "39.95" ], [ "2005", "tufted puffin", "n / a", "39818", "39.95" ], [ "2006", "snowy owl", "glen loates", "39935", "44.95" ], [ "2007", "trumpeter swan", "kerri burnett", "40000", "45.95" ], [ "2008", "common eider", "mark hobson", "40000", "47.95" ], [ "2009", "great blue heron", "chris jordison", "40000", "47.95" ], [ "2010", "northern harrier", "arnold nogy", "35000", "49.95" ], [ "2011", "great gray owl", "arnold nogy", "35000", "49.95" ], [ "2012", "25th anniversary loonie", "arnold nogy", "35000", "49.95" ] ], "title": "", "original_id": "f05eecdcb6b316d67cfcdee33a48b838" }, { "_id": "6e87572a6fa85b9b02c8cd32a2d859b9", "header": [ "election", "of candidates nominated", "of seats won", "of total votes", "% of popular vote" ], "rows": [ [ "1945", "203", "65", "1448744", "27.62%" ], [ "1949", "249", "41", "1734261", "29.62%" ], [ "1953", "248", "50", "1749579", "31.01%" ], [ "1957", "256", "109", "2564732", "38.81%" ], [ "1958", "265", "208", "3908633", "53.56%" ], [ "1962", "265", "114", "2865542", "37.22%" ], [ "1963", "265", "93", "2582322", "32.72%" ], [ "1965", "265", "95", "2500113", "32.41%" ], [ "1968", "262", "72", "2548949", "31.36%" ], [ "1972", "265", "107", "3388980", "35.02%" ], [ "1974", "264", "95", "3371319", "35.46%" ], [ "1979", "282", "136", "4111606", "35.89%" ], [ "1980", "282", "103", "3552994", "32.49%" ], [ "1984", "282", "211", "6278818", "50.03%" ], [ "1988", "295", "169", "5667543", "43.02%" ], [ "1993", "295", "2", "2178303", "16.04%" ], [ "1997", "301", "20", "2446705", "18.84%" ], [ "2000", "291", "12", "1566994", "12.19%" ] ], "title": "", "original_id": "c2d0e0b5e2f5835d65687912d1ad3d7c" }, { "_id": "39cf9fb5c3b815418e803f9968f51d8b", "header": [ "south american rank", "world rank", "nation", "2011 (imf)", "2008 (cia factbook)" ], "rows": [ [ "1", "51", "argentina", "17376", "14500" ], [ "2", "55", "chile", "16171", "15400" ], [ "3", "59", "uruguay", "15469", "12300" ], [ "4", "71", "venezuela", "12407", "13500" ], [ "5", "74", "brazil", "11845", "10513" ], [ "6", "82", "colombia", "10155", "9000" ], [ "7", "83", "peru", "10000", "8500" ], [ "8", "86", "suriname", "9492", "8900" ], [ "9", "91", "ecuador", "8335", "7700" ], [ "10", "96", "guyana", "7541", "4000" ], [ "11", "110", "paraguay", "5548", "4400" ] ], "title": "", "original_id": "e3cdc02ff933ead57a5ddd0f4dc189c2" }, { "_id": "7e5213dfe3efb175704186d794f87439", "header": [ "country", "area km square", "population", "population density per km square", "hdi (2011)", "capital" ], "rows": [ [ "china (prc)", "9640011", "1339724852", "138", "0.699", "beijing" ], [ "hong kong (prc)", "1104", "7061200", "6390", "0.898", "hong kong" ], [ "japan", "377930", "127950000", "337", "0.901", "tokyo" ], [ "macau (prc)", "30", "556800", "18662", "no data", "macau" ], [ "mongolia", "1564100", "2809600", "2", "0.653", "ulaanbaatar" ], [ "north korea", "120538", "24346000", "198", "no data", "pyongyang" ], [ "south korea", "100210", "48988833", "500", "0.897", "seoul" ] ], "title": "", "original_id": "fd3ba4c9889705553735f6144bc72739" }, { "_id": "0743ed491d311559a4f7c0689e959351", "header": [ "rank", "heat", "lane", "name", "nationality", "time" ], "rows": [ [ "1", "2", "4", "jason lezak", "united states", "48.51" ], [ "2", "1", "4", "filippo magnini", "italy", "48.6" ], [ "3", "2", "5", "pieter van den hoogenband", "netherlands", "48.72" ], [ "4", "2", "3", "brent hayden", "canada", "48.79" ], [ "5", "2", "6", "eamon sullivan", "australia", "48.86" ], [ "6", "1", "6", "ryk neethling", "south africa", "48.87" ], [ "6", "2", "2", "cãsar cielo filho", "brazil", "48.87" ], [ "6", "2", "8", "roland schoeman", "south africa", "48.87" ], [ "9", "1", "5", "alain bernard", "france", "48.89" ], [ "10", "1", "2", "stefan nystrand", "sweden", "48.92" ], [ "11", "2", "7", "albert subirats altes", "venezuela", "49.17" ], [ "12", "1", "3", "simon burnett", "great britain", "49.22" ], [ "13", "1", "7", "dominik meichtry", "switzerland", "49.27" ], [ "14", "1", "8", "christian galenda", "italy", "49.31" ], [ "15", "1", "1", "mitja zastrow", "netherlands", "49.41" ], [ "16", "2", "1", "ashley callus", "australia", "49.45" ] ], "title": "", "original_id": "c195eb7689321829b33cdc40c5931ad3" }, { "_id": "685f73872de9ece8922a6820b0ead0b6", "header": [ "nbr class", "type", "introduced", "driving wheel", "total", "extinct" ], "rows": [ [ "141", "2 - 4 - 0", "1869", "ft6in (mm)", "2", "1915" ], [ "38", "2 - 4 - 0", "1869", "ft0in (mm)", "1", "1912" ], [ "418", "2 - 4 - 0", "1873", "ft0in (mm)", "8", "1927" ], [ "40", "2 - 4 - 0", "1873", "ft0in (mm)", "2", "1903" ], [ "224", "4 - 4 - 0", "1871", "ft6in (mm)", "2", "1919" ], [ "420", "4 - 4 - 0", "1873", "ft6in (mm)", "4", "1918" ], [ "251", "0 - 6 - 0", "1867", "ft3in (mm)", "38", "1924" ], [ "56", "0 - 6 - 0", "1868", "ft0in (mm)", "8", "1914" ], [ "17", "0 - 6 - 0", "1869", "ft6in (mm)", "1", "1914" ], [ "396", "0 - 6 - 0", "1867", "ft0in (mm)", "88", "1937" ], [ "293", "0 - 6 - 0", "1872", "ft0in (mm)", "1", "1907" ], [ "357", "0 - 4 - 0", "1868", "ft3in (mm)", "2", "1925" ], [ "226", "0 - 6 - 0st", "1870", "ft0in (mm)", "2", "1924" ], [ "229", "0 - 6 - 0st", "1871", "ft0in (mm)", "15", "1924" ], [ "112", "0 - 6 - 0st", "1870", "ft6in (mm)", "3", "1910" ], [ "282", "0 - 6 - 0st", "1866", "ft1in (mm)", "3", "1921" ], [ "130", "0 - 6 - 0st", "1870", "ft3in (mm)", "10", "1924" ], [ "32", "0 - 6 - 0st", "1874", "ft6in (mm)", "6", "1907" ], [ "18", "0 - 4 - 0st", "1872", "ft0in (mm)", "2", "1906" ] ], "title": "", "original_id": "68abb88ce95a7853db80f4df14284e88" }, { "_id": "eec5ad9962ccb889e28f9c0b4404fbe2", "header": [ "rank", "team name", "basic elements", "tumbling", "stunts", "tosses / pyramids", "deductions", "total" ], "rows": [ [ "1", "school of saint anthony ssa seagulls", "61.5", "66.5", "67.5", "69.5", "(13)", "252.0" ], [ "2", "school of the holy spirit shs pep squad", "64.5", "63.0", "66.0", "64.5", "(15)", "243.0" ], [ "5", "pcc pep squad", "55.0", "49.0", "65.0", "64.0", "(26)", "207.0" ], [ "6", "assumption college ac hardcourt", "59.0", "53.0", "62.0", "48.5", "(37)", "185.5" ], [ "8", "the cmic fighting vanguards", "47.0", "36.5", "57.5", "56.5", "(35)", "162.5" ], [ "9", "de la salle zobel dlsz pep squad and cheerdancers", "46.5", "44.5", "54.0", "44.0", "(27)", "162.0" ] ], "title": "", "original_id": "accf35669852e1aaaf42099aaeb188bb" }, { "_id": "65d1f1fe9023c68a2715459026950ccc", "header": [ "rank", "english title", "chinese title", "average", "peak", "premiere", "finale", "hk viewers" ], "rows": [ [ "1", "la femme desperado", "女人唔易做", "33", "41", "31", "34", "2.14 million" ], [ "2", "forensic heroes", "法證先鋒", "33", "43", "28", "37", "2.11 million" ], [ "3", "the saviour of the soul", "神鵰俠侶", "32", "40", "32", "35", "2.07 million" ], [ "4", "love guaranteed", "愛情全保", "32", "36", "30", "34", "2.07 million" ], [ "5", "bar bender", "潮爆大狀", "32", "38", "31", "34", "2.06 million" ], [ "6", "the dance of passion", "火舞黃沙", "32", "38", "34", "35", "2.05 million" ], [ "7", "maiden 's vow", "鳳凰四重奏", "32", "37", "32", "29", "2.05 million" ], [ "8", "to grow with love", "肥田囍事", "32", "35", "32", "32", "2.04 million" ], [ "9", "men in pain", "男人之苦", "32", "39", "28", "33", "2.03 million" ], [ "10", "under the canopy of love", "天幕下的戀人", "31", "37", "28", "33", "2.02 million" ] ], "title": "", "original_id": "552dcdcf1bd1de6d19d74f2ecab53af8" }, { "_id": "23414d8bf1e06ae55b4f42b911e5cf30", "header": [ "series", "season", "title", "directed by", "written by", "original air date", "production code", "us viewers (million)" ], "rows": [ [ "118", "1", "my mirror image (part 2)", "john inwood", "tim hobert", "november 30 , 2006", "601", "8.45" ], [ "119", "2", "my best friend 's baby 's baby and my baby 's baby", "gail mancuso", "neil goldman & garrett donovan", "december 7 , 2006", "603", "8.43" ], [ "120", "3", "my coffee", "rick blue", "tad quill", "december 14 , 2006", "602", "7.78" ], [ "121", "4", "my house", "john putch", "bill callahan", "january 4 , 2007", "604", "7.33" ], [ "122", "5", "my friend with money", "john michel", "gabrielle allan", "january 11 , 2007", "605", "7.33" ], [ "123", "6", "my musical", "will mackenzie", "debra fordham", "january 18 , 2007", "607", "6.57" ], [ "124", "7", "his story iv", "linda mendoza", "mike schwartz", "february 1 , 2007", "606", "6.88" ], [ "125", "8", "my road to nowhere", "mark stegemann", "mark stegemann", "february 8 , 2007", "608", "6.22" ], [ "126", "9", "my perspective", "john putch", "angela nissel", "february 15 , 2007", "609", "6.26" ], [ "127", "10", "my therapeutic month", "ken whittingham", "aseem batra", "february 22 , 2007", "610", "5.69" ], [ "128", "11", "my night to remember", "richard davis", "debra fordham", "march 1 , 2007", "614", "6.8" ], [ "129", "12", "my fishbowl", "chris koch", "kevin biegel", "march 8 , 2007", "611", "5.89" ], [ "130", "13", "my scrubs", "john putch", "clarence livingston", "march 15 , 2007", "612", "6.37" ], [ "131", "14", "my no good reason (part 1)", "zach braff", "janae bakken", "march 22 , 2007", "613", "6.48" ], [ "132", "15", "my long goodbye (part 2)", "victor nelli , jr", "dave tennant", "april 5 , 2007", "615", "4.89" ], [ "133", "16", "my words of wisdom", "victor nelli , jr", "eric weinberg", "april 12 , 2007", "616", "5.02" ], [ "134", "17", "their story", "richard alexander wells", "andy schwartz", "april 19 , 2007", "617", "5.56" ], [ "135", "18", "my turf war", "bill lawrence", "sean russell", "april 26 , 2007", "618", "4.65" ], [ "136", "19", "my cold shower", "john inwood", "janae bakken", "may 3 , 2007", "619", "4.95" ], [ "137", "20", "my conventional wisdom", "michael mcdonald", "bill callahan", "may 10 , 2007", "620", "5.31" ], [ "138", "21", "my rabbit (part 1)", "john putch", "kevin biegel & aseem batra", "may 17 , 2007", "621", "5.21" ] ], "title": "", "original_id": "a4f6d7cb86e12d536c41b2a9a6bab3d2" }, { "_id": "96e5153c3f93c29850e839163d010983", "header": [ "series", "presenters", "start date", "end date", "days in camp", "camp mates", "winner", "highest viewers (millions)", "lowest viewers (millions)", "average viewers (millions)" ], "rows": [ [ "one", "ant & dec", "25 august 2002", "8 september 2002", "15", "8", "tony blackburn", "10.95", "6.14", "7.58" ], [ "two", "ant & dec", "28 april 2003", "12 may 2003", "15", "10", "phil tufnell", "12.75", "5.15", "8.55" ], [ "three", "ant & dec", "26 january 2004", "9 february 2004", "16", "10", "kerry katona", "14.99", "8.96", "11.02" ], [ "four", "ant & dec", "21 november 2004", "6 december 2004", "18", "11", "joe pasquale", "11.43", "7.04", "8.66" ], [ "five", "ant & dec", "20 november 2005", "5 december 2005", "18", "12", "carol thatcher", "12.35", "7.69", "9.42" ], [ "six", "ant & dec", "13 november 2006", "1 december 2006", "19", "12", "matt willis", "10.05", "6.97", "8.01" ], [ "seven", "ant & dec", "12 november 2007", "30 november 2007", "20", "11", "christopher biggins", "8.84", "5.0", "7.34" ], [ "eight", "ant & dec", "16 november 2008", "5 december 2008", "21", "12", "joe swash", "10.19", "7.91", "8.78" ], [ "nine", "ant & dec", "15 november 2009", "4 december 2009", "21", "13", "gino d'acampo", "10.86", "7.86", "9.37" ], [ "ten", "ant & dec", "14 november 2010", "4 december 2010", "21", "13", "stacey solomon", "13.48", "6.68", "9.7" ], [ "eleven", "ant & dec", "13 november 2011", "3 december 2011", "21", "13", "dougie poynter", "11.8", "6.8", "9.74" ], [ "twelve", "ant & dec", "11 november 2012", "1 december 2012", "21", "12", "charlie brooks", "11.51", "7.81", "9.81" ] ], "title": "", "original_id": "c83997f5fbd697a85059649fdfb3293d" }, { "_id": "1ede6f32a9759542203ac96c626de14b", "header": [ "district", "s barangay", "population (2010 census)", "area ( has )", "pop density (per km2)" ], "rows": [ [ "binondo", "10", "12985", "66.11", "19641.5" ], [ "ermita", "13", "7143", "158.91", "4495.0" ], [ "intramuros", "5", "4925", "67.26", "7322.3" ], [ "malate", "57", "77513", "259.58", "29860.9" ], [ "paco", "43", "70978", "278.69", "25468.4" ], [ "pandacan", "38", "73895", "166.0", "44515.1" ], [ "port area", "5", "57405", "315.28", "18207.6" ], [ "quiapo", "16", "24886", "84.69", "29384.8" ], [ "sampaloc", "192", "241528", "513.71", "47016.4" ], [ "san andrãs", "65", "115942", "168.02", "69004.9" ], [ "san miguel", "12", "15992", "91.37", "17502.5" ], [ "san nicolas", "15", "44241", "163.85", "27000.9" ], [ "santa ana", "34", "60952", "169.42", "35976.9" ], [ "santa cruz", "82", "115747", "309.01", "37457.4" ], [ "santa mesa", "51", "99933", "261.01", "38287.0" ], [ "tondo", "259", "628106", "865.13", "72602.5" ] ], "title": "", "original_id": "be0223bd4b1d4dcfcb9bf7d3351329b3" }, { "_id": "c135787d7b84d1a072be1bdb883e93bc", "header": [ "School", "Location", "Outright Titles", "Shared Titles", "Runners-Up", "Total Finals", "Last Title", "Last Final" ], "rows": [ [ "Methodist College Belfast", "Belfast", "35", "2", "25", "62", "2014.0", "2014" ], [ "Royal Belfast Academical Institution", "Belfast", "29", "4", "21", "54", "2007.0", "2013" ], [ "Campbell College", "Belfast", "23", "4", "12", "39", "2011.0", "2011" ], [ "Coleraine Academical Institution", "Coleraine", "9", "0", "24", "33", "1992.0", "1998" ], [ "The Royal School, Armagh", "Armagh", "9", "0", "3", "12", "2004.0", "2004" ], [ "Portora Royal School", "Enniskillen", "6", "1", "5", "12", "1942.0", "1942" ], [ "Bangor Grammar School", "Bangor", "5", "0", "4", "9", "1988.0", "1995" ], [ "Ballymena Academy", "Ballymena", "3", "0", "6", "9", "2010.0", "2010" ], [ "Rainey Endowed School", "Magherafelt", "2", "1", "2", "5", "1982.0", "1982" ], [ "Foyle College", "Londonderry", "2", "0", "4", "6", "1915.0", "1915" ], [ "Belfast Royal Academy", "Belfast", "1", "3", "5", "9", "1997.0", "2010" ], [ "Regent House Grammar School", "Newtownards", "1", "1", "2", "4", "1996.0", "2008" ], [ "Royal School Dungannon", "Dungannon", "1", "0", "4", "5", "1907.0", "1975" ], [ "Annadale Grammar School (now Wellington College)", "Belfast", "1", "0", "1", "2", "1958.0", "1978" ], [ "Ballyclare High School", "Ballyclare", "1", "0", "1", "2", "1973.0", "2012" ], [ "Belfast Boys' Model School", "Belfast", "1", "0", "0", "1", "1971.0", "1971" ], [ "Grosvenor High School", "Belfast", "1", "0", "0", "1", "1983.0", "1983" ], [ "Wallace High School", "Lisburn", "0", "0", "4", "4", null, "2007" ], [ "Derry Academy", "Derry", "0", "0", "2", "2", null, "1896" ], [ "Dalriada School", "Ballymoney", "0", "0", "1", "1", null, "1993" ], [ "Galway Grammar School", "Galway", "0", "0", "1", "1", null, "1887" ], [ "Lurgan College", "Lurgan", "0", "0", "1", "1", null, "1934" ], [ "Omagh Academy", "Omagh", "0", "0", "1", "1", null, "1985" ], [ "Sullivan Upper School", "Holywood", "0", "0", "1", "1", null, "2014" ] ], "title": "", "original_id": "ffe5d38c4973ddc4bd3ca6d9c2d34406" }, { "_id": "fd3ce583185bf40e79b3cd873488f502", "header": [ "commodity", "2001 - 02", "2002 - 03", "2003 - 04", "2004 - 05", "2005 - 06", "2006 - 07" ], "rows": [ [ "cattle and calves", "6617", "5849", "6345", "7331", "7082", "6517" ], [ "wheat", "6356", "2692", "5636", "4320", "5905", "6026" ], [ "milk", "3717", "2795", "2808", "3194", "3268", "3245" ], [ "fruit and nuts", "2333", "2408", "2350", "2640", "2795", "2915" ], [ "s vegetable", "2269", "2126", "2356", "2490", "2601", "2715" ], [ "wool", "2713", "3318", "2397", "2196", "2187", "2138" ], [ "barley", "1725", "984", "1750", "1240", "1744", "1624" ], [ "poultry", "1175", "1273", "1264", "1358", "1416", "1461" ], [ "s lamb", "1181", "1161", "1318", "1327", "1425", "1348" ], [ "sugar cane", "989", "1019", "854", "968", "1037", "1208" ] ], "title": "", "original_id": "8b7282ee8b62b7081c34cb52912ccc40" }, { "_id": "5a65f6d8c0f14a41cdb2d12b29cc51d4", "header": [ "sno", "power plant", "state", "commissioned capacity (mw)", "year of commission" ], "rows": [ [ "1", "baira siul", "himachal pradesh", "180", "1981" ], [ "2", "loktak", "manipur", "105", "1983" ], [ "3", "salal - i", "jammu & kashmir", "345", "1987" ], [ "4", "tanakpur", "uttarakhand", "120", "1992" ], [ "5", "chamera - i", "himachal pradesh", "540", "1994" ], [ "6", "salal - ii", "jammu & kashmir", "345", "1996" ], [ "7", "uri - i", "jammu & kashmir", "480", "1997" ], [ "8", "rangit", "sikkim", "60", "1999" ], [ "9", "chamera - ii", "himachal pradesh", "300", "2004" ], [ "10", "indira sagar", "madhya pradesh", "1000", "2005" ], [ "11", "dhauliganga - i", "uttarakhand", "280", "2005" ], [ "12", "dul hasti", "jammu & kashmir", "390", "2007" ], [ "13", "omkareshwar", "madhya pradesh", "520", "2007" ], [ "14", "teesta - v", "sikkim", "510", "2008" ], [ "15", "sewa - ii", "jammu & kashmir", "120", "2010" ], [ "16", "chamera - iii", "himachal pradesh", "231", "2012" ] ], "title": "", "original_id": "ac4ea376af826244678bb8ef6a0e024b" }, { "_id": "63c16af56b3d709395dffa88cf4ab9d7", "header": [ "region", "start datum", "target datum", "c_x ( metre )", "c_y (metre)", "c_z (metre)", "s ( ppm )", "r x ( arcsecond )", "r y ( arcsecond )", "r z ( arcsecond )" ], "rows": [ [ "slovenia etrs89", "d48", "d96", "409.545", "72.164", "486.872", "17.919665", "3.085957", "5.46911", "11.020289" ], [ "england , scotland , wales", "wgs84", "osgb36", "446.448", "125.157", "542.06", "20.4894", "0.1502", "0.247", "0.8421" ], [ "ireland", "wgs84", "ireland 1965", "482.53", "130.596", "564.557", "8.15", "1.042", "0.214", "0.631" ], [ "germany", "wgs84", "dhdn", "591.28", "81.35", "396.39", "9.82", "1.477", "0.0736", "1.458" ], [ "germany", "wgs84", "bessel 1841", "582.0", "105.0", "414.0", "8.3", "1.04", "0.35", "3.08" ], [ "germany", "wgs84", "krassovski 1940", "24.0", "123.0", "94.0", "1.1", "0.02", "0.26", "0.13" ], [ "austria (bev)", "wgs84", "mgi", "577.326", "90.129", "463.92", "2.423", "5.137", "1.474", "5.297" ] ], "title": "", "original_id": "0150c6f2c5f3a2b3ea7326b41446cbf3" }, { "_id": "636b65c0daa4444c3680548c6170e113", "header": [ "Name", "Title", "Start", "End" ], "rows": [ [ "William J. Porter", "Chargé d'Affaires", "1956", "1956" ], [ "Cavendish W. Cannon", "Ambassador", "1956", "1958" ], [ "Charles Yost", "Ambassador", "1958", "1961" ], [ "Philip W. Bonsal", "Ambassador", "1961", "1962" ], [ "John H. Ferguson", "Ambassador", "1962", "1964" ], [ "Henry J. Tasca", "Ambassador", "1965", "1969" ], [ "Stuart W. Rockwell", "Ambassador", "1970", "1973" ], [ "Robert G. Neumann", "Ambassador", "1973", "1976" ], [ "Robert Anderson", "Ambassador", "1976", "1978" ], [ "Richard B. Parker", "Ambassador", "1978", "1979" ], [ "Angier Biddle Duke", "Ambassador", "1979", "1981" ], [ "Joseph Verner Reed, Jr.", "Ambassador", "1981", "1985" ], [ "Thomas Anthony Nassif", "Ambassador", "1985", "1988" ], [ "Michael Ussery", "Ambassador", "1988", "1991" ], [ "Frederick Vreeland", "Ambassador", "1991", "1993" ], [ "Marc Charles Ginsberg", "Ambassador", "1994", "1997" ], [ "Gary S. Usrey", "Chargé d'Affaires", "1997", "1998" ], [ "Edward M. Gabriel", "Ambassador", "1998", "2001" ], [ "Margaret D. Tutwiler", "Ambassador", "2001", "2003" ], [ "Thomas Riley", "Ambassador", "2004", "2009" ], [ "Samuel L. Kaplan", "Ambassador", "2009", "2013" ], [ "Matthew Lussenhop", "Chargé d'Affaires", "2013", "2014" ], [ "Dwight L. Bush Sr.", "Ambassador", "2014", "2017" ] ], "title": "", "original_id": "70d9755a3802ad91ea099532f8465915" }, { "_id": "7b8344c6a1edd4a9ebfe522b88058701", "header": [ "party", "pr seats", "district seats", "total elected 2001", "total seats" ], "rows": [ [ "liberal democratic party", "20", "45", "65", "111" ], [ "democratic party", "8", "18", "26", "59" ], [ "new komeito party", "8", "5", "13", "23" ], [ "liberal party", "4", "2", "6", "8" ], [ "communist party", "4", "1", "5", "20" ], [ "social democratic party", "3", "0", "3", "8" ], [ "new conservative party", "1", "0", "1", "5" ], [ "others", "0", "2", "2", "2" ], [ "independents", "0", "0", "0", "4" ], [ "total", "48", "73", "121", "247" ] ], "title": "", "original_id": "e7b71d1c7427df2a8dd74f7b599ff66e" }, { "_id": "bce9ccee41e9adcf156e7dc16133c22b", "header": [ "type", "beam height (mm)", "flange width (mm)", "web thickness (mm)", "flange thickness (mm)", "weight (kg / m)", "cross - section area (cm 2 )", "moment of inertia in torsion (j) (cm 4 )" ], "rows": [ [ "ismb 80", "80", "46", "3.8", "5.2", "6.0", "7.64", "0.7" ], [ "ismb 100", "100", "55", "4.1", "5.7", "8.1", "10.3", "1.1" ], [ "ismb 120", "120", "70", "4.4", "6.3", "10.4", "13.2", "1.71" ], [ "ismb 140", "140", "73", "4.7", "6.9", "12.9", "16.4", "2.54" ], [ "ismb 750 137", "753", "263", "11.5", "17.0", "137.0", "175.0", "137.1" ], [ "ismb 750 147", "753", "265", "13.2", "17.0", "147.0", "188.0", "161.5" ], [ "ismb 750 173", "762", "267", "14.4", "21.6", "173.0", "221.0", "273.6" ] ], "title": "", "original_id": "7341c70da411447ef71639df09d1b994" }, { "_id": "77fc281bd9c327b12cda36d32692030d", "header": [ "draw", "singer", "song", "points", "place" ], "rows": [ [ "1", "manjola nallbani", "kjo botë merr frymë nga dashuria", "27", "7" ], [ "2", "produkt 28", "30 sekonda", "3", "15" ], [ "3", "eneida tarifa", "e para letër", "11", "10" ], [ "4", "mariza ikonomi", "mall i tretur", "20", "9" ], [ "5", "greta koçi", "natën të kërkova", "35", "6" ], [ "6", "flaka krelani & doruntina disha", "jeta kërkon dashuri", "57", "2" ], [ "7", "mira konçi & redon makashi", "nën një qiell", "37", "5" ], [ "8", "kthjellu", "dhoma", "9", "11" ], [ "9", "kozma dushi", "tatuazh në kujtesë", "1", "16" ], [ "10", "devis xherahu", "endacaku", "0", "17" ], [ "11", "teuta kurti", "qyteti i dashurisë", "3", "14" ], [ "12", "samanta karavello", "pse u harrua dashuria", "23", "8" ], [ "13", "juliana pasha", "një qiell të ri", "54", "3" ], [ "14", "agim poshka", "kujt i them të dua", "8", "12" ], [ "15", "jonida maliqi", "s'ka fajtor në dashuri", "36", "4" ], [ "16", "olta boka", "zemrën e lamë peng", "67", "1" ], [ "17", "rosela gjylbegu", "po lind një yll", "8", "13" ] ], "title": "", "original_id": "3ca51f974a30120a84a22b6e72b818ba" }, { "_id": "85eb3edf34d3c98f185ec1921f84eeaf", "header": [ "polling firm", "date of polling", "link", "progressive conservative", "liberal", "new democratic" ], "rows": [ [ "corporate research associates", "september 29 - october 3 , 2011", "html", "59", "16", "25" ], [ "environics", "september 29 - october 4 , 2011", "html", "54", "13", "33" ], [ "marketquest omnifacts research", "september 28 - 30 , 2011", "html", "54", "13", "33" ], [ "marketquest omnifacts research", "september 16 - 19 , 2011", "html", "53", "18", "29" ], [ "corporate research associates", "august 15 - 31 , 2011", "pdf", "54", "22", "24" ], [ "corporate research associates", "may 11 - 28 , 2011", "pdf", "57", "22", "20" ], [ "corporate research associates", "february 10 - 28 , 2011", "pdf", "73", "18", "8" ], [ "corporate research associates", "november 9 - 30 , 2010", "pdf", "75", "16", "8" ], [ "corporate research associates", "august 10 - 30 , 2010", "pdf", "76", "17", "7" ], [ "corporate research associates", "may 11 - 31 , 2010", "pdf", "75", "16", "8" ], [ "corporate research associates", "february 9 - 25 , 2010", "pdf", "80", "15", "5" ], [ "corporate research associates", "november 5 - 22 , 2009", "pdf", "77", "16", "7" ], [ "corporate research associates", "august 11 - 29 , 2009", "pdf", "77", "15", "8" ], [ "corporate research associates", "may 12 - 30 , 2009", "pdf", "72", "19", "8" ], [ "corporate research associates", "february 11 - 28 , 2009", "pdf", "71", "22", "7" ], [ "corporate research associates", "november 5 - december 2 , 2008", "pdf", "72", "19", "9" ], [ "corporate research associates", "august 12 - 30 , 2008", "pdf", "78", "14", "7" ], [ "corporate research associates", "may 8 - june 1 , 2008", "pdf", "77", "13", "8" ], [ "corporate research associates", "february 12 - march 4 , 2008", "pdf", "79", "14", "6" ], [ "corporate research associates", "november 9 - december 3 , 2007", "pdf", "82", "12", "7" ] ], "title": "", "original_id": "3e1a5d8854ccc78754eb3badc950a684" }, { "_id": "ea12962d63f3eedbd9606781dcaf0479", "header": [ "club", "played", "drawn", "lost", "points for", "points against", "points difference", "tries for", "tries against", "try bonus", "losing bonus", "points" ], "rows": [ [ "club", "played", "drawn", "lost", "points for", "points against", "points difference", "tries for", "tries against", "try bonus", "losing bonus", "points" ], [ "wattstown rfc", "16", "0", "0", "361", "117", "+ 244", "39", "14", "5", "0", "69" ], [ "bryncethin rfc", "16", "0", "4", "306", "184", "+ 122", "41", "26", "6", "2", "56" ], [ "crc caerdydd rfc", "16", "0", "5", "280", "197", "+ 83", "39", "23", "4", "1", "49" ], [ "cambrian welfare rfc", "16", "1", "8", "336", "209", "+ 127", "49", "20", "5", "6", "41" ], [ "glyncoch rfc", "16", "0", "10", "206", "248", "- 42", "25", "31", "1", "6", "31" ], [ "llanrumney rfc", "16", "1", "10", "277", "304", "- 27", "36", "38", "3", "3", "28" ], [ "ynysowen rfc", "16", "0", "11", "240", "339", "- 99", "28", "49", "0", "3", "23" ], [ "caerau ely rfc", "16", "0", "12", "163", "273", "- 110", "21", "33", "2", "4", "22" ], [ "llandrindod wells rfc", "16", "0", "11", "155", "453", "- 298", "18", "62", "0", "1", "21" ] ], "title": "", "original_id": "2d94c83349915e453b125fdda0e30f95" }, { "_id": "c17f809ee30b3b24aea2fc420d8f483f", "header": [ "Position", "Club", "Played", "Points", "Wins", "Draws", "Losses", "Goals for", "Goals against", "Goal Difference" ], "rows": [ [ "1", "UE Lleida", "38", "57+19", "23", "11", "4", "56", "20", "36" ], [ "2", "Real Valladolid", "38", "52+14", "20", "12", "6", "50", "30", "20" ], [ "3", "Racing de Santander", "38", "52+14", "23", "6", "9", "56", "38", "18" ], [ "4", "RCD Mallorca", "38", "50+12", "21", "8", "9", "57", "34", "23" ], [ "5", "Real Betis", "38", "43+5", "16", "11", "11", "49", "33", "16" ], [ "6", "Real Madrid B", "38", "42+4", "15", "12", "11", "57", "41", "16" ], [ "7", "Atlético Marbella", "38", "42+4", "17", "8", "13", "45", "41", "4" ], [ "8", "Barcelona B", "38", "39+1", "15", "9", "14", "59", "55", "4" ], [ "9", "CP Mérida", "38", "39+1", "13", "13", "12", "43", "42", "1" ], [ "10", "CD Castellón", "38", "36-2", "13", "10", "15", "40", "45", "-5" ], [ "11", "CD Badajoz", "38", "36-2", "14", "8", "16", "37", "36", "1" ], [ "12", "SD Compostela", "38", "35-3", "10", "15", "13", "35", "39", "-4" ], [ "13", "Villarreal CF", "38", "34-4", "13", "8", "17", "38", "51", "-14" ], [ "14", "Palamós CF", "38", "33-5", "12", "9", "17", "33", "50", "-17" ], [ "15", "Athletic de Bilbao B", "38", "33-5", "9", "15", "14", "33", "34", "-1" ], [ "16", "SD Eibar", "38", "32-6", "10", "12", "16", "33", "44", "-11" ], [ "17", "UE Figueres", "38", "32-6", "11", "10", "17", "41", "59", "-18" ], [ "18", "CD Lugo", "38", "25-13", "7", "11", "20", "23", "41", "-18" ], [ "19", "Sestao", "38", "24-14", "7", "10", "21", "29", "54", "-25" ], [ "20", "CE Sabadell FC 1", "38", "24-14", "8", "8", "22", "30", "57", "-27" ] ], "title": "", "original_id": "1c7c310b185c9507faa6e8b0f38a1213" }, { "_id": "172ac017587b75be4bcbff56b96df602", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1", "Russia", "17", "5", "5", "27" ], [ "2", "Bulgaria", "5", "2", "3", "10" ], [ "3", "Belarus", "2", "4", "2", "8" ], [ "4", "Ukraine", "1", "2", "11", "14" ], [ "5", "Kazakhstan", "1", "1", "3", "5" ], [ "6", "Latvia", "1", "0", "0", "1" ], [ "7", "Uzbekistan", "0", "3", "4", "7" ], [ "8", "Lithuania", "0", "1", "6", "7" ], [ "8", "Venezuela", "0", "3", "3", "6" ], [ "9", "Mongolia", "0", "2", "4", "6" ], [ "10", "Armenia", "0", "1", "3", "4" ], [ "11", "Japan", "0", "0", "3", "3" ], [ "12", "Estonia", "0", "0", "2", "2" ], [ "13", "Azerbaijan", "0", "1", "0", "1" ], [ "13", "France", "0", "1", "0", "1" ], [ "13", "Germany", "0", "1", "0", "1" ], [ "13", "Romania", "0", "1", "0", "1" ], [ "17", "Serbia", "0", "0", "1", "1" ], [ "17", "Spain", "0", "0", "1", "1" ], [ "17", "Tajikistan", "0", "0", "1", "1" ], [ "17", "Turkmenistan", "0", "0", "1", "1" ], [ "21", "Algeria", "0", "0", "0", "0" ], [ "21", "Austria", "0", "0", "0", "0" ], [ "21", "Belgium", "0", "0", "0", "0" ], [ "21", "Cameroon", "0", "0", "0", "0" ], [ "21", "Canada", "0", "0", "0", "0" ], [ "21", "Colombia", "0", "0", "0", "0" ], [ "21", "Czech Republic", "0", "0", "0", "0" ], [ "21", "Cyprus", "0", "0", "0", "0" ], [ "21", "Ecuador", "0", "0", "0", "0" ], [ "21", "Finland", "0", "0", "0", "0" ], [ "21", "Great Britain", "0", "0", "0", "0" ], [ "21", "India", "0", "0", "0", "0" ], [ "21", "Indonesia", "0", "0", "0", "0" ], [ "21", "Ireland", "0", "0", "0", "0" ], [ "21", "Israel", "0", "0", "0", "0" ], [ "21", "Italy", "0", "0", "0", "0" ], [ "21", "Jordan", "0", "0", "0", "0" ], [ "21", "South Korea", "0", "0", "0", "0" ], [ "21", "Kyrgyzstan", "0", "0", "0", "0" ], [ "21", "Lebanon", "0", "0", "0", "0" ], [ "21", "Malaysia", "0", "0", "0", "0" ], [ "21", "Morocco", "0", "0", "0", "0" ], [ "21", "Moldova", "0", "0", "0", "0" ], [ "21", "Nepal", "0", "0", "0", "0" ], [ "21", "New Zealand", "0", "0", "0", "0" ], [ "21", "Pakistan", "0", "0", "0", "0" ], [ "21", "Panama", "0", "0", "0", "0" ], [ "21", "Peru", "0", "0", "0", "0" ], [ "21", "Poland", "0", "0", "0", "0" ], [ "21", "Syria", "0", "0", "0", "0" ], [ "21", "Slovenia", "0", "0", "0", "0" ], [ "21", "Slovakia", "0", "0", "0", "0" ], [ "21", "Thailand", "0", "0", "0", "0" ], [ "21", "Tunisia", "0", "0", "0", "0" ], [ "21", "Turkey", "0", "0", "0", "0" ], [ "21", "United States", "0", "0", "0", "0" ], [ "21", "Yemen", "0", "0", "0", "0" ], [ "Total", "Total", "27", "27", "54", "108" ] ], "title": "", "original_id": "c2f777e603e02e71156416f9065b55f5" }, { "_id": "6d46f3235c2a39767f6b9b721cfb742c", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "south korea", "11", "1", "1", "13" ], [ "2", "spain", "3", "1", "2", "6" ], [ "3", "chinese taipei", "1", "1", "2", "4" ], [ "4", "france", "1", "0", "1", "2" ], [ "5", "turkey", "0", "2", "3", "5" ], [ "6", "mexico", "0", "2", "2", "4" ], [ "7", "canada", "0", "2", "1", "3" ], [ "7", "greece", "0", "2", "1", "3" ], [ "9", "brazil", "0", "2", "0", "2" ], [ "10", "venezuela", "0", "1", "1", "2" ], [ "11", "denmark", "0", "1", "0", "1" ], [ "11", "indonesia", "0", "1", "0", "1" ], [ "13", "united states", "0", "0", "4", "4" ], [ "14", "egypt", "0", "0", "2", "2" ], [ "14", "germany", "0", "0", "2", "2" ], [ "16", "argentina", "0", "0", "1", "1" ], [ "16", "colombia", "0", "0", "1", "1" ], [ "16", "cyprus", "0", "0", "1", "1" ], [ "16", "finland", "0", "0", "1", "1" ], [ "16", "malaysia", "0", "0", "1", "1" ], [ "16", "netherlands", "0", "0", "1", "1" ], [ "16", "nigeria", "0", "0", "1", "1" ], [ "16", "philippines", "0", "0", "1", "1" ], [ "16", "puerto rico", "0", "0", "1", "1" ], [ "16", "sweden", "0", "0", "1", "1" ], [ "total", "total", "16", "16", "32", "64" ] ], "title": "", "original_id": "78f1a1ec29ac20f339fbc3fb396b02d1" }, { "_id": "ea149d1de2e24a191ced6d9cf9856484", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "germany", "45", "33", "28", "106" ], [ "2", "switzerland", "39", "35", "32", "106" ], [ "3", "italy", "18", "18", "6", "42" ], [ "4", "united states", "12", "20", "31", "63" ], [ "5", "west germany", "11", "13", "12", "36" ], [ "6", "canada", "11", "11", "12", "34" ], [ "7", "east germany", "8", "9", "8", "25" ], [ "8", "great britain", "7", "6", "4", "17" ], [ "9", "austria", "6", "11", "14", "31" ], [ "10", "russia", "2", "5", "4", "11" ], [ "11", "romania", "2", "2", "2", "6" ], [ "12", "latvia", "2", "1", "1", "4" ], [ "13", "belgium", "1", "1", "1", "3" ], [ "14", "france", "1", "0", "4", "5" ], [ "15", "new zealand", "1", "0", "1", "2" ], [ "16", "czechoslovakia", "0", "2", "0", "2" ], [ "17", "sweden", "0", "0", "2", "2" ], [ "17", "soviet union", "0", "0", "2", "2" ], [ "19", "spain", "0", "0", "1", "1" ] ], "title": "", "original_id": "56af57cfe3097874ce49535911e9f039" }, { "_id": "8cbfb25294dbe450ef71bad2d6871168", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "italy", "5", "4", "2", "11" ], [ "2", "france", "3", "3", "5", "11" ], [ "3", "egypt", "2", "0", "2", "4" ], [ "4", "algeria", "1", "4", "4", "9" ], [ "5", "tunisia", "1", "1", "5", "7" ], [ "6", "turkey", "1", "1", "0", "2" ], [ "7", "slovenia", "1", "0", "1", "2" ], [ "8", "serbia and montenegro", "0", "1", "2", "3" ], [ "9", "spain", "0", "0", "5", "5" ], [ "10 =", "greece", "0", "0", "1", "1" ], [ "10 =", "morocco", "0", "0", "1", "1" ] ], "title": "", "original_id": "0024501faeb895ca098242a0af2f822a" }, { "_id": "0aefaea311e276834b8a2feb8b83fce0", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "united states", "50", "41", "32", "123" ], [ "2", "great britain", "18", "23", "20", "61" ], [ "3", "italy", "14", "15", "16", "45" ], [ "4", "australia", "12", "11", "7", "30" ], [ "5", "rhodesia", "10", "5", "2", "17" ], [ "6", "south africa", "8", "8", "3", "19" ], [ "7", "israel", "7", "3", "11", "21" ], [ "8", "argentina", "6", "15", "16", "37" ], [ "9", "west germany", "5", "2", "5", "12" ], [ "10", "netherlands", "4", "6", "4", "14" ] ], "title": "", "original_id": "3e8c9ae6880c285746e8344707583b81" }, { "_id": "9cc840450f05ae843c204d94dba19c02", "header": [ "club", "played", "drawn", "lost", "points for", "points against", "tries for", "tries against", "try bonus", "losing bonus", "points" ], "rows": [ [ "club", "played", "drawn", "lost", "points for", "points against", "tries for", "tries against", "try bonus", "losing bonus", "points" ], [ "llandeilo rfc", "22", "1", "0", "917", "119", "136", "14", "19", "0", "105" ], [ "brynamman rfc", "22", "1", "2", "821", "210", "116", "27", "16", "2", "96" ], [ "tenby united rfc", "22", "0", "8", "562", "461", "78", "61", "10", "1", "67" ], [ "pembroke dock harlequins rfc", "22", "0", "8", "423", "351", "56", "40", "7", "3", "66" ], [ "pontarddulais rfc", "22", "1", "9", "550", "503", "79", "68", "11", "5", "66" ], [ "betws rfc", "22", "1", "9", "528", "440", "72", "63", "9", "0", "59" ], [ "trimsaran rfc", "22", "0", "12", "471", "540", "68", "77", "7", "1", "48" ], [ "pembroke rfc", "22", "0", "13", "467", "500", "69", "66", "8", "4", "48" ], [ "burry port rfc", "22", "1", "14", "373", "688", "47", "99", "3", "2", "31" ], [ "hendy rfc", "22", "0", "17", "292", "707", "38", "109", "1", "6", "27" ], [ "tycroes rfc", "22", "0", "18", "267", "645", "35", "89", "3", "3", "18" ], [ "cwmgors rfc", "22", "1", "19", "211", "718", "28", "109", "2", "3", "15" ] ], "title": "", "original_id": "d7b545735f844944b02b05fe0343cb44" }, { "_id": "e5c305305240101dfdb0493fbb4004dc", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1", "China", "63", "46", "32", "141" ], [ "2", "Great Britain", "35", "30", "29", "94" ], [ "3", "Canada", "28", "19", "25", "72" ], [ "4", "United States", "27", "22", "39", "88" ], [ "5", "Australia", "26", "38", "36", "100" ], [ "6", "Ukraine", "24", "12", "19", "55" ], [ "7", "Spain", "20", "27", "24", "71" ], [ "8", "Germany", "19", "28", "31", "78" ], [ "9", "France", "18", "26", "30", "74" ], [ "10", "Japan", "17", "16", "20", "53" ] ], "title": "", "original_id": "6197fb264f5bffbbaadd753cde55c2e5" }, { "_id": "dfcb133d13839c18df15ebaa338a7918", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1", "Venezuela", "9", "8", "6", "23" ], [ "2", "Guatemala", "6", "6", "6", "18" ], [ "3", "Peru", "5", "8", "9", "22" ], [ "4", "Chile", "4", "4", "1", "9" ], [ "5", "El Salvador", "4", "0", "2", "6" ], [ "6", "Ecuador", "2", "5", "1", "8" ], [ "7", "Bolivia", "2", "1", "2", "5" ], [ "8", "Dominican Republic", "1", "0", "2", "3" ], [ "9", "Colombia", "0", "1", "3", "4" ], [ "Total", "Total", "33", "33", "32", "98" ] ], "title": "", "original_id": "04b30155112a315590a58ffe5fcd4a0b" }, { "_id": "a51a16fd045d8c94feba814c64300a8e", "header": [ "season", "series", "races", "wins", "poles", "f / laps", "podiums", "points", "position" ], "rows": [ [ "2007", "formula first manfeild winter series", "3", "0", "0", "1", "1", "170", "14th" ], [ "2007 - 08", "oem supply nz formula first championship", "24", "4", "1", "5", "18", "1368", "3rd" ], [ "2008", "formula ford manfeild winter series", "9", "5", "1", "3", "7", "610", "3rd" ], [ "2008", "australian formula ford championship", "2", "0", "0", "0", "0", "0", "nc" ], [ "2008 - 09", "mta formula ford championship", "21", "11", "3", "4", "15", "1215", "1st" ], [ "2009", "australian formula ford championship", "16", "1", "0", "2", "6", "164", "6th" ], [ "2009", "adac formel masters", "6", "0", "1", "0", "2", "52", "8th" ], [ "2009", "toyota racing series - hamilton 400 trophy", "2", "2", "2", "1", "2", "150", "1st" ], [ "2010", "adac formel masters", "18", "12", "2", "9", "17", "315", "1st" ], [ "2010", "michelin formula renault winter cup", "6", "1", "0", "1", "3", "99", "5th" ], [ "2010", "toyota racing series", "6", "1", "0", "2", "3", "362", "10th" ], [ "2011", "german formula three championship", "18", "13", "10", "8", "16", "181", "1st" ], [ "2011", "gp3 series", "4", "1", "0", "0", "1", "7", "20th" ], [ "2012", "formula renault 3.5 series", "5", "0", "0", "0", "0", "8", "22nd" ] ], "title": "", "original_id": "c73a6bab38248ecb331733bcd07ebde8" }, { "_id": "e1fc3c8a16aef1606c9fc167b3995d23", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1", "Puerto Rico", "17", "27", "13", "57" ], [ "2", "Bahamas", "17", "15", "19", "51" ], [ "3", "México", "9", "9", "5", "23" ], [ "4", "Jamaica", "8", "6", "4", "18" ], [ "5", "Barbados", "7", "3", "6", "16" ], [ "6", "Trinidad and Tobago", "7", "2", "2", "11" ], [ "7", "Venezuela", "3", "3", "8", "14" ], [ "8", "Colombia", "3", "1", "2", "6" ], [ "9", "U.S. Virgin Islands", "1", "1", "3", "5" ], [ "10", "Martinique", "1", "1", "0", "2" ], [ "11", "Antigua and Barbuda", "1", "0", "1", "2" ], [ "12", "Suriname", "1", "0", "0", "1" ], [ "13", "Bermuda", "0", "4", "2", "6" ], [ "14", "Dominican Republic", "0", "2", "4", "6" ], [ "15", "Panamá", "0", "1", "2", "3" ], [ "16", "Cayman Islands", "0", "0", "2", "2" ], [ "16", "Saint Kitts and Nevis", "0", "0", "2", "2" ] ], "title": "", "original_id": "a1e8eb2edd205ca85ff3310d4a0ad0eb" }, { "_id": "9a75b6be6fbf1ee44bde75c1a1e3c58d", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "cuba", "7", "4", "3", "14" ], [ "2", "venezuela", "6", "6", "4", "16" ], [ "3", "jamaica", "5", "3", "5", "13" ], [ "4", "mexico", "3", "4", "5", "12" ], [ "5", "colombia", "3", "0", "4", "7" ], [ "6", "puerto rico", "1", "4", "4", "9" ], [ "7", "netherlands antilles", "1", "1", "0", "2" ], [ "8", "bahamas", "1", "0", "1", "2" ], [ "9", "guyana", "1", "1", "0", "2" ], [ "10", "guatemala", "1", "0", "0", "1" ], [ "11", "panama", "0", "3", "1", "4" ], [ "12", "trinidad and tobago", "0", "2", "2", "4" ], [ "13", "barbados", "0", "1", "0", "1" ] ], "title": "", "original_id": "b991baa4ea3f9da3acf4bea043fd5b4d" }, { "_id": "36692a3457bb6dd0e93d0a909c129c2e", "header": [ "player", "matches", "innings", "runs", "average", "highest score", "100s", "50s" ], "rows": [ [ "lionel palairet", "10", "19", "560", "31.11", "100", "1", "5" ], [ "john challen", "9", "16", "354", "25.28", "89", "0", "2" ], [ "richard palairet", "10", "17", "266", "19.0", "74", "0", "1" ], [ "herbie hewett", "12", "22", "388", "18.47", "65", "0", "2" ], [ "sammy woods", "11", "19", "330", "18.33", "50", "0", "1" ], [ "bill roe", "7", "12", "168", "15.27", "36", "0", "0" ], [ "crescens robinson", "11", "17", "196", "14.0", "55", "0", "1" ], [ "vernon hill", "9", "15", "184", "12.26", "31", "0", "0" ], [ "george nichols", "12", "21", "216", "10.28", "37", "0", "0" ], [ "ted tyler", "12", "20", "168", "9.88", "62", "0", "1" ] ], "title": "", "original_id": "9280930f516f9e7e740df6336b2c327a" }, { "_id": "49c899ca783137eb905a89d5d7492de2", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "canada", "1", "1", "2", "4" ], [ "2", "lebanon", "1", "1", "0", "2" ], [ "3", "bulgaria", "1", "0", "1", "2" ], [ "4", "benin", "1", "0", "0", "1" ], [ "4", "quebec", "1", "0", "0", "1" ], [ "4", "cape verde", "1", "0", "0", "1" ], [ "4", "ivory coast", "1", "0", "0", "1" ], [ "8", "vietnam", "0", "2", "0", "2" ], [ "9", "central african republic", "0", "1", "0", "1" ], [ "9", "french community of belgium", "0", "1", "0", "1" ], [ "9", "niger", "0", "1", "0", "1" ], [ "9", "democratic republic of the congo", "0", "1", "0", "1" ], [ "9", "republic of the congo", "0", "1", "0", "1" ], [ "14", "cameroon", "0", "0", "1", "1" ], [ "14", "madagascar", "0", "0", "1", "1" ] ], "title": "", "original_id": "daa1e132c435be7e111cbe2363bb2c23" }, { "_id": "a751632a695262f1c230b6108b7a9712", "header": [ "Unnamed: 0", "1948", "1952", "1956", "1960", "1964" ], "rows": [ [ "all voters", "50.0", "45.0", "42", "50", "61" ], [ "White", "50.0", "43.0", "41", "49", "59" ], [ "Black", "50.0", "79.0", "61", "68", "94" ], [ "College educated", "22.0", "34.0", "31", "39", "52" ], [ "High School educated", "51.0", "45.0", "42", "52", "62" ], [ "Grade School educated", "64.0", "52.0", "50", "55", "66" ], [ "Professional & Business", "19.0", "36.0", "32", "42", "54" ], [ "White Collar", "47.0", "40.0", "37", "48", "57" ], [ "Manual worker", "66.0", "55.0", "50", "60", "71" ], [ "Farmer", "60.0", "33.0", "46", "48", "53" ], [ "Union member", "76.0", null, "51", "62", "77" ], [ "Not union", "42.0", null, "35", "44", "56" ], [ "Protestant", "43.0", "37.0", "37", "38", "55" ], [ "Catholic", "62.0", "56.0", "51", "78", "76" ], [ "Republican", null, "8.0", "4", "5", "20" ], [ "Independent", null, "35.0", "30", "43", "56" ], [ "Democrat", null, "77.0", "85", "84", "87" ], [ "East", "48.0", "45.0", "40", "53", "68" ], [ "Midwest", "50.0", "42.0", "41", "48", "61" ], [ "West", "49.0", "42.0", "43", "49", "60" ], [ "South", "53.0", "51.0", "49", "51", "52" ] ], "title": "", "original_id": "1b9e6880bae6250d652f23b7ae3c9102" }, { "_id": "09b76abab984f6b85b66e98a3561eea8", "header": [ "shirt number", "player name", "games played", "total points", "2 - points", "3 - points", "free throw" ], "rows": [ [ "11", "alpha ibrahim koroma", "5", "31", "30", "0", "1" ], [ "12", "alpha jalloh", "5", "17", "16", "0", "1" ], [ "13", "samuel juah", "3", "7", "6", "0", "1" ], [ "14", "abdulai bangura", "2", "4", "4", "0", "0" ], [ "15", "ibrahim jalloh", "5", "6", "6", "0", "0" ], [ "17", "ibrahim kallon", "4", "6", "2", "3", "1" ], [ "18", "ibrahim bakarr kamara", "3", "2", "2", "0", "0" ], [ "22", "alpha ambrose kargbo", "5", "60", "42", "15", "3" ], [ "33", "amadu kargbo", "4", "14", "12", "0", "2" ] ], "title": "", "original_id": "d2db16edd343270475522cf1f70b86c6" }, { "_id": "3dccdeae4aee2d2aeb7d095b70b1725e", "header": [ "club", "played", "drawn", "lost", "points for", "points against", "tries for", "tries against", "try bonus", "losing bonus", "points" ], "rows": [ [ "club", "played", "drawn", "lost", "points for", "points against", "tries for", "tries against", "try bonus", "losing bonus", "points" ], [ "maesteg rfc", "22", "2", "1", "615", "271", "78", "24", "12", "0", "92" ], [ "waunarlwydd rfc", "22", "1", "7", "594", "359", "73", "38", "10", "5", "73" ], [ "bp llandarcy rfc", "22", "1", "7", "376", "320", "43", "36", "3", "5", "66" ], [ "kidwelly rfc", "22", "0", "9", "558", "393", "68", "39", "6", "6", "64" ], [ "aberavon quins rfc", "22", "0", "9", "449", "424", "56", "45", "6", "3", "61" ], [ "ammanford rfc", "22", "1", "10", "409", "348", "45", "33", "4", "8", "58" ], [ "loughor rfc", "22", "1", "11", "427", "479", "47", "60", "5", "4", "51" ], [ "aberystwyth rfc", "22", "0", "12", "390", "509", "46", "71", "5", "4", "49" ], [ "pontyberem rfc", "22", "0", "12", "353", "520", "35", "67", "4", "3", "47" ], [ "mumbles rfc", "22", "1", "14", "372", "471", "51", "55", "5", "4", "39" ], [ "pencoed rfc", "22", "0", "19", "321", "505", "34", "62", "0", "10", "22" ], [ "dunvant rfc", "22", "1", "17", "324", "589", "33", "79", "0", "2", "20" ] ], "title": "", "original_id": "8784e31776b33c2a8c9988602a50dabc" }, { "_id": "bec0e2bb45a20a7286686456e1f8df3c", "header": [ "year", "starts", "wins", "top 5", "top 10", "poles", "avg start", "avg finish", "winnings", "position", "team (s)" ], "rows": [ [ "1983", "5", "0", "0", "0", "0", "25.6", "30.4", "8060", "47th", "5 sacks & sons" ], [ "1984", "29", "0", "0", "1", "0", "24.3", "25.1", "75183", "19th", "51 sacks & sons" ], [ "1986", "8", "0", "0", "1", "0", "22.4", "30.4", "64810", "41st", "10 digard motorsports" ], [ "1987", "16", "0", "0", "0", "0", "23.6", "29.8", "54815", "33rd", "50 dingman brothers racing" ], [ "1990", "16", "0", "2", "4", "1", "18.6", "20.8", "216148", "32nd", "17 / 18 / 46 hendrick motorsports" ], [ "1991", "11", "0", "0", "0", "0", "27.5", "30.4", "84215", "39th", "18 daytona speed inc 47 close racing" ], [ "1992", "20", "0", "0", "0", "0", "23.5", "25.1", "178120", "30th", "41 larry hedrick motorsports" ], [ "1993", "19", "0", "0", "1", "0", "24.3", "24.2", "168055", "35th", "9 melling racing 68 tristar motorsports" ], [ "1994", "31", "0", "0", "3", "1", "19.7", "27.0", "411728", "31st", "77 us motorsports inc" ], [ "1998", "7", "0", "0", "0", "0", "23.6", "35.3", "296880", "53rd", "98 yarborough - burdette motorsports" ], [ "2004", "3", "0", "0", "0", "0", "36.3", "41.7", "154100", "71st", "13 daytona speed inc" ] ], "title": "", "original_id": "3cebc683797d8ddec38b47f86d1c2eb0" }, { "_id": "463041e0bff9d6305e976ac70abfaa87", "header": [ "country", "preliminary", "interview", "swimsuit", "evening gown", "average" ], "rows": [ [ "california", "8.435", "8.861", "9.211", "9.2", "9.09" ], [ "texas", "8.671", "9.322", "9.177", "9.3", "9.266" ], [ "south carolina", "8.075", "8.733", "8.65", "8.744", "8.709" ], [ "louisiana", "8.147", "8.644", "8.8", "8.9", "8.781" ], [ "north dakota", "7.949", "8.955", "8.3", "8.422", "8.559" ], [ "oklahoma", "7.844", "8.688", "8.266", "8.566", "8.506" ], [ "nevada", "8.147", "8.011", "8.866", "8.322", "8.399" ], [ "washington", "8.207", "7.977", "8.577", "8.633", "8.395" ], [ "michigan", "7.864", "8.525", "8.366", "8.272", "8.387" ], [ "pennsylvania", "8.035", "8.166", "8.555", "8.377", "8.366" ], [ "georgia", "7.903", "7.655", "8.588", "8.755", "8.332" ] ], "title": "", "original_id": "b4f1cccbee7620602901988934f47abf" }, { "_id": "90fb8eccc50c9a24dc0475c2aa657617", "header": [ "year", "indians admitted", "pakistanis admitted", "sri lankans admitted", "bangladeshis admitted", "nepalis admitted" ], "rows": [ [ "2000", "26122", "14201", "5849", "2715", "247" ], [ "2001", "27901", "15353", "5520", "3393", "273" ], [ "2002", "28838", "14173", "4968", "2615", "418" ], [ "2003", "24595", "12351", "4448", "1896", "440" ], [ "2004", "25573", "12793", "4134", "3374", "594" ], [ "2005", "22141", "13575", "4690", "3940", "714" ], [ "2006", "30746", "12329", "4490", "3838", "640" ], [ "2007", "26047", "9545", "3934", "2735", "564" ], [ "2008", "24548", "8051", "4508", "2716", "639" ], [ "2009", "26117", "6213", "4270", "4270", "627" ], [ "2010", "30252", "4986", "4181", "4364", "1502" ], [ "2011", "24965", "6073", "3104", "2449", "1249" ], [ "2012", "28943", "9931", "3152", "2449", "1311" ], [ "total", "346788", "139574", "57248", "35856", "9218" ] ], "title": "", "original_id": "993a7fd34ef053762ab118cd5ae0a3c0" }, { "_id": "ee595d664aa2e4e1a342514c75adf9dc", "header": [ "country / territory", "area (km square)", "population", "pop density ( / km square)", "gdp millions of usd (2009)", "gdp per capita usd (2009 - 2011)", "capital" ], "rows": [ [ "american samoa", "199", "55519", "326", "537", "7874", "pago pago" ], [ "australia", "7617930", "23154782", "3", "1515468", "41500", "canberra" ], [ "brunei", "5765", "407000", "70", "14700", "36700", "bandar seri begawan" ], [ "cambodia", "181035", "14805000", "82", "10900", "800", "phnom penh" ], [ "china", "9671018", "1339530000", "138", "7203784", "6076", "beijing" ], [ "hong kong", "1104", "7055071", "6390", "210730", "30000", "hong kong" ], [ "indonesia", "1904569", "237556363", "126", "514900", "2200", "jakarta" ], [ "japan", "377944", "127470000", "337", "5870357", "39700", "tokyo" ], [ "north korea", "120540", "23906000", "198", "27820", "1200", "pyongyang" ], [ "south korea", "100140", "50062000", "500", "800300", "20000", "seoul" ], [ "laos", "236800", "6320000", "27", "5721", "900", "vientiane" ], [ "macau", "29", "541200", "18662", "36428", "39800", "macau" ], [ "malaysia", "329847", "28318000", "86", "191399", "7525", "kuala lumpur" ], [ "mongolia", "1564116", "2736800", "2", "4212", "1500", "ulan bator" ], [ "burma", "676578", "50496000", "74", "26820", "500", "naypyidaw" ], [ "new zealand", "268021", "4357437", "16", "109600", "25500", "wellington" ], [ "papua new guinea", "462840", "6732000", "15", "8200", "1200", "port moresby" ], [ "philippines", "299764", "91983000", "307", "158700", "1700", "manila" ], [ "singapore", "710", "5183700", "7023", "177133", "35500", "city of singapore" ], [ "taiwan", "36191", "23119772", "639", "466054", "20328", "taipei" ], [ "thailand", "513120", "67764000", "132", "263510", "3900", "bangkok" ], [ "timor - leste", "14874", "1171000", "76", "599", "500", "dili" ] ], "title": "", "original_id": "285c59f7f980d49b638f546b5d11d7ef" }, { "_id": "219336322eaf9747d55a0aee4abe2efe", "header": [ "ward", "bello", "ben - tahir", "doucet", "furtenbacher", "gauthier", "haydon", "larter", "lawrance", "libweshya", "liscumb" ], "rows": [ [ "orlãans", "51", "27", "1918", "14", "132", "939", "18", "27", "6", "6" ], [ "innes", "41", "11", "1466", "11", "105", "638", "10", "7", "7", "5" ], [ "barrhaven", "36", "32", "1267", "6", "26", "1305", "10", "15", "4", "3" ], [ "kanata north", "23", "23", "1222", "14", "14", "704", "12", "9", "3", "2" ], [ "west carleton - march", "6", "5", "958", "2", "10", "909", "3", "8", "2", "1" ], [ "stittsville", "9", "7", "771", "1", "9", "664", "2", "8", "2", "1" ], [ "bay", "37", "68", "2009", "20", "38", "1226", "20", "21", "8", "8" ], [ "college", "40", "32", "2112", "13", "22", "1632", "7", "15", "6", "10" ], [ "knoxdale - merivale", "33", "47", "1583", "17", "17", "1281", "11", "12", "4", "3" ], [ "gloucester - southgate", "84", "62", "1378", "25", "39", "726", "15", "20", "12", "8" ], [ "beacon hill - cyrville", "70", "24", "1297", "7", "143", "592", "7", "10", "1", "6" ], [ "rideau - vanier", "66", "24", "2148", "15", "261", "423", "11", "14", "11", "4" ], [ "rideau - rockcliffe", "68", "48", "1975", "15", "179", "481", "11", "19", "8", "6" ], [ "somerset", "47", "33", "2455", "17", "45", "326", "15", "18", "12", "1" ], [ "kitchissippi", "39", "21", "3556", "12", "21", "603", "10", "10", "3", "6" ], [ "river", "52", "57", "1917", "16", "31", "798", "11", "13", "6", "4" ], [ "capital", "40", "20", "4430", "18", "34", "369", "8", "7", "7", "5" ], [ "alta vista", "58", "89", "2114", "12", "74", "801", "8", "15", "5", "2" ], [ "cumberland", "39", "32", "1282", "12", "135", "634", "8", "8", "5", "5" ], [ "osgoode", "15", "2", "769", "8", "22", "768", "5", "11", "1", "4" ], [ "rideau - goulbourn", "7", "4", "898", "11", "15", "1010", "1", "7", "1", "4" ], [ "gloucester - south nepean", "36", "35", "976", "9", "23", "721", "10", "6", "5", "5" ], [ "kanata south", "29", "26", "1646", "24", "18", "1354", "6", "20", "3", "5" ], [ "ward", "lyrette", "maguire", "o'brien", "pita", "ryan", "st arnaud", "scharf", "taylor", "watson", "wright" ], [ "orlãans", "14", "332", "3937", "8", "27", "17", "84", "52", "8685", "14" ], [ "innes", "5", "229", "2952", "9", "26", "11", "44", "35", "6746", "11" ], [ "barrhaven", "3", "394", "3335", "14", "20", "4", "46", "46", "5943", "19" ], [ "kanata north", "3", "209", "2612", "10", "8", "3", "35", "44", "4516", "15" ], [ "west carleton - march", "1", "297", "3072", "2", "13", "3", "28", "28", "2746", "88" ], [ "stittsville", "2", "265", "2884", "10", "7", "6", "33", "15", "3195", "8" ], [ "bay", "9", "299", "3221", "8", "16", "9", "82", "96", "7220", "19" ], [ "college", "4", "378", "4249", "14", "28", "8", "68", "83", "7668", "21" ], [ "knoxdale - merivale", "8", "301", "3269", "14", "20", "1", "43", "47", "5540", "18" ], [ "gloucester - southgate", "7", "288", "3006", "16", "24", "17", "46", "39", "6107", "13" ], [ "beacon hill - cyrville", "9", "239", "2329", "20", "11", "15", "59", "39", "5484", "7" ], [ "rideau - vanier", "17", "129", "1503", "10", "11", "17", "58", "58", "5784", "21" ], [ "rideau - rockcliffe", "18", "139", "1729", "16", "13", "17", "55", "42", "5850", "27" ], [ "somerset", "8", "126", "1393", "12", "16", "12", "59", "80", "5164", "21" ], [ "kitchissippi", "6", "211", "2389", "13", "10", "9", "56", "80", "7034", "22" ], [ "river", "9", "312", "2875", "20", "13", "8", "53", "69", "6539", "27" ], [ "capital", "5", "140", "1436", "12", "6", "10", "35", "52", "6543", "14" ], [ "alta vista", "9", "265", "2672", "13", "15", "8", "52", "60", "6666", "22" ], [ "cumberland", "11", "296", "3203", "6", "25", "7", "53", "40", "6371", "12" ], [ "osgoode", "6", "441", "3039", "6", "9", "1", "48", "27", "2844", "11" ], [ "rideau - goulbourn", "2", "649", "3556", "6", "10", "3", "36", "19", "3359", "8" ], [ "gloucester - south nepean", "8", "247", "2372", "12", "13", "4", "33", "36", "4759", "11" ] ], "title": "", "original_id": "132684d63673e37ed6c5beabaa2d5a43" }, { "_id": "4d1b5f4db902a834810bab29c270d9d7", "header": [ "seed", "rank", "player", "points", "points defending", "points won", "new points", "status" ], "rows": [ [ "1", "1", "rafael nadal", "12070", "2000", "1200", "11270", "runner - up , lost to novak djokovic" ], [ "2", "2", "novak djokovic", "12005", "720", "2000", "13285", "champion , defeated rafael nadal" ], [ "3", "3", "roger federer", "9230", "360", "360", "9230", "quarterfinals lost to jo - wilfried tsonga" ], [ "4", "4", "andy murray", "6855", "720", "720", "6855", "semifinals lost to rafael nadal" ], [ "5", "5", "robin söderling", "4595", "360", "90", "4325", "third round lost to bernard tomic (q)" ], [ "6", "7", "tomáš berdych", "3490", "1200", "180", "2470", "fourth round lost to mardy fish" ], [ "7", "6", "david ferrer", "4150", "180", "180", "4150", "fourth round lost to jo - wilfried tsonga" ], [ "8", "10", "andy roddick", "2200", "180", "90", "2110", "third round lost to feliciano lópez" ], [ "9", "8", "gaël monfils", "2780", "90", "90", "2780", "third round lost to łukasz kubot (q)" ], [ "10", "9", "mardy fish", "2335", "45", "360", "2650", "quarterfinals lost rafael nadal" ], [ "11", "11", "jürgen melzer", "2175", "180", "90", "2085", "third round lost to xavier malisse" ], [ "12", "19", "jo - wilfried tsonga", "1585", "360", "720", "1945", "semifinals lost to novak djokovic" ], [ "13", "12", "viktor troicki", "1930", "45", "45", "1930", "second round lost to lu yen - hsun" ], [ "14", "14", "stanislas wawrinka", "1900", "10", "45", "1935", "second round lost to simone bolelli (ll)" ], [ "15", "16", "gilles simon", "1745", "90", "90", "1745", "third round lost to juan martín del potro" ], [ "16", "15", "nicolás almagro", "1875", "10", "90", "1955", "third round lost to mikhail youzhny" ], [ "17", "13", "richard gasquet", "1925", "0", "180", "2105", "fourth round lost to andy murray" ], [ "18", "17", "mikhail youzhny", "1740", "45", "180", "1875", "fourth round lost to roger federer" ], [ "19", "35", "michaël llodra", "1195", "45", "180", "1330", "fourth round lost vs novak djokovic" ], [ "20", "18", "florian mayer", "1600", "90", "45", "1555", "second round lost to xavier malisse" ], [ "21", "23", "fernando verdasco", "1425", "10", "45", "1460", "second round lost to robin haase" ], [ "22", "21", "alexandr dolgopolov", "1405", "45", "10", "1370", "first round lost to fernando gonzález (pr)" ], [ "23", "29", "janko tipsarević", "1305", "10", "10", "1305", "first round lost to ivo karlović" ], [ "24", "22", "juan martín del potro", "1445", "0", "180", "1625", "fourth round lost to rafael nadal" ], [ "25", "20", "juan ignacio chela", "1475", "10", "45", "1505", "second round lost to alex bogomolov , jr" ], [ "26", "31", "guillermo garcía - lópez", "1120", "10", "45", "1155", "second round lost to karol beck (q)" ], [ "27", "26", "marin čilić", "1345", "10", "10", "1345", "first round lost to ivan ljubičić" ], [ "28", "24", "david nalbandian", "1425", "0", "90", "1515", "third round lost to roger federer" ], [ "29", "27", "nikolay davydenko", "1330", "45", "10", "1295", "first round lost to bernard tomic (q)" ], [ "30", "28", "thomaz bellucci", "1305", "90", "10", "1225", "first round lost to rainer schüttler" ], [ "31", "25", "milos raonic", "1354", "0", "45", "1399", "second round lost to gilles müller (wc)" ] ], "title": "", "original_id": "01029e3c959b99916ea9d73a107a87bf" }, { "_id": "f05438f31426c74c3bff1122635c5e1f", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1.", "United States", "8", "7", "1", "16" ], [ "2.", "Russia", "7", "7", "5", "19" ], [ "3.", "France", "3", "3", "2", "8" ], [ "4.", "Ethiopia", "3", "2", "2", "7" ], [ "5.", "Belarus", "3", "1", "3", "7" ], [ "6.", "Sweden", "2", "1", "2", "5" ], [ "7.", "Kenya", "2", "1", "1", "4" ], [ "7=", "South Africa", "2", "1", "1", "4" ], [ "9.", "Morocco", "2", "1", "0", "3" ], [ "10.", "Greece", "1", "1", "2", "4" ], [ "11.", "Cuba", "1", "1", "0", "2" ], [ "12.", "Italy", "1", "0", "2", "3" ], [ "13.", "Canada", "1", "0", "1", "2" ], [ "14.", "Algeria", "1", "0", "0", "1" ], [ "14=", "Australia", "1", "0", "0", "1" ], [ "14=", "Dominican Republic", "1", "0", "0", "1" ], [ "14=", "Ecuador", "1", "0", "0", "1" ], [ "14=", "Lithuania", "1", "0", "0", "1" ], [ "14=", "Mexico", "1", "0", "0", "1" ], [ "14=", "Mozambique", "1", "0", "0", "1" ], [ "14=", "Poland", "1", "0", "0", "1" ], [ "14=", "Qatar", "1", "0", "0", "1" ], [ "14=", "Saint Kitts and Nevis", "1", "0", "0", "1" ], [ "24.", "Jamaica", "0", "4", "2", "6" ], [ "25.", "Spain", "0", "3", "2", "5" ], [ "26.", "Hungary", "0", "2", "0", "2" ], [ "27.", "Germany", "0", "1", "3", "4" ], [ "27=", "Japan", "0", "1", "3", "4" ], [ "27=", "Ukraine", "0", "1", "3", "4" ], [ "30.", "Great Britain", "0", "1", "2", "3" ], [ "31.", "Brazil", "0", "1", "0", "1" ], [ "31=", "Cameroon", "0", "1", "0", "1" ], [ "31=", "Czech Republic", "0", "1", "0", "1" ], [ "31=", "Estonia", "0", "1", "0", "1" ], [ "31=", "Ireland", "0", "1", "0", "1" ], [ "31=", "Trinidad and Tobago", "0", "1", "0", "1" ], [ "31=", "Turkey", "0", "1", "0", "1" ], [ "38.", "Bahamas", "0", "0", "3", "3" ], [ "39.", "China", "0", "0", "2", "2" ], [ "40.", "India", "0", "0", "1", "1" ], [ "40=", "Kazakhstan", "0", "0", "1", "1" ], [ "40=", "Netherlands", "0", "0", "1", "1" ], [ "40=", "Senegal", "0", "0", "1", "1" ] ], "title": "", "original_id": "df326b71a2a4177210d685c8bbd6cbf2" }, { "_id": "7ae88a2e90b1abcdae1edb32607ca1ac", "header": [ "Unnamed: 0", "Average population (x 1000)", "Live births", "Deaths", "Natural change", "Crude birth rate (per 1000)", "Crude death rate (per 1000)", "Natural change (per 1000)" ], "rows": [ [ "1970", "38", "761", "299", "462", "20.0", "7.9", "12.2" ], [ "1975", "42", "857", "317", "540", "20.4", "7.5", "12.9" ], [ "1980", "46", "996", "333", "663", "21.7", "7.2", "14.4" ], [ "1985", "51", "1 104", "370", "734", "21.6", "7.3", "14.4" ], [ "1990", "51", "842", "360", "482", "16.4", "7.0", "9.4" ], [ "1991", "50", "789", "335", "454", "15.8", "6.7", "9.1" ], [ "1992", "48", "692", "401", "291", "14.4", "8.3", "6.0" ], [ "1993", "46", "617", "448", "169", "13.4", "9.7", "3.7" ], [ "1994", "44", "585", "518", "67", "13.3", "11.8", "1.5" ], [ "1995", "43", "537", "501", "36", "12.6", "11.8", "0.8" ], [ "1996", "42", "486", "441", "45", "11.7", "10.6", "1.1" ], [ "1997", "41", "483", "374", "109", "11.9", "9.2", "2.7" ], [ "1998", "40", "498", "368", "130", "12.6", "9.3", "3.3" ], [ "1999", "39", "448", "376", "72", "11.6", "9.7", "1.9" ], [ "2000", "38", "460", "438", "22", "12.0", "11.4", "0.6" ], [ "2001", "39", "562", "438", "124", "14.5", "11.3", "3.2" ], [ "2002", "39", "608", "397", "211", "15.5", "10.1", "5.4" ], [ "2003", "39", "625", "386", "239", "15.9", "9.8", "6.1" ], [ "2004", "39", "637", "345", "292", "16.5", "8.9", "7.6" ], [ "2005", "38", "548", "369", "179", "14.5", "9.7", "4.7" ], [ "2006", "37", "540", "347", "193", "14.5", "9.3", "5.2" ] ], "title": "", "original_id": "615fe8039d2c84220b9f383b5e287a50" }, { "_id": "b8a6b75aa2ef64973e4d9b662fa6d97f", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1", "United States (USA)", "25", "16", "7", "48" ], [ "2", "Canada (CAN)", "5", "4", "7", "16" ], [ "3", "Jamaica (JAM)", "4", "3", "4", "11" ], [ "4", "Cuba (CUB)", "3", "8", "4", "15" ], [ "5", "Mexico (MEX)", "0", "3", "3", "6" ], [ "6", "Brazil (BRA)", "0", "2", "1", "3" ], [ "7", "Puerto Rico (PUR)", "0", "1", "1", "2" ], [ "8", "Colombia (COL)", "0", "0", "3", "3" ], [ "9", "Peru (PER)", "0", "0", "2", "2" ], [ "9", "Trinidad and Tobago (TRI)", "0", "0", "2", "2" ], [ "11", "Chile (CHI)", "0", "0", "1", "1" ], [ "11", "Uruguay (URU)", "0", "0", "1", "1" ], [ "11", "Venezuela (VEN)", "0", "0", "1", "1" ] ], "title": "", "original_id": "db5d51a82497e56cdd5c4b55ba02f07b" }, { "_id": "e1f95370c65d4c5f3868b7af6359626e", "header": [ "season", "series", "team", "races", "wins", "poles", "podiums" ], "rows": [ [ "2006", "star of silverstone", "silverstone motorsport academy", "2", "1", "0", "2" ], [ "2006", "formula renault 2.0 uk winter series", "aka lemac", "4", "0", "0", "0" ], [ "2007", "eurocup formula renault 2.0", "sg drivers project", "14", "5", "4", "6" ], [ "2007", "french formula renault 2.0", "sg formula", "10", "2", "1", "3" ], [ "2007", "formula renault 2.0 uk winter series", "hitech junior team", "4", "0", "0", "0" ], [ "2008", "formula 3 euro series", "art grand prix", "19", "1", "0", "2" ], [ "2008", "masters of formula 3", "art grand prix", "1", "0", "0", "1" ], [ "2008", "macau grand prix", "manor motorsport", "1", "0", "0", "0" ], [ "2009", "formula renault 3.5 series", "comtec racing", "12", "1", "1", "2" ], [ "2010", "formula renault 3.5 series", "fortec motorsport", "17", "0", "1", "1" ], [ "2011", "fia formula two championship", "motorsport vision", "2", "0", "0", "0" ], [ "2011", "auto gp", "super nova racing", "4", "1", "0", "1" ], [ "2012", "gp2 series", "ocean racing technology", "2", "0", "0", "0" ], [ "2013", "gp2 series", "hilmer motorsport", "6", "1", "0", "2" ] ], "title": "", "original_id": "991bb7236167d5557333f1dc881d2110" }, { "_id": "47f9359a052cb2dbd9810a17a3f6a5ba", "header": [ "rank", "country (or dependent territory)", "july 1 , 2013 projection", "% of pop", "average relative annual growth (%)", "average absolute annual growth" ], "rows": [ [ "1", "egypt", "84605000.0", "22.81", "2.29", "1893000" ], [ "2", "algeria", "38295000.0", "10.32", "2.11", "792000" ], [ "3", "iraq", "35404000.0", "9.54", "3.06", "1051000" ], [ "4", "sudan", "35150000.0", "9.47", "2.52", "863000" ], [ "5", "morocco", "32950000.0", "8.88", "1.08", "353000" ], [ "6", "saudi arabia", "30193000.0", "8.14", "3.41", "997000" ], [ "7", "yemen", "25252000.0", "6.81", "2.96", "725000" ], [ "8", "syria", "22169000.0", "5.98", "2.45", "531000" ], [ "9", "tunisia", "10889000.0", "2.94", "1.03", "111000" ], [ "10", "somalia", "9662000.0", "2.6", "1.17", "112000" ], [ "11", "united arab emirates", "8659000.0", "2.33", "1.56", "133000" ], [ "12", "jordan", "6517000.0", "1.76", "2.84", "180000" ], [ "13", "libya", "6323000.0", "1.7", "1.56", "97000" ], [ "14", "palestine", "4421000.0", "1.19", "2.91", "125000" ], [ "15", "lebanon", "4127000.0", "1.11", "1.58", "64000" ], [ "16", "oman", "3942000.0", "1.06", "8.8", "319000" ], [ "17", "kuwait", "3852000.0", "1.04", "2.94", "110000" ], [ "18", "mauritania", "3461000.0", "0.93", "2.58", "87000" ], [ "19", "qatar", "1917000.0", "0.52", "3.85", "71000" ], [ "20", "bahrain", "1546000.0", "0.42", "7.36", "106000" ], [ "21", "djibouti", "912000.0", "0.25", "2.7", "24000" ], [ "22", "comoros", "743000.0", "0.2", "2.62", "19000" ], [ "align = left|total", "370989000", "100.0", "2.42", "8763000.0", "29" ] ], "title": "", "original_id": "29915db5c65f536063c9f0a89349a75b" }, { "_id": "00110373865130e75eb1441a7b250c72", "header": [ "position", "team", "played", "wins", "draws", "losses", "scored", "conceded", "points" ], "rows": [ [ "1", "cerro porteño", "9", "5", "2", "2", "14", "7", "17" ], [ "2", "libertad", "9", "4", "4", "1", "12", "4", "16" ], [ "3", "12 de octubre", "9", "5", "1", "3", "15", "10", "16" ], [ "4", "cerro corá", "9", "4", "2", "3", "15", "14", "14" ], [ "5", "san lorenzo", "9", "4", "1", "4", "11", "11", "13" ], [ "6", "sportivo luqueño", "9", "3", "4", "2", "11", "12", "13" ], [ "7", "guaraní", "9", "3", "1", "5", "6", "9", "10" ], [ "8", "sol de américa", "9", "2", "3", "4", "11", "16", "9" ], [ "9", "atl colegiales", "9", "2", "3", "4", "6", "11", "9" ] ], "title": "", "original_id": "b706776a23c7b8fc4d8036047a48890e" }, { "_id": "7d49fe013eb36603a635956f3fde3e30", "header": [ "Year", "Numer of Jamaicans\ngranted British\ncitizenship", "Naturalisation\nby residence", "Naturalisation\nby marriage", "Registration\nof a minor child", "Registration\nby other means" ], "rows": [ [ "1997", "732", "327", "279", "114", "12" ], [ "1998", "1,370", "571", "564", "221", "14" ], [ "1999", "1,437", "678", "526", "226", "7" ], [ "2000", "1,882", "927", "664", "281", "10" ], [ "2001", "2,070", "1,025", "710", "330", "0" ], [ "2002", "2,025", "1,035", "705", "285", "0" ], [ "2003", "2,795", "1,285", "985", "520", "5" ], [ "2004", "3,180", "1,415", "1,060", "640", "65" ], [ "2005", "3,515", "1,585", "1,080", "770", "80" ], [ "2006", "2,525", "1,110", "710", "655", "55" ], [ "2007", "3,165", "1,575", "825", "725", "45" ], [ "2008", "2,715", "1,275", "695", "700", "45" ] ], "title": "", "original_id": "410a163d2c0672ff88d17cab3cecc0c6" }, { "_id": "cd1c1e4d2fcce4a5257736873da11399", "header": [ "position", "team", "points", "played", "drawn", "lost", "against", "difference" ], "rows": [ [ "1", "palestra itália - sp", "18", "9", "0", "0", "8", "25" ], [ "2", "auto", "14", "9", "0", "2", "14", "11" ], [ "3", "corinthians", "13", "9", "1", "2", "9", "17" ], [ "4", "santos", "11", "9", "1", "3", "17", "7" ], [ "5", "sílex", "8", "9", "2", "4", "26", "- 9" ], [ "6", "sírio", "7", "9", "1", "5", "20", "1" ], [ "7", "ypiranga - sp", "7", "9", "1", "5", "22", "- 6" ], [ "8", "portuguesa", "7", "9", "3", "4", "26", "- 9" ], [ "9", "aa são bento", "4", "9", "0", "7", "31", "- 22" ], [ "10", "sc internacional de são paulo", "1", "9", "1", "8", "24", "- 15" ] ], "title": "", "original_id": "9a37bff1bac90eb54cc51e99d4abef15" }, { "_id": "597384a0e201856e6ffcf1b27cf3af04", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "germany", "3", "5", "4", "12" ], [ "2", "hungary", "6", "1", "4", "11" ], [ "3", "poland", "3", "4", "3", "10" ], [ "4", "spain", "2", "2", "3", "7" ], [ "5", "russia", "3", "2", "1", "6" ], [ "6", "canada", "0", "3", "2", "5" ], [ "7", "romania", "1", "1", "2", "4" ], [ "8", "slovakia", "3", "0", "0", "3" ], [ "9", "cuba", "2", "1", "0", "3" ], [ "10", "bulgaria", "0", "1", "2", "3" ], [ "11", "norway", "1", "1", "0", "2" ], [ "12", "lithuania", "1", "0", "1", "2" ], [ "13", "czech republic", "0", "2", "0", "2" ], [ "14", "belarus", "0", "1", "1", "2" ], [ "15", "uzbekistan", "0", "1", "1", "2" ], [ "16", "italy", "0", "0", "2", "2" ], [ "17", "australia", "1", "0", "0", "1" ], [ "18", "sweden", "1", "0", "0", "1" ], [ "19", "argentina", "0", "1", "0", "1" ], [ "20", "china", "0", "1", "0", "1" ], [ "21", "ukraine", "0", "1", "0", "1" ], [ "22", "israel", "0", "0", "1", "1" ], [ "total", "total", "27", "27", "27", "81" ] ], "title": "", "original_id": "73cc123cf088d1762671001ecd08190f" }, { "_id": "8e44ca4de88e4f11ef10dd822de486d3", "header": [ "season", "races", "wins", "podiums", "poles", "fastest laps" ], "rows": [ [ "2003", "10", "0", "0", "0", "0" ], [ "2003", "5", "0", "0", "0", "0" ], [ "2004", "14", "0", "0", "0", "0" ], [ "2005", "16", "1", "2", "0", "0" ], [ "2006", "14", "0", "0", "0", "0" ], [ "2007", "15", "0", "0", "0", "0" ], [ "2008", "17", "4", "9", "2", "4" ], [ "2009", "16", "0", "2", "1", "0" ], [ "2010", "16", "0", "0", "0", "0" ], [ "2011", "17", "0", "0", "0", "0" ], [ "2012", "16", "0", "0", "0", "0" ], [ "2013", "10", "0", "0", "0", "0" ], [ "total", "166", "5", "13", "3", "4" ] ], "title": "", "original_id": "10d49252c00b82016f0d0b8bfabae105" }, { "_id": "6a5e8a6ec4f7537211b6f2dfeb5c029c", "header": [ "hand", "1 credit", "2 credits", "3 credits", "4 credits", "5 credits" ], "rows": [ [ "royal flush", "250", "500", "750", "1000", "4000" ], [ "straight flush", "60", "120", "180", "240", "400" ], [ "four aces", "400", "800", "1200", "1600", "2000" ], [ "four of a kind , 2 - 4", "100", "200", "300", "400", "500" ], [ "four of a kind , 5 - k", "50", "100", "150", "200", "250" ], [ "full house", "8", "16", "24", "32", "40" ], [ "flush", "5", "10", "15", "20", "25" ], [ "straight", "4", "8", "12", "16", "20" ], [ "three of a kind", "3", "6", "9", "12", "15" ], [ "two pair", "1", "2", "3", "4", "5" ], [ "jacks or better", "1", "2", "3", "4", "5" ], [ "theoretical return", "98.68%", "98.68%", "98.68%", "98.68%", "99.92%" ] ], "title": "", "original_id": "0bf3ab8f74244dfca72c5290d44e6f3e" }, { "_id": "a6f86e8dd171258bb4ade5169e486b7c", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "east germany", "17", "4", "3", "24" ], [ "2", "austria", "12", "13", "10", "35" ], [ "3", "russia", "10", "8", "7", "25" ], [ "4", "great britain", "6", "11", "11", "28" ], [ "5", "netherlands", "6", "3", "3", "12" ], [ "6", "norway", "6", "0", "0", "6" ], [ "7", "france", "5", "4", "4", "13" ], [ "8", "italy", "5", "2", "4", "11" ], [ "9", "germany", "2", "8", "8", "18" ], [ "10", "czechoslovakia", "2", "3", "3", "8" ], [ "11", "switzerland", "2", "2", "2", "6" ], [ "12", "canada", "2", "0", "0", "2" ], [ "13", "finland", "1", "2", "4", "7" ], [ "14", "hungary", "1", "2", "3", "6" ], [ "15", "soviet union", "0", "7", "6", "13" ], [ "16", "ukraine", "0", "3", "3", "6" ], [ "17", "united states", "0", "1", "1", "2" ], [ "18", "yugoslavia", "0", "1", "0", "1" ], [ "19", "sweden", "0", "0", "2", "2" ], [ "20", "georgia", "0", "0", "2", "2" ] ], "title": "", "original_id": "6d38c7ec1308824230451156f31f1f00" }, { "_id": "9846b582c0cad59386869e785110ada0", "header": [ "Player", "Rec.", "Yards", "Avg.", "TD's", "Long" ], "rows": [ [ "Charles Frederick", "115", "1385", "12", "27", "42" ], [ "Jerel Myers", "104", "1183", "11.4", "21", "38" ], [ "Anthony Hines", "58", "822", "14.2", "12", "39" ], [ "Boo Williams", "45", "474", "10.5", "17", "35" ], [ "Ira Gooch", "24", "339", "14.1", "6", "32" ], [ "Sam Simmons", "15", "197", "13.1", "2", "30" ], [ "Kevin Beard", "10", "87", "8.7", "0", "21" ], [ "Dawan Moss", "7", "39", "5.6", "1", "12" ], [ "Cyron Brown", "3", "17", "5.7", "1", "8" ], [ "Larrell Johnson", "3", "14", "4.7", "0", "6" ], [ "Jamarr Wood", "1", "13", "13", "0", "13" ], [ "Cecil Moore", "2", "9", "4.5", "2", "8" ], [ "Raymond Philyaw", "1", "−6", "−6", "0", "−6" ] ], "title": "", "original_id": "78ccc4fb07ce60975392c8b42aa454ea" }, { "_id": "da587e3a91e628bd5cfa8cf42cbdb6fc", "header": [ "year", "2010", "2009", "2008", "2005", "2000" ], "rows": [ [ "shanghai", "1", "2", "1", "1", "1" ], [ "beijing", "2", "1", "2", "2", "2" ], [ "tianjin", "3", "3", "3", "3", "3" ], [ "jiangsu", "4", "4", "5", "6", "6" ], [ "zhejiang", "5", "5", "4", "4", "4" ], [ "inner mongolia", "6", "6", "7", "10", "15" ], [ "guangdong", "7", "7", "6", "5", "5" ], [ "liaoning", "8", "9", "9", "8", "8" ], [ "shandong", "9", "8", "8", "7", "9" ], [ "fujian", "10", "10", "10", "9", "7" ], [ "jilin", "11", "11", "11", "13", "13" ], [ "hebei", "12", "12", "12", "11", "11" ], [ "hubei", "13", "14", "16", "17", "16" ], [ "chongqing", "14", "13", "15", "16", "17" ], [ "shaanxi", "15", "16", "18", "20", "23" ], [ "heilongjiang", "16", "15", "13", "12", "10" ], [ "ningxia", "17", "17", "19", "22", "21" ], [ "shanxi", "18", "18", "14", "15", "18" ], [ "xinjiang", "19", "21", "17", "14", "12" ], [ "hunan", "20", "20", "22", "21", "20" ], [ "henan", "21", "19", "20", "18", "19" ], [ "qinghai", "22", "22", "21", "23", "22" ], [ "hainan", "23", "23", "23", "19", "14" ], [ "jiangxi", "24", "25", "24", "24", "25" ], [ "sichuan", "25", "24", "25", "25", "24" ], [ "anhui", "26", "26", "27", "27", "26" ], [ "guangxi", "27", "27", "26", "28", "28" ], [ "tibet", "28", "28", "28", "26", "29" ], [ "gansu", "29", "30", "30", "30", "30" ], [ "yunnan", "30", "29", "29", "29", "27" ], [ "guizhou", "31", "31", "31", "31", "31" ] ], "title": "", "original_id": "ee38d1e26018264f906e82e45b85e4d8" }, { "_id": "82bf863049cb67acb2b46023a9fb5a05", "header": [ "draw", "artist", "song", "rank", "points", "a krajka", "gj leka", "b haxhia", "d tukiqi", "r magjistari", "gj xhuvani", "a skënderaj" ], "rows": [ [ "1", "manjola nallbani", "kjo botë merr frymë nga dashuria", "7", "27", "3", "4", "4", "7", "8", "1", "0" ], [ "2", "produkt 28", "30 sekonda", "15", "3", "0", "0", "0", "1", "1", "0", "1" ], [ "3", "eneida tarifa", "e para letër", "10", "11", "0", "1", "0", "0", "0", "7", "3" ], [ "4", "mariza ikonomi", "mall i tretur", "9", "20", "2", "3", "0", "3", "3", "3", "6" ], [ "5", "greta koçi", "natën të kërkova", "5", "35", "5", "5", "3", "6", "4", "8", "4" ], [ "6", "flaka krelani & doruntina disha", "jeta kërkon dashuri", "2", "57", "12", "12", "12", "12", "9", "0", "0" ], [ "7", "mira konçi & redon makashi", "nën një qiell", "6", "35", "6", "6", "6", "9", "6", "2", "0" ], [ "8", "kthjellu", "dhoma", "11", "9", "0", "0", "1", "0", "0", "0", "8" ], [ "9", "kozma dushi", "tatuazh në kujtesë", "16", "1", "1", "0", "0", "0", "0", "0", "0" ], [ "10", "devis xherahu", "endacaku", "17", "0", "0", "0", "0", "0", "0", "0", "0" ], [ "11", "teuta kurti", "qyteti i dashurisë", "14", "5", "0", "0", "5", "0", "0", "0", "0" ], [ "12", "samanta karavello", "pse u harrua dashuria", "8", "23", "4", "2", "2", "5", "0", "5", "5" ], [ "13", "juliana pasha", "një qiell të ri", "3", "54", "9", "9", "9", "4", "5", "9", "9" ], [ "14", "agim poshka", "kujt i them të dua", "12", "8", "0", "0", "0", "0", "2", "4", "2" ], [ "15", "jonida maliqi", "s'ka fajtor në dashuri", "4", "36", "0", "7", "7", "2", "7", "6", "7" ], [ "16", "olta boka", "zemrën e lamë peng", "1", "67", "7", "8", "8", "8", "12", "12", "12" ], [ "17", "rosela gjylbegu", "po lind një yll", "13", "8", "8", "0", "0", "0", "0", "0", "0" ] ], "title": "", "original_id": "a91f81d1472de78a9c78cef99cf9e92c" }, { "_id": "c35f24887c4d6d7a66fa65189719346c", "header": [ "team", "points", "played", "drawn", "lost", "against", "diff" ], "rows": [ [ "ua maracaibo", "41", "18", "5", "1", "11", "+ 17" ], [ "deportivo tã¡chira fc", "31", "18", "4", "5", "23", "+ 9" ], [ "mineros de guayana", "27", "18", "6", "5", "19", "+ 5" ], [ "carabobo fc", "27", "18", "6", "5", "24", "+ 4" ], [ "caracas fc", "24", "18", "3", "8", "25", "+ 3" ], [ "cd italmaracaibo", "24", "18", "6", "6", "22", "+ 1" ], [ "aragua fc", "22", "18", "4", "8", "27", "- 11" ], [ "trujillanos fc", "18", "18", "6", "8", "24", "- 10" ], [ "estudiantes de mãrida fc", "15", "18", "6", "9", "30", "- 9" ], [ "monagas sc", "15", "18", "6", "9", "28", "- 9" ] ], "title": "", "original_id": "b1750bbee8884677e5b289413c44f99a" }, { "_id": "6672305c8f131415e15bdff68648d909", "header": [ "season", "overall", "slalom", "giant slalom", "super g", "downhill", "combined" ], "rows": [ [ "1990", "44", "-", "39", "12", "-", "21" ], [ "1991", "15", "-", "29", "3", "13", "12" ], [ "1992", "3", "-", "10", "4", "1", "-" ], [ "1993", "2", "58", "7", "1", "1", "7" ], [ "1994", "3", "49", "6", "1", "1", "19" ], [ "1995", "2", "19", "9", "1", "3", "4" ], [ "1996", "1", "39", "2", "1", "2", "-" ], [ "1997", "2", "19", "2", "2", "5", "-" ], [ "1998", "1", "12", "6", "1", "1", "2" ] ], "title": "", "original_id": "8b3679190263b8ff21f47df999a55756" }, { "_id": "d4837db1e5300b89e443332df85de6e6", "header": [ "name", "league goals", "fa cup goals", "fl cup goals", "other goals", "total", "career" ], "rows": [ [ "george brown", "142", "17", "0", "0", "159", "1921 - 1929" ], [ "jimmy glazzard", "142", "12", "0", "0", "154", "1946 - 1956" ], [ "andy booth", "133", "5", "4", "8", "150", "1991 - 1996 and 2001 - 2009" ], [ "billy smith", "114", "12", "0", "0", "126", "1913 - 1934" ], [ "les massie", "100", "6", "2", "0", "108", "1956 - 1966" ], [ "vic metcalfe", "87", "3", "0", "0", "90", "1946 - 1958" ], [ "alex jackson", "70", "19", "0", "0", "89", "1925 - 1930" ], [ "jordan rhodes", "73", "2", "6", "6", "87", "2009 - 2012" ], [ "frank mann", "68", "7", "0", "0", "75", "1912 - 1923" ], [ "dave mangnall", "61", "12", "0", "0", "73", "1929 - 1934" ], [ "derek stokes", "65", "2", "2", "0", "69", "1960 - 1965" ], [ "kevin mchale", "60", "5", "3", "0", "68", "1956 - 1967" ], [ "iwan roberts", "50", "4", "6", "8", "68", "1990 - 1993" ], [ "ian robins", "59", "5", "3", "0", "67", "1978 - 1982" ], [ "marcus stewart", "58", "2", "7", "0", "67", "1996 - 2000" ], [ "mark lillis", "56", "4", "3", "0", "63", "1978 - 1985" ], [ "charlie wilson", "57", "5", "0", "0", "62", "1922 - 1925" ], [ "alan gowling", "58", "1", "2", "0", "61", "1972 - 1975" ], [ "craig maskell", "43", "3", "4", "4", "55", "1988 - 1990" ], [ "brian stanton", "45", "6", "3", "0", "54", "1979 - 1986" ], [ "colin dobson", "50", "0", "2", "0", "52", "1966 - 1970" ], [ "ernie islip", "44", "8", "0", "0", "52", "1913 - 1923" ], [ "paweł abbott", "48", "1", "2", "0", "51", "2004 - 2007" ], [ "clem stephenson", "42", "8", "0", "0", "50", "1921 - 1929" ], [ "david cowling", "43", "2", "3", "0", "48", "1978 - 1987" ], [ "duncan shearer", "38", "3", "6", "1", "48", "1986 - 1988" ], [ "frank worthington", "41", "5", "2", "0", "48", "1967 - 1972" ], [ "charlie luke", "40", "7", "0", "0", "47", "1931 - 1936" ], [ "phil starbuck", "36", "4", "2", "5", "47", "1991 - 1995" ], [ "jimmy lawson", "42", "4", "0", "0", "46", "1968 - 1976" ], [ "alf lythgoe", "42", "4", "0", "0", "46", "1934 - 1938" ], [ "george mclean", "43", "3", "0", "0", "46", "1930 - 1934" ], [ "danny schofield", "39", "1", "0", "6", "46", "1998 - 2008" ], [ "peter fletcher", "36", "4", "5", "0", "45", "1978 - 1982" ], [ "sammy taylor", "39", "6", "0", "0", "45", "1919 - 1921" ], [ "tony leighton", "40", "2", "2", "0", "44", "1965 - 1968" ], [ "ronnie jepson", "36", "3", "2", "1", "42", "1993 - 1996" ], [ "bob kelly", "39", "3", "0", "0", "42", "1927 - 1932" ], [ "lee novak", "34", "5", "2", "1", "42", "2009 - 2013" ], [ "terry gray", "36", "2", "3", "0", "41", "1973 - 1979" ] ], "title": "", "original_id": "f10d21dbe9cca173c388760beaa75c80" }, { "_id": "5c2940fee5196bea80d1d682db43694e", "header": [ "club", "played", "drawn", "lost", "points for", "points against", "tries for", "tries against", "try bonus", "losing bonus", "points" ], "rows": [ [ "club", "played", "drawn", "lost", "points for", "points against", "tries for", "tries against", "try bonus", "losing bonus", "points" ], [ "oakdale rfc", "22", "2", "0", "614", "226", "88", "23", "13", "0", "97" ], [ "blaenavon rfc", "22", "1", "5", "444", "271", "61", "33", "5", "2", "73" ], [ "brynithel rfc", "22", "3", "4", "398", "292", "41", "24", "4", "1", "71" ], [ "caldicot rfc", "22", "0", "8", "500", "330", "69", "44", "8", "3", "67" ], [ "usk rfc", "22", "2", "8", "484", "431", "71", "58", "11", "1", "64" ], [ "hartridge rfc", "22", "1", "11", "424", "345", "52", "45", "5", "5", "52" ], [ "bettws rfc", "22", "3", "11", "476", "438", "59", "53", "6", "7", "51" ], [ "rtb (ebbw vale) rfc", "22", "3", "12", "317", "371", "38", "50", "5", "4", "43" ], [ "ynysddu rfc", "22", "1", "14", "315", "376", "35", "44", "3", "9", "42" ], [ "llanhilleth rfc", "22", "3", "13", "357", "475", "42", "61", "3", "4", "37" ], [ "trinant rfc", "22", "1", "15", "261", "487", "29", "65", "1", "4", "31" ], [ "pontllanfraith rfc", "22", "0", "21", "160", "708", "17", "102", "2", "1", "7" ] ], "title": "", "original_id": "fb233753896ca878c04484eeb4f019b9" }, { "_id": "50c802cb7b5fb28d5e88fca8750cd183", "header": [ "Month", "Jan", "Feb", "Mar", "Apr", "May", "Jun", "Jul", "Aug", "Sep", "Oct", "Nov", "Dec", "Year" ], "rows": [ [ "Record high °F (°C)", "76\n(24)", "86\n(30)", "96\n(36)", "96\n(36)", "95\n(35)", "104\n(40)", "111\n(44)", "109\n(43)", "105\n(41)", "96\n(36)", "90\n(32)", "78\n(26)", "111\n(44)" ], [ "Average high °F (°C)", "46.2\n(7.9)", "50.4\n(10.2)", "59.1\n(15.1)", "68.7\n(20.4)", "75.5\n(24.2)", "83.5\n(28.6)", "88.7\n(31.5)", "89.4\n(31.9)", "80.8\n(27.1)", "70.3\n(21.3)", "59.2\n(15.1)", "48.0\n(8.9)", "68.3\n(20.2)" ], [ "Average low °F (°C)", "26.1\n(−3.3)", "29.0\n(−1.7)", "37.8\n(3.2)", "46.9\n(8.3)", "55.7\n(13.2)", "64.1\n(17.8)", "68.7\n(20.4)", "67.7\n(19.8)", "58.9\n(14.9)", "47.6\n(8.7)", "39.2\n(4)", "28.1\n(−2.2)", "47.5\n(8.6)" ], [ "Record low °F (°C)", "−23\n(−31)", "−24\n(−31)", "−11\n(−24)", "18\n(−8)", "28\n(−2)", "41\n(5)", "48\n(9)", "44\n(7)", "29\n(−2)", "17\n(−8)", "5\n(−15)", "−12\n(−24)", "−24\n(−31)" ], [ "Precipitation inches (mm)", "1.99\n(50.5)", "2.43\n(61.7)", "3.54\n(89.9)", "4.05\n(102.9)", "4.99\n(126.7)", "4.59\n(116.6)", "3.18\n(80.8)", "2.75\n(69.9)", "4.43\n(112.5)", "3.83\n(97.3)", "4.19\n(106.4)", "2.73\n(69.3)", "42.7\n(1,084.6)" ], [ "Snowfall inches (cm)", "1.6\n(4.1)", "2.0\n(5.1)", "0\n(0)", "0\n(0)", "0\n(0)", "0\n(0)", "0\n(0)", "0\n(0)", "0\n(0)", "0\n(0)", "0\n(0)", ".7\n(1.8)", "4.4\n(11.2)" ], [ "Avg. precipitation days (≥ 0.01 in)", "5.4", "6.6", "8.2", "9.0", "11.2", "8.9", "7.0", "6.4", "7.6", "7.9", "7.0", "6.3", "91.4" ], [ "Avg. snowy days (≥ 0.1 in)", ".7", ".9", "0", "0", "0", "0", "0", "0", "0", "0", "0", ".5", "2.3" ] ], "title": "", "original_id": "77f8372afde69977a62eda34f4cae760" }, { "_id": "d04c9e45bd6464470e71de1e8cfc2336", "header": [ "Unnamed: 0", "Club", "Played", "Won", "Drawn", "Lost", "Points For", "Points Against", "Points Difference", "Tries For", "Tries Against", "Try Bonus", "Losing Bonus", "Points" ], "rows": [ [ "1", "Saracens (RU)", "22", "19", "0", "3", "629", "353", "276", "68", "39", "10", "1", "87" ], [ "2", "Northampton Saints (CH)", "22", "16", "2", "4", "604", "350", "254", "72", "31", "7", "3", "78" ], [ "3", "Leicester Tigers (SF)", "22", "15", "2", "5", "542", "430", "112", "59", "41", "7", "3", "74" ], [ "4", "Harlequins (SF)", "22", "15", "0", "7", "437", "365", "72", "43", "33", "4", "3", "67" ], [ "5", "Bath", "22", "14", "2", "6", "495", "388", "107", "48", "38", "4", "3", "67" ], [ "6", "Sale Sharks", "22", "12", "0", "10", "432", "399", "33", "46", "40", "3", "6", "57" ], [ "7", "London Wasps", "22", "9", "0", "13", "451", "533", "-82", "48", "56", "4", "9", "49" ], [ "8", "Exeter Chiefs", "22", "9", "0", "13", "426", "480", "-54", "40", "51", "2", "7", "45" ], [ "9", "Gloucester", "22", "8", "0", "14", "440", "539", "-99", "46", "60", "4", "8", "44" ], [ "10", "London Irish", "22", "7", "0", "15", "396", "496", "-100", "40", "49", "2", "6", "36" ], [ "11", "Newcastle Falcons", "22", "3", "0", "19", "281", "544", "-263", "23", "62", "2", "8", "22" ], [ "12", "Worcester Warriors (R)", "22", "2", "0", "20", "325", "581", "-256", "31", "64", "1", "7", "16" ] ], "title": "", "original_id": "908fe4eba12fbc8328b6ca83eaf617fb" }, { "_id": "9c5563871561e6e9b80a48c1e1d3de40", "header": [ "Month", "Jan", "Feb", "Mar", "Apr", "May", "Jun", "Jul", "Aug", "Sep", "Oct", "Nov", "Dec", "Year" ], "rows": [ [ "Record high °C (°F)", "10.8\n(51.4)", "10.7\n(51.3)", "25.7\n(78.3)", "29.2\n(84.6)", "35.4\n(95.7)", "38.3\n(100.9)", "36.7\n(98.1)", "40.0\n(104)", "35.1\n(95.2)", "27.8\n(82)", "21.0\n(69.8)", "12.9\n(55.2)", "40.0\n(104)" ], [ "Average high °C (°F)", "−8.5\n(16.7)", "−6.2\n(20.8)", "1.6\n(34.9)", "11.6\n(52.9)", "18.1\n(64.6)", "22.1\n(71.8)", "25.2\n(77.4)", "24.6\n(76.3)", "18.6\n(65.5)", "10.8\n(51.4)", "−0.2\n(31.6)", "−6.6\n(20.1)", "9.3\n(48.7)" ], [ "Daily mean °C (°F)", "−14.5\n(5.9)", "−11.6\n(11.1)", "−4.1\n(24.6)", "4.8\n(40.6)", "11.0\n(51.8)", "15.5\n(59.9)", "18.1\n(64.6)", "17.3\n(63.1)", "11.6\n(52.9)", "4.1\n(39.4)", "−5.2\n(22.6)", "−11.9\n(10.6)", "4.9\n(40.8)" ], [ "Average low °C (°F)", "−19.0\n(−2.2)", "−16.9\n(1.6)", "−9.4\n(15.1)", "−2.1\n(28.2)", "3.8\n(38.8)", "8.8\n(47.8)", "11.0\n(51.8)", "10.0\n(50)", "4.4\n(39.9)", "−2.5\n(27.5)", "−10.4\n(13.3)", "−17.1\n(1.2)", "−3.3\n(26.1)" ], [ "Record low °C (°F)", "−40.4\n(−40.7)", "−43.4\n(−46.1)", "−34.7\n(−30.5)", "−17.4\n(0.7)", "−11.4\n(11.5)", "−2.3\n(27.9)", "3.4\n(38.1)", "-0.0\n(32)", "−10.7\n(12.7)", "−26.3\n(−15.3)", "−36.1\n(−33)", "−40.4\n(−40.7)", "−43.4\n(−46.1)" ], [ "Precipitation mm (inches)", "10.9\n(0.429)", "6.7\n(0.264)", "11.7\n(0.461)", "23.5\n(0.925)", "40.3\n(1.587)", "67.0\n(2.638)", "58.4\n(2.299)", "43.8\n(1.724)", "28.8\n(1.134)", "13.2\n(0.52)", "10.6\n(0.417)", "12.7\n(0.5)", "327.6\n(12.898)" ], [ "Rainfall mm (inches)", "0.3\n(0.012)", "0.3\n(0.012)", "1.7\n(0.067)", "15.6\n(0.614)", "38.3\n(1.508)", "67.0\n(2.638)", "58.7\n(2.311)", "43.8\n(1.724)", "28.5\n(1.122)", "8.3\n(0.327)", "1.9\n(0.075)", "0.2\n(0.008)", "264.6\n(10.417)" ], [ "Snowfall cm (inches)", "15.6\n(6.14)", "9.6\n(3.78)", "12.9\n(5.08)", "9.5\n(3.74)", "2.1\n(0.83)", "0.04\n(0.016)", "0\n(0)", "0\n(0)", "0.8\n(0.31)", "6.5\n(2.56)", "12.0\n(4.72)", "17.5\n(6.89)", "86.5\n(34.06)" ] ], "title": "", "original_id": "e5be717f4811ecea5e824a40a0675c39" }, { "_id": "766cd4510c6e3359b643883c5a6ecd47", "header": [ "Country", "Amphibians", "Birds", "Mammals", "Reptile", "Total terrestrial vertebrates", "Vascular plants", "Biodiversity" ], "rows": [ [ "Belize", "46", "544", "147", "140", "877", "2894", "3771" ], [ "Costa Rica", "183", "838", "232", "258", "1511", "12119", "13630" ], [ "El Salvador", "30", "434", "137", "106", "707", "2911", "3618" ], [ "Guatemala", "133", "684", "193", "236", "1246", "8681", "9927" ], [ "Honduras", "101", "699", "201", "213", "1214", "5680", "6894" ], [ "Nicaragua", "61", "632", "181", "178", "1052", "7590", "8642" ], [ "Panama", "182", "904", "241", "242", "1569", "9915", "11484" ] ], "title": "", "original_id": "485b450b0ede043ce95109c0e9057578" }, { "_id": "cd2c0ee7c17268898ea913d229cfe67d", "header": [ "Party", "Candidate", "Votes", "%", "∆%" ], "rows": [ [ "Conservative", "Joe Daniel", "14,422", "36.78", "+5.78" ], [ "Liberal", "Yasmin Ratansi", "13,552", "34.56", "-13.51" ], [ "New Democratic", "Mary Trapani Hynes", "9,878", "25.19", "+11.87" ], [ "Green", "Akil Sadikali", "1,114", "2.84", "-4.05" ], [ "Christian Heritage", "Ryan Kidd", "246", "0.63", "-0.07" ], [ "Total valid votes", "Total valid votes", "39,212", "100.00", null ], [ "Total rejected ballots", "Total rejected ballots", "218", "0.55", "–" ], [ "Turnout", "Turnout", "39,430", "57.24", "–" ], [ "Eligible voters", "Eligible voters", "68,890", "–", "–" ] ], "title": "", "original_id": "64664032a7a369ee8b22f988514f1107" }, { "_id": "4845dc728710185107f808a6ec834bf3", "header": [ "Period", "Live births per year", "Deaths per year", "Natural change per year", "CBR1", "CDR1", "NC1", "TFR1", "IMR1" ], "rows": [ [ "1950-1955", "9 000", "5 000", "4 000", "47.9", "27.1", "20.8", "6.67", "184.8" ], [ "1955-1960", "10 000", "6 000", "5 000", "49.0", "26.8", "22.3", "6.67", "181.4" ], [ "1960-1965", "12 000", "6 000", "6 000", "48.5", "25.7", "22.8", "6.67", "174.1" ], [ "1965-1970", "13 000", "7 000", "7 000", "47.8", "24.1", "23.8", "6.67", "163.1" ], [ "1970-1975", "16 000", "7 000", "8 000", "47.0", "22.0", "25.1", "6.67", "149.3" ], [ "1975-1980", "18 000", "8 000", "10 000", "45.8", "19.6", "26.2", "6.67", "133.2" ], [ "1980-1985", "20 000", "8 000", "12 000", "42.7", "17.1", "25.6", "6.39", "117.1" ], [ "1985-1990", "21 000", "8 000", "13 000", "40.4", "15.0", "25.3", "6.11", "104.0" ], [ "1990-1995", "19 000", "7 000", "12 000", "35.2", "12.5", "22.7", "5.27", "87.5" ], [ "1995-2000", "16 000", "5 000", "11 000", "29.2", "9.9", "19.3", "4.13", "69.7" ], [ "2000-2005", "15 000", "5 000", "11 000", "25.2", "7.9", "17.2", "3.3", "52.8" ], [ "2005-2010", "15 000", "5 000", "10 000", "21.5", "7.2", "14.4", "2.61", "44.4" ] ], "title": "", "original_id": "4119f4674c16142eed9eef4730b2c75f" }, { "_id": "675794ec972eb1e612281e0e27ebd5d2", "header": [ "Ethnicity", "1880", "1899", "1913", "19301", "1956", "1966", "1977", "1992", "2002" ], "rows": [ [ "All", "139,671", "258,242", "380,430", "437,131", "593,659", "702,461", "863,348", "1,019,766", "971,643" ], [ "Romanian", "43,671 (31%)", "118,919 (46%)", "216,425 (56.8%)", "282,844 (64.7%)", "514,331 (86.6%)", "622,996 (88.7%)", "784,934 (90.9%)", "926,608 (90.8%)", "883,620 (90.9%)" ], [ "Bulgarian", "24,915 (17%)", "38,439 (14%)", "51,149 (13.4%)", "42,070 (9.6%)", "749 (0.13%)", "524 (0.07%)", "415 (0.05%)", "311 (0.03%)", "135 (0.01%)" ], [ "Turkish", "18,624 (13%)", "12,146 (4%)", "20,092 (5.3%)", "21,748 (5%)", "11,994 (2%)", "16,209 (2.3%)", "21,666 (2.5%)", "27,685 (2.7%)", "27,580 (2.8%)" ], [ "Tatar", "29,476 (21%)", "28,670 (11%)", "21,350 (5.6%)", "15,546 (3.6%)", "20,239 (3.4%)", "21,939 (3.1%)", "22,875 (2.65%)", "24,185 (2.4%)", "23,409 (2.4%)" ], [ "Russian-Lipovan", "8,250 (6%)", "12,801 (5%)", "35,859 (9.4%)", "26,210 (6%)²", "29,944 (5%)", "30,509 (4.35%)", "24,098 (2.8%)", "26,154 (2.6%)", "21,623 (2.2%)" ], [ "Ruthenian\n(Ukrainian from 1956)", "455 (0.3%)", "13,680 (5%)", "35,859 (9.4%)", "33 (0.01%)", "7,025 (1.18%)", "5,154 (0.73%)", "2,639 (0.3%)", "4,101 (0.4%)", "1,465 (0.1%)" ], [ "Dobrujan Germans", "2,461 (1.7%)", "8,566 (3%)", "7,697 (2%)", "12,023 (2.75%)", "735 (0.12%)", "599 (0.09%)", "648 (0.08%)", "677 (0.07%)", "398 (0.04%)" ], [ "Greek", "4,015 (2.8%)", "8,445 (3%)", "9,999 (2.6%)", "7,743 (1.8%)", "1,399 (0.24%)", "908 (0.13%)", "635 (0.07%)", "1,230 (0.12%)", "2,270 (0.23%)" ], [ "Roma", "702 (0.5%)", "2,252 (0.87%)", "3,263 (0.9%)", "3,831 (0.88%)", "1,176 (0.2%)", "378 (0.05%)", "2,565 (0.3%)", "5,983 (0.59%)", "8,295 (0.85%)" ] ], "title": "", "original_id": "b1ea3f96d887432df9bb3aa3bcf800d6" }, { "_id": "ffe3097bbe884c33f76c43cc63068316", "header": [ "Pos", "No", "Driver", "Constructor", "Lap", "Gap" ], "rows": [ [ "1", "98", "Walt Faulkner", "Kurtis Kraft-Offenhauser", "4:27.97", "–" ], [ "2", "28", "Fred Agabashian", "Kurtis Kraft-Offenhauser", "4:31.10", "+ 3.13" ], [ "3", "31", "Mauri Rose", "Deidt-Offenhauser", "4:32.07", "+ 4.10" ], [ "4", "5", "George Connor", "Lesovsky-Offenhauser", "4:32.39", "+ 4.42" ], [ "5", "1", "Johnnie Parsons", "Kurtis Kraft-Offenhauser", "4:32.43", "+ 4.46" ], [ "6", "49", "Jack McGrath", "Kurtis Kraft-Offenhauser", "4:33.00", "+ 5.03" ], [ "7", "69", "Duke Dinsmore", "Kurtis Kraft-Offenhauser", "4:34.67", "+ 6.70" ], [ "8", "14", "Tony Bettenhausen", "Deidt-Offenhauser", "4:34.92", "+ 6.95" ], [ "9", "17", "Joie Chitwood", "Kurtis Kraft-Offenhauser", "4:35.32", "+ 7.35" ], [ "10", "3", "Bill Holland", "Deidt-Offenhauser", "4:35.90", "+ 7.93" ], [ "11", "59", "Pat Flaherty", "Kurtis Kraft-Offenhauser", "4:37.76", "+ 9.79" ], [ "12", "54", "Cecil Green", "Kurtis Kraft-Offenhauser", "4:30.86", "+ 2.89" ], [ "13", "18", "Duane Carter", "Stevens-Offenhauser", "4:33.42", "+ 5.45" ], [ "14", "21", "Spider Webb", "Maserati-Offenhauser", "4:37.46", "+ 9.49" ], [ "15", "81", "Jerry Hoyt", "Kurtis Kraft-Offenhauser", "4:37.95", "+ 9.98" ], [ "16", "2", "Myron Fohr", "Marchese-Offenhauser", "4:33.32", "+ 5.35" ], [ "17", "24", "Bayliss Levrett", "Adams-Offenhauser", "4:34.43", "+ 6.46" ], [ "18", "45", "Dick Rathmann", "Watson-Offenhauser", "4:34.96", "+ 6.99" ], [ "19", "7", "Paul Russo", "Nichels-Offenhauser", "4:35.25", "+ 7.28" ], [ "20", "4", "Walt Brown", "Kurtis Kraft-Offenhauser", "4:35.96", "+ 7.99" ], [ "21", "12", "Henry Banks", "Maserati-Offenhauser", "4:37.68", "+ 9.71" ], [ "22", "67", "Bill Schindler", "Snowberger-Offenhauser", "4:31.31", "+ 3.34" ], [ "23", "8", "Lee Wallard", "Moore-Offenhauser", "4:31.83", "+ 3.86" ], [ "24", "55", "Troy Ruttman", "Lesovsky-Offenhauser", "4:32.91", "+ 4.94" ], [ "25", "23", "Sam Hanks", "Kurtis Kraft-Offenhauser", "4:33.57", "+ 5.60" ], [ "26", "15", "Mack Hellings", "Kurtis Kraft-Offenhauser", "4:35.32", "+ 7.35" ], [ "27", "22", "Jimmy Davies", "Ewing-Offenhauser", "4:36.07", "+ 8.10" ], [ "28", "76", "Jim Rathmann", "Wetteroth-Offenhauser", "4:37.01", "+ 9.04" ], [ "29", "27", "Walt Ader", "Rae-Offenhauser", "4:37.05", "+ 9.08" ], [ "30", "77", "Jackie Holmes", "Olson-Offenhauser", "4:37.57", "+ 9.60" ], [ "31", "75", "Gene Hartley", "Langley-Offenhauser", "4:38.61", "+ 10.64" ], [ "32", "61", "Jimmy Jackson", "Kurtis Kraft-Cummins", "4:38.62", "+ 10.65" ], [ "33", "62", "Johnny McDowell", "Kurtis Kraft-Offenhauser", "4:37.58", "+ 9.61" ] ], "title": "", "original_id": "b0bce3c8708c147f9d7b85cac2fb8549" }, { "_id": "db0eca2addbd8d93e213d289ae3a3d34", "header": [ "Institution", "Location", "Established", "Gained university status", "Vice-chancellor", "Total number of students", "Research funding (£,000)" ], "rows": [ [ "Birkbeck, University of London", "London", "1823", "1920", "Professor David Latchman", "19,020", "9,985" ], [ "University of East Anglia", "Norwich", "1963", "1963", "Professor Edward Acton", "19,585", "16,482" ], [ "University of Essex", "Colchester", "1964", "1964", "Professor Anthony Forster", "11,690", "9,967" ], [ "Goldsmiths, University of London", "London", "1891", "1904", "Dr Pat Loughrey", "7,615", "8,539" ], [ "Institute of Education, University of London", "London", "1902", "1932", "Professor Chris Husbands", "7,215", "7,734" ], [ "University of Lancaster", "Lancaster", "1964", "1964", "Professor Mark Smith", "12,695", "18,640" ], [ "University of Leicester", "Leicester", "1921", "1957", "Professor Robert Burgess", "16,160", "22,225" ], [ "Loughborough University", "Loughborough", "1909", "1966", "Professor Robert Allison", "17,825", "22,398" ], [ "Royal Holloway, University of London", "Egham", "1849", "1900", "Professor Paul Layzell (Principal)", "7,620", "13,699" ], [ "SOAS, University of London", "London", "1916", "1916", "Professor Paul Webley", "4,525", "7,238" ], [ "University of Sussex", "Brighton", "1961", "1961", "Professor Michael Farthing", "12,415", "16,196" ] ], "title": "", "original_id": "a7b1009dbaec71cea179c8bc90230152" }, { "_id": "3560be2ffcb66508bbaa9105b6a69433", "header": [ "Unnamed: 0", "agglutination", "synthesis", "compounding", "derivation", "inflection", "prefixing", "suffixing" ], "rows": [ [ "Swahili", "0.67", "2.56", "1.0", "0.03", "0.31", "0.45", "0.16" ], [ "spoken Turkish", "0.67", "1.75", "1.04", "0.06", "0.38", "0.0", "0.44" ], [ "written Turkish", "0.6", "2.33", "1.0", "0.11", "0.43", "0.0", "0.54" ], [ "Yakut", "0.51", "2.17", "1.02", "0.16", "0.38", "0.0", "0.53" ], [ "Greek", "0.4", "1.82", "1.02", "0.07", "0.37", "0.02", "0.42" ], [ "English", "0.3", "1.67", "1.0", "0.09", "0.32", "0.02", "0.38" ], [ "Eskimo", "0.03", "3.7", "1.0", "0.34", "0.47", "0.0", "0.73" ] ], "title": "", "original_id": "193c026fe2590582330b4506df2091bc" }, { "_id": "51fab6743838fef6232aa5803949fd57", "header": [ "Team", "Year", "Regular Season\nWon", "Regular Season\nLost", "Regular Season\nTies", "Regular Season\nWin %", "Regular Season\nFinish", "Post Season\nWon", "Post Season\nLost", "Post Season\nWin %", "Post Season\nResult" ], "rows": [ [ "DEN", "1981", "10", "6", "0", "0.625", "2nd in AFC West", "-", "-", "-", "-" ], [ "DEN", "1982", "2", "7", "0", "0.222", "5th in AFC West", "-", "-", "-", "-" ], [ "DEN", "1983", "9", "7", "0", "0.563", "2nd in AFC West", "0", "1", ".000", "Lost to Seattle Seahawks in AFC Wild Card Game." ], [ "DEN", "1984", "13", "3", "0", "0.813", "1st in AFC West", "0", "1", ".000", "Lost to Pittsburgh Steelers in AFC Divisional Game." ], [ "DEN", "1985", "11", "5", "0", "0.688", "2nd in AFC West", "-", "-", "-", "-" ], [ "DEN", "1986", "11", "5", "0", "0.688", "1st in AFC West", "2", "1", ".667", "Lost to New York Giants in Super Bowl XXI." ], [ "DEN", "1987", "10", "4", "1", "0.714", "1st in AFC West", "2", "1", ".667", "Lost to Washington Redskins in Super Bowl XXII." ], [ "DEN", "1988", "8", "8", "0", "0.5", "2nd in AFC West", "-", "-", "-", "-" ], [ "DEN", "1989", "11", "5", "0", "0.688", "1st in AFC West", "2", "1", ".667", "Lost to San Francisco 49ers in Super Bowl XXIV." ], [ "DEN", "1990", "5", "11", "0", "0.313", "5th in AFC West", "-", "-", "-", "-" ], [ "DEN", "1991", "12", "4", "0", "0.75", "1st in AFC West", "1", "1", ".500", "Lost to Buffalo Bills in AFC Championship Game." ], [ "DEN", "1992", "8", "8", "0", "0.5", "3rd in AFC West", "-", "-", "-", "-" ], [ "DEN Total", "DEN Total", "110", "73", "1", "0.601", null, "7", "6", ".538", null ], [ "NYG", "1993", "11", "5", "0", "0.688", "2nd in NFC East", "1", "1", ".500", "Lost to San Francisco 49ers in NFC Divisional Game." ], [ "NYG", "1994", "9", "7", "0", "0.563", "2nd in NFC East", "-", "-", "-", "-" ], [ "NYG", "1995", "5", "11", "0", "0.313", "4th in NFC East", "-", "-", "-", "-" ], [ "NYG", "1996", "6", "10", "0", "0.375", "5th in NFC East", "-", "-", "-", "-" ], [ "NYG Total", "NYG Total", "31", "33", "0", "0.484", null, "1", "1", ".500", null ], [ "ATL", "1997", "7", "9", "0", "0.438", "2nd in NFC West", "-", "-", "-", "-" ], [ "ATL", "1998", "14", "2", "0", "0.875", "1st in NFC West", "2", "1", ".667", "Lost to Denver Broncos in Super Bowl XXXIII." ], [ "ATL", "1999", "5", "11", "0", "0.313", "3rd in NFC West", "-", "-", "-", "-" ], [ "ATL", "2000", "4", "12", "0", "0.25", "5th in NFC West", "-", "-", "-", "-" ], [ "ATL", "2001", "7", "9", "0", "0.438", "3rd in NFC South", "-", "-", "-", "-" ], [ "ATL", "2002", "9", "6", "1", "0.594", "2nd in NFC South", "1", "1", ".500", "Lost to Philadelphia Eagles in NFC Divisional Game." ], [ "ATL", "2003", "3", "10", "0", "0.231", "4th in NFC South", "-", "-", "-", "-" ], [ "ATL Total", "ATL Total", "49", "59", "1", "0.454", null, "3", "2", ".600", null ], [ "Total", "Total", "190", "165", "2", "0.535", null, "11", "9", ".550", null ] ], "title": "", "original_id": "76bd1c55217e71d2dad443c1499400dc" }, { "_id": "e3731c392955ab1d78df183f6cde86b8", "header": [ "Rank", "Title", "Studio", "Actors", "Gross" ], "rows": [ [ "1.0", "Star Wars*", "Lucasfilm/20th Century Fox", "Mark Hamill, Harrison Ford, Carrie Fisher, Peter Cushing, Alec Guinness, David Prowse, James Earl Jones, Anthony Daniels, Kenny Baker and Peter Mayhew", "$460,998,007" ], [ "2.0", "Smokey and the Bandit", "Universal/Rastar", "Burt Reynolds, Sally Field, Jackie Gleason, Jerry Reed and Mike Henry", "$300,000,000" ], [ "3.0", "Close Encounters of the Third Kind*", "Columbia", "Richard Dreyfuss, Teri Garr, Melinda Dillon and François Truffaut", "$166,000,000" ], [ "4.0", "Saturday Night Fever", "Paramount", "John Travolta and Karen Lynn Gorney", "$139,486,124" ], [ "5.0", "The Goodbye Girl", "MGM/Warner Bros./Rastar", "Richard Dreyfuss, Marsha Mason and Quinn Cummings", "$102,000,000" ], [ "6.0", "The Rescuers*", "Disney", "voices of Eva Gabor, Bob Newhart and Geraldine Page", "$71,215,869" ], [ "7.0", "Oh, God!", "Warner Bros.", "George Burns, John Denver and Teri Garr", "$51,061,196" ], [ "8.0", "A Bridge Too Far", "United Artists", "Dirk Bogarde, James Caan, Sean Connery, Elliott Gould, Laurence Olivier, Ryan O'Neal, Robert Redford, Liv Ullmann, Michael Caine, Edward Fox, Anthony Hopkins, Gene Hackman, Hardy Krüger and Maximilian Schell", "$50,800,000" ], [ "9.0", "The Deep", "Columbia", "Robert Shaw, Nick Nolte and Jacqueline Bisset", "$50,681,884" ], [ "10.0", "The Spy Who Loved Me", "United Artists", "Roger Moore, Barbara Bach, Curd Jürgens and Richard Kiel", "$46,838,673" ], [ "11.0", "Annie Hall", "United Artists", "Woody Allen and Diane Keaton", "$38,251,425" ], [ "12.0", "Semi-Tough", "United Artists", "Burt Reynolds, Kris Kristofferson and Jill Clayburgh", "$37,187,139" ], [ "13.0", "Pete's Dragon", "Disney", "Helen Reddy, Mickey Rooney and Shelley Winters", "$36,000,000" ], [ "14.0", "The Gauntlet", "Warner Bros.", "Clint Eastwood and Sondra Locke", "$35,400,000" ], [ "15.0", "The Turning Point", "20th Century Fox", "Shirley MacLaine, Anne Bancroft, Tom Skerritt, Mikhail Baryshnikov and Leslie Browne", "$33,600,000" ], [ "16.0", "Heroes", "Universal", "Henry Winkler, Sally Field, and Harrison Ford", "$33,500,000" ], [ "17.0", "High Anxiety", "20th Century Fox", "Mel Brooks, Madeline Kahn, Cloris Leachman, Harvey Korman, Ron Carey, Howard Morris and Dick Van Patten", "$31,063,038" ], [ "18.0", "Exorcist II: The Heretic", "Warner Bros.", "Linda Blair, Richard Burton, Louise Fletcher, Max von Sydow and James Earl Jones", "$30,749,142" ], [ "19.0", "Airport '77", "Universal", "Jack Lemmon, Lee Grant and James Stewart", "$30,000,000" ], [ "20.0", "Herbie Goes to Monte Carlo", "Disney", "Dean Jones, Don Knotts and Julie Sommars", "$29,000,000" ], [ "21.0", "Slap Shot", "Universal", "Paul Newman and Strother Martin", "$28,000,000" ], [ "22.0", "The Other Side of Midnight", "20th Century Fox", "Marie-France Pisier, John Beck and Susan Sarandon", "$24,652,021" ], [ "23.0", "Looking for Mr. Goodbar", "Paramount", "Diane Keaton, Tuesday Weld and Richard Gere", "$22,512,655" ], [ "24.0", "For the Love of Benji", "Mulberry Square", "Benjean, Patsy Garrett and Ed Nelson", "$22,257,624" ], [ "25.0", "The World's Greatest Lover", "20th Century Fox", "Gene Wilder, Carol Kane and Dom DeLuise", "$21,000,000" ], [ "26.0", "Julia", "20th Century Fox", "Jane Fonda, Vanessa Redgrave, Jason Robards, Hal Holbrook, Rosemary Murphy and Maximilian Schell", "$20,714,400" ] ], "title": "", "original_id": "f4d60e32414319753c3f708a4b9664ea" }, { "_id": "44b72363ea3361db1ebaeef822a74099", "header": [ "#", "Name", "Hanzi", "Hanyu Pinyin", "Population (2003 est.)", "Area (km²)", "Density (/km²)" ], "rows": [ [ "1", "Aimin District", "爱民区", "Àimín Qū", "230,000", "359", "641" ], [ "2", "Dong'an District", "东安区", "Dōng'ān Qū", "180,000", "566", "318" ], [ "3", "Yangming District", "阳明区", "Yángmíng Qū", "160,000", "358", "447" ], [ "4", "Xi'an District", "西安区", "Xī'ān Qū", "210,000", "325", "646" ], [ "5", "Muling City", "穆棱市", "Mùlíng Shì", "330,000", "6,094", "54" ], [ "6", "Suifenhe City", "绥芬河市", "Suífēnhé Shi", "60,000", "427", "141" ], [ "7", "Hailin City", "海林市", "Hǎilín Shì", "440,000", "9,877", "45" ], [ "8", "Ning'an City", "宁安市", "Níng'ān Shì", "440,000", "7,870", "56" ], [ "9", "Dongning County", "东宁县", "Dōngníng Xiàn", "210,000", "7,368", "29" ], [ "10", "Linkou County", "林口县", "Línkǒu Xiàn", "450,000", "7,191", "63" ] ], "title": "", "original_id": "8d2f95dcfcff9966314745491802b50c" }, { "_id": "8a00b0da870bb5746f4637ab64456fa1", "header": [ "Event", "Gold", "Gold.1", "Silver", "Silver.1", "Bronze", "Bronze.1" ], "rows": [ [ "60 metres", "Nelli Cooman (NED)", "7.17", "Melanie Paschke (GER)", "7.19", "Patricia Girard (FRA)", "7.19" ], [ "200 metres", "Galina Malchugina (RUS)", "22.41", "Silke Knoll (GER)", "22.96", "Jacqueline Poelman (NED)", "23.43" ], [ "400 metres", "Svetlana Goncharenko (RUS)", "51.62", "Tatyana Alekseyeva (RUS)", "51.77", "Viviane Dorsile (FRA)", "51.92" ], [ "800 metres", "Natalya Dukhnova (BLR)", "2:00.42", "Ella Kovacs (ROM)", "2:00.49", "Carla Sacramento (POR)", "2:01.12" ], [ "1500 metres", "Yekaterina Podkopayeva (RUS)", "4:06.46", "Lyudmila Rogachova (RUS)", "4:06.60", "Małgorzata Rydz (POL)", "4:06.98" ], [ "3000 metres", "Fernanda Ribeiro (POR)", "8:50.47", "Margareta Keszeg (ROM)", "8:55.61", "Anna Brzezińska (POL)", "8:56.90" ], [ "60 metres hurdles", "Yordanka Donkova (BUL)", "7.85", "Eva Sokolova (RUS)", "7.89", "Anne Piquereau (FRA)", "7.91" ], [ "3000 metres walk", "Annarita Sidoti (ITA)", "11:54.32", "Beate Gummelt (GER)", "11:56.01", "Yelena Arshintseva (RUS)", "11:57.48" ], [ "High jump", "Stefka Kostadinova (BUL)", "1.98", "Desislava Aleksandrova (BUL)", "1.96", "Sigrid Kirchmann (AUT)", "1.94 NR" ], [ "Long jump", "Heike Drechsler (GER)", "7.06", "Ljudmila Ninova (AUT)", "6.78", "Inessa Kravets (UKR)", "6.72" ], [ "Triple jump", "Inna Lasovskaya (RUS)", "14.88", "Anna Biryukova (RUS)", "14.72", "Sofiya Bozhanova (BUL)", "14.52" ], [ "Shot put", "Astrid Kumbernuss (GER)", "19.44", "Larisa Peleshenko (RUS)", "19.16", "Svetla Mitkova (BUL)", "19.09" ], [ "Pentathlon", "Larisa Turchinskaya (RUS)", "4801", "Rita Ináncsi (HUN)", "4775 NR", "Urszula Włodarczyk (POL)", "4668" ] ], "title": "", "original_id": "7b4151479725d585c4b0be8c8ae4f9ed" }, { "_id": "ab812d5edf572e5558925573119c9bb0", "header": [ "Date", "Time (EDT)", "Team #1", "Res.", "Team #2", "Round", "Spectators" ], "rows": [ [ "1994-06-18", "16.0", "Italy", "0–1", "Republic of Ireland", "Group E", "75,338" ], [ "1994-06-23", "16.0", "Italy", "1–0", "Norway", "Group E", "74,624" ], [ "1994-06-25", "12.3", "Saudi Arabia", "2–1", "Morocco", "Group F", "76,322" ], [ "1994-06-28", "12.3", "Republic of Ireland", "0–0", "Norway", "Group E", "72,404" ], [ "1994-07-05", "16.3", "Mexico", "1–1 (1–3 on pen.)", "Bulgaria", "Round of 16", "71,030" ], [ "1994-07-10", "12.0", "Bulgaria", "2–1", "Germany", "Quarterfinals", "72,000" ], [ "1994-07-13", "16.0", "Bulgaria", "1–2", "Italy", "Semifinals", "74,110" ] ], "title": "", "original_id": "d460758d99ecaaf80409bcf5c8918b8a" }, { "_id": "978740c2d0e5fbcdef1e4ce13aae9254", "header": [ "Year", "Team", "GP", "Att", "Yds", "Avg", "Long", "Rush TD", "Rec", "Yds.1", "Avg.1", "Long.1", "Rec TD" ], "rows": [ [ "1981", "San Diego Chargers", "14", "109", "525", "4.8", "28", "3", "46", "329", "7.2", "29", "3" ], [ "1982", "San Digeo Chargers", "9", "87", "430", "4.9", "48", "6", "13", "66", "5.1", "12", "0" ], [ "1983", "San Diego Chargers", "15", "127", "516", "4.1", "61", "3", "25", "215", "8.6", "36", "0" ], [ "1984", "Cincinnati Bengals", "15", "103", "396", "3.8", "33", "2", "34", "268", "7.9", "27", "2" ], [ "1985", "Cincinnati Bengals", "16", "192", "929", "4.8", "39", "7", "55", "576", "10.5", "57", "5" ], [ "1986", "Cincinnati Bengals", "16", "205", "1,087", "5.3", "56", "5", "54", "686", "12.7", "54", "4" ], [ "1987", "Cincinnati Bengals", "9", "94", "280", "3.1", "18", "1", "22", "272", "12.4", "46", "2" ], [ "1988", "Cincinnati Bengals", "15", "182", "931", "5.1", "51", "8", "29", "287", "9.9", "28", "6" ], [ "1989", "Cincinnati Bengals", "16", "221", "1,239", "5.6", "65", "7", "37", "306", "8.3", "25", "2" ], [ "1990", "Cincinnati Bengals", "16", "195", "1,004", "5.1", "56", "5", "26", "269", "10.3", "35", "4" ], [ "1991", "Cincinnati Bengals", "15", "152", "571", "3.8", "25", "2", "40", "348", "8.7", "40", "2" ], [ "1992", "Tampa Bay Buccaneers", "2", "5", "6", "1.2", "4", "0", "0", "0", "0.0", "0", "0" ], [ "1992", "Cleveland Browns", "4", "13", "38", "2.9", "13", "0", "2", "-1", "-0.5", "4", "0" ], [ "Career Totals", null, "162", "1,685", "7,962", "4.7", "65", "49", "383", "3,621", "9.5", "57", "30" ] ], "title": "", "original_id": "3bba76d2d41024fde7d3061dc3e4c230" }, { "_id": "db2370e4447adf197a80b98ee278bb0b", "header": [ "Value", "Diameter", "Composition", "1979–1989\nObverse", "1979–1989\nReverse" ], "rows": [ [ "1 cent", "18 mm", "Bronze", "State arms", "Frigate Birds" ], [ "2 cents", "21 mm", "Bronze", "State arms", "B'abal plant" ], [ "5 cents", "19 mm", "Cupronickel", "State arms", "Tokay gecko" ], [ "10 cents", "24 mm", "Cupronickel", "State arms", "Breadfruit" ], [ "20 cents", "29 mm", "Cupronickel", "State arms", "Dolphins" ], [ "50 cents", "32 mm", "Cupronickel", "State arms", "Panda nut plant" ], [ "1 dollar", "30 mm", "Cupronickel", "State arms", "Outrigger canoe" ], [ "2 dollars", "29 mm", "Nickel-Brass", "State arms", "Meeting lodge/\\Tenth Anniversary of Independence\\\"\"" ] ], "title": "", "original_id": "fcec735ee13d0a97869221546baacd18" }, { "_id": "1669132fb55f14e8e8ba66e63b680a8b", "header": [ "Year", "Team", "GP", "GS", "MPG", "FG%", "3P%", "FT%", "RPG", "APG", "SPG", "BPG", "PPG" ], "rows": [ [ "1993–94", "Golden State", "76", "76", "32.1", "0.552", "0.0", "0.532", "9.1", "3.6", "1.2", "2.2", "17.5" ], [ "1994–95", "Washington", "54", "52", "38.3", "0.495", "0.276", "0.502", "9.6", "4.7", "1.5", "1.6", "20.1" ], [ "1995–96", "Washington", "15", "15", "37.2", "0.543", "0.441", "0.594", "7.6", "5.0", "1.8", ".6", "23.7" ], [ "1996–97", "Washington", "72", "72", "39.0", "0.518", "0.397", "0.565", "10.3", "4.6", "1.7", "1.9", "20.1" ], [ "1997–98", "Washington", "71", "71", "39.6", "0.482", "0.317", "0.589", "9.5", "3.8", "1.6", "1.7", "21.9" ], [ "1998–99", "Sacramento", "42", "42", "40.9", "0.486", "0.118", "0.454", "13.0", "4.1", "1.4", "2.1", "20.0" ], [ "1999–00", "Sacramento", "75", "75", "38.4", "0.483", "0.284", "0.751", "10.5", "4.6", "1.6", "1.7", "24.5" ], [ "2000–01", "Sacramento", "70", "70", "40.5", "0.481", "0.071", "0.703", "11.1", "4.2", "1.3", "1.7", "27.1" ], [ "2001–02", "Sacramento", "54", "54", "38.4", "0.495", "0.263", "0.749", "10.1", "4.8", "1.7", "1.4", "24.5" ], [ "2002–03", "Sacramento", "67", "67", "39.1", "0.461", "0.238", "0.607", "10.5", "5.4", "1.6", "1.3", "23.0" ], [ "2003–04", "Sacramento", "23", "23", "36.1", "0.413", "0.2", "0.711", "8.7", "4.6", "1.3", ".9", "18.7" ], [ "2004–05", "Sacramento", "46", "46", "36.3", "0.449", "0.379", "0.799", "9.7", "5.5", "1.5", ".7", "21.3" ], [ "2004–05", "Philadelphia", "21", "21", "33.4", "0.391", "0.267", "0.776", "7.9", "3.1", "1.2", ".9", "15.6" ], [ "2005–06", "Philadelphia", "75", "75", "38.6", "0.434", "0.273", "0.756", "9.9", "3.4", "1.4", ".8", "20.2" ], [ "2006–07", "Philadelphia", "18", "18", "30.2", "0.387", "0.4", "0.643", "8.3", "3.4", "1.0", ".8", "11.0" ], [ "2006–07", "Detroit", "43", "42", "29.7", "0.489", "0.333", "0.636", "6.7", "3.0", "1.0", ".6", "11.3" ], [ "2007–08", "Golden State", "9", "8", "14.0", "0.484", "0.0", "0.417", "3.6", "2.0", "0.4", ".7", "3.9" ], [ "Career", null, "831", "827", "37.1", "0.479", "0.299", "0.649", "9.8", "4.2", "1.4", "1.4", "20.7" ], [ "All-Star", null, "4", "4", "19.0", "0.371", "0.333", "0.375", "6.0", "3.3", "1.0", "-", "7.5" ] ], "title": "", "original_id": "7b87f70bc3d95922c6b3335e7a737fe2" }, { "_id": "79e97fe56c64b71242c75f96b95b6630", "header": [ "Name", "County", "Population\n(2012 est.)", "Population\n(2010)", "Land area" ], "rows": [ [ "Aberdeen", "Grays Harbor", "16,529", "16,896", "10.65 sq mi (27.6 km2)" ], [ "Airway Heights", "Spokane", "6,363", "6,114", "5.63 sq mi (14.6 km2)" ], [ "Algona", "King", "3,074", "3,015", "1.29 sq mi (3.3 km2)" ], [ "Anacortes", "Skagit", "15,928", "15,778", "11.75 sq mi (30.4 km2)" ], [ "Arlington", "Snohomish", "18,317", "17,926", "9.25 sq mi (24.0 km2)" ], [ "Asotin", "Asotin", "1,270", "1,251", "1.05 sq mi (2.7 km2)" ], [ "Auburn", "King\nPierce", "73,505", "70,180", "29.62 sq mi (76.7 km2)" ], [ "Bainbridge Island", "Kitsap", "23,263", "23,025", "27.61 sq mi (71.5 km2)" ], [ "Battle Ground", "Clark", "18,044", "17,571", "7.16 sq mi (18.5 km2)" ], [ "Bellevue", "King", "126,439", "122,363", "31.97 sq mi (82.8 km2)" ], [ "Bellingham", "Whatcom", "82,234", "80,885", "27.08 sq mi (70.1 km2)" ], [ "Benton City", "Benton", "3,134", "3,038", "2.46 sq mi (6.4 km2)" ], [ "Bingen", "Klickitat", "724", "712", "0.62 sq mi (1.6 km2)" ], [ "Black Diamond", "King", "4,237", "4,151", "6.01 sq mi (15.6 km2)" ], [ "Blaine", "Whatcom", "4,744", "4,684", "5.63 sq mi (14.6 km2)" ], [ "Bonney Lake", "Pierce", "17,964", "17,374", "7.94 sq mi (20.6 km2)" ], [ "Bothell", "King\nSnohomish", "34,651", "33,505", "12.11 sq mi (31.4 km2)" ], [ "Bremerton", "Kitsap", "39,251", "37,729", "28.41 sq mi (73.6 km2)" ], [ "Brewster", "Okanogan", "2,386", "2,370", "1.19 sq mi (3.1 km2)" ], [ "Bridgeport", "Douglas", "2,444", "2,409", "1.05 sq mi (2.7 km2)" ], [ "Brier", "Snohomish", "6,251", "6,087", "2.13 sq mi (5.5 km2)" ], [ "Buckley", "Pierce", "4,402", "4,354", "3.87 sq mi (10.0 km2)" ], [ "Burien", "King", "49,410", "33,313", "7.42 sq mi (19.2 km2)" ], [ "Burlington", "Skagit", "8,470", "8,388", "4.26 sq mi (11.0 km2)" ], [ "Camas", "Clark", "20,490", "19,355", "13.49 sq mi (34.9 km2)" ], [ "Carnation", "King", "1,823", "1,786", "1.16 sq mi (3.0 km2)" ], [ "Cashmere", "Chelan", "3,104", "3,063", "1.03 sq mi (2.7 km2)" ], [ "Castle Rock", "Cowlitz", "1,983", "1,982", "1.59 sq mi (4.1 km2)" ], [ "Centralia", "Lewis", "16,505", "16,336", "7.42 sq mi (19.2 km2)" ], [ "Chehalis", "Lewis", "7,298", "7,259", "5.53 sq mi (14.3 km2)" ], [ "Chelan", "Chelan", "3,945", "3,890", "6.29 sq mi (16.3 km2)" ], [ "Cheney", "Spokane", "11,018", "10,590", "4.27 sq mi (11.1 km2)" ], [ "Chewelah", "Stevens", "2,606", "2,607", "2.98 sq mi (7.7 km2)" ], [ "Clarkston", "Asotin", "7,283", "7,229", "2.01 sq mi (5.2 km2)" ], [ "Cle Elum", "Kittitas", "1,907", "1,872", "3.82 sq mi (9.9 km2)" ], [ "Clyde Hill", "King", "3,047", "2,984", "1.06 sq mi (2.7 km2)" ], [ "Colfax", "Whitman", "2,839", "2,805", "3.79 sq mi (9.8 km2)" ], [ "College Place", "Walla Walla", "8,884", "8,765", "2.66 sq mi (6.9 km2)" ], [ "Colville", "Stevens", "4,669", "4,673", "2.93 sq mi (7.6 km2)" ], [ "Connell", "Franklin", "5,421", "4,209", "7.87 sq mi (20.4 km2)" ], [ "Cosmopolis", "Grays Harbor", "1,643", "1,649", "1.33 sq mi (3.4 km2)" ], [ "Covington", "King", "18,298", "17,575", "5.86 sq mi (15.2 km2)" ], [ "Davenport", "Lincoln", "1,718", "1,734", "1.82 sq mi (4.7 km2)" ], [ "Dayton", "Columbia", "2,509", "2,526", "1.43 sq mi (3.7 km2)" ], [ "Deer Park", "Spokane", "3,673", "3,652", "6.88 sq mi (17.8 km2)" ], [ "Des Moines", "King", "30,449", "29,673", "6.50 sq mi (16.8 km2)" ], [ "DuPont", "Pierce", "8,808", "8,199", "5.86 sq mi (15.2 km2)" ], [ "Duvall", "King", "7,183", "6,695", "2.47 sq mi (6.4 km2)" ], [ "East Wenatchee", "Douglas", "13,439", "13,190", "3.80 sq mi (9.8 km2)" ], [ "Edgewood", "Pierce", "9,501", "9,387", "8.41 sq mi (21.8 km2)" ], [ "Edmonds", "Snohomish", "40,400", "39,709", "8.91 sq mi (23.1 km2)" ], [ "Electric City", "Grant", "1,004", "968", "1.70 sq mi (4.4 km2)" ], [ "Ellensburg", "Kittitas", "18,348", "18,174", "6.92 sq mi (17.9 km2)" ], [ "Elma", "Grays Harbor", "3,095", "3,107", "1.89 sq mi (4.9 km2)" ], [ "Entiat", "Chelan", "1,129", "1,112", "2.11 sq mi (5.5 km2)" ], [ "Enumclaw", "King\nPierce", "11,327", "10,669", "4.26 sq mi (11.0 km2)" ], [ "Ephrata", "Grant", "7,916", "7,664", "10.09 sq mi (26.1 km2)" ], [ "Everett", "Snohomish", "104,655", "103,019", "33.45 sq mi (86.6 km2)" ], [ "Everson", "Whatcom", "2,513", "2,481", "1.24 sq mi (3.2 km2)" ], [ "Federal Way", "King", "91,933", "89,306", "22.26 sq mi (57.7 km2)" ], [ "Ferndale", "Whatcom", "11,998", "11,415", "6.61 sq mi (17.1 km2)" ], [ "Fife", "Pierce", "9,333", "9,173", "5.68 sq mi (14.7 km2)" ], [ "Fircrest", "Pierce", "6,579", "6,497", "1.58 sq mi (4.1 km2)" ], [ "Forks", "Clallam", "3,552", "3,532", "3.65 sq mi (9.5 km2)" ], [ "George", "Grant", "514", "501", "1.33 sq mi (3.4 km2)" ], [ "Gig Harbor", "Pierce", "7,549", "7,126", "5.95 sq mi (15.4 km2)" ], [ "Gold Bar", "Snohomish", "2,101", "2,075", "1.03 sq mi (2.7 km2)" ], [ "Goldendale", "Klickitat", "3,471", "3,407", "2.52 sq mi (6.5 km2)" ], [ "Grand Coulee", "Grant", "1,044", "988", "1.19 sq mi (3.1 km2)" ], [ "Grandview", "Yakima", "11,012", "10,862", "6.23 sq mi (16.1 km2)" ], [ "Granger", "Yakima", "3,298", "3,246", "1.79 sq mi (4.6 km2)" ], [ "Granite Falls", "Snohomish", "3,416", "3,364", "2.18 sq mi (5.6 km2)" ], [ "Harrington", "Lincoln", "420", "424", "0.38 sq mi (0.98 km2)" ], [ "Hoquiam", "Grays Harbor", "8,535", "8,726", "9.02 sq mi (23.4 km2)" ], [ "Ilwaco", "Pacific", "936", "936", "2.10 sq mi (5.4 km2)" ], [ "Issaquah", "King", "32,633", "30,434", "11.38 sq mi (29.5 km2)" ], [ "Kahlotus", "Franklin", "204", "193", "0.47 sq mi (1.2 km2)" ], [ "Kalama", "Cowlitz", "2,346", "2,344", "2.77 sq mi (7.2 km2)" ], [ "Kelso", "Cowlitz", "11,832", "11,925", "8.14 sq mi (21.1 km2)" ], [ "Kenmore", "King", "21,280", "20,460", "6.15 sq mi (15.9 km2)" ], [ "Kennewick", "Benton", "75,971", "73,917", "26.93 sq mi (69.7 km2)" ], [ "Kent", "King", "122,999", "92,411", "28.63 sq mi (74.2 km2)" ], [ "Kettle Falls", "Stevens", "1,593", "1,595", "1.07 sq mi (2.8 km2)" ], [ "Kirkland", "King", "50,697", "48,787", "10.79 sq mi (27.9 km2)" ], [ "Kittitas", "Kittitas", "1,405", "1,381", "0.76 sq mi (2.0 km2)" ], [ "La Center", "Clark", "2,852", "2,800", "1.27 sq mi (3.3 km2)" ], [ "Lacey", "Thurston", "43,860", "42,393", "16.06 sq mi (41.6 km2)" ], [ "Lake Forest Park", "King", "12,972", "12,598", "3.53 sq mi (9.1 km2)" ], [ "Lake Stevens", "Snohomish", "29,104", "28,069", "8.88 sq mi (23.0 km2)" ], [ "Lakewood", "Pierce", "58,852", "58,163", "17.17 sq mi (44.5 km2)" ], [ "Langley", "Island", "1,041", "1,035", "1.08 sq mi (2.8 km2)" ], [ "Leavenworth", "Chelan", "1,993", "1,965", "1.23 sq mi (3.2 km2)" ], [ "Liberty Lake", "Spokane", "7,889", "7,591", "6.14 sq mi (15.9 km2)" ], [ "Long Beach", "Pacific", "1,393", "1,392", "1.35 sq mi (3.5 km2)" ], [ "Longview", "Cowlitz", "36,458", "36,648", "14.48 sq mi (37.5 km2)" ], [ "Lynden", "Whatcom", "12,605", "11,951", "5.17 sq mi (13.4 km2)" ], [ "Lynnwood", "Snohomish", "36,275", "35,836", "7.84 sq mi (20.3 km2)" ], [ "Mabton", "Yakima", "2,324", "2,286", "0.80 sq mi (2.1 km2)" ], [ "Maple Valley", "King", "24,171", "22,684", "5.72 sq mi (14.8 km2)" ], [ "Marysville", "Snohomish", "62,402", "60,020", "20.68 sq mi (53.6 km2)" ], [ "Mattawa", "Grant", "4,543", "4,437", "0.74 sq mi (1.9 km2)" ], [ "McCleary", "Grays Harbor", "1,647", "1,653", "2.05 sq mi (5.3 km2)" ], [ "Medical Lake", "Spokane", "4,940", "5,060", "3.40 sq mi (8.8 km2)" ], [ "Medina", "King", "3,029", "2,969", "1.44 sq mi (3.7 km2)" ], [ "Mercer Island", "King", "23,661", "22,699", "6.32 sq mi (16.4 km2)" ], [ "Mesa", "Franklin", "518", "489", "1.64 sq mi (4.2 km2)" ], [ "Mill Creek", "Snohomish", "18,671", "18,244", "4.67 sq mi (12.1 km2)" ], [ "Millwood", "Spokane", "1,797", "1,786", "0.70 sq mi (1.8 km2)" ], [ "Milton", "Pierce\nKing", "7,048", "6,968", "2.51 sq mi (6.5 km2)" ], [ "Monroe", "Snohomish", "17,503", "17,304", "6.05 sq mi (15.7 km2)" ], [ "Montesano", "Grays Harbor", "3,962", "3,976", "10.41 sq mi (27.0 km2)" ], [ "Morton", "Lewis", "1,132", "1,126", "0.82 sq mi (2.1 km2)" ], [ "Moses Lake", "Grant", "21,182", "20,366", "15.75 sq mi (40.8 km2)" ], [ "Mossyrock", "Lewis", "764", "759", "0.68 sq mi (1.8 km2)" ], [ "Mount Vernon", "Skagit", "32,287", "31,743", "12.30 sq mi (31.9 km2)" ], [ "Mountlake Terrace", "Snohomish", "20,198", "19,909", "4.06 sq mi (10.5 km2)" ], [ "Moxee", "Yakima", "3,361", "3,308", "1.69 sq mi (4.4 km2)" ], [ "Mukilteo", "Snohomish", "20,605", "20,254", "6.40 sq mi (16.6 km2)" ], [ "Napavine", "Lewis", "1,778", "1,766", "2.38 sq mi (6.2 km2)" ], [ "Newcastle", "King", "10,792", "10,380", "4.45 sq mi (11.5 km2)" ], [ "Newport", "Pend Oreille", "2,116", "2,126", "1.07 sq mi (2.8 km2)" ], [ "Nooksack", "Whatcom", "1,355", "1,338", "0.70 sq mi (1.8 km2)" ], [ "Normandy Park", "King", "6,504", "6,335", "2.52 sq mi (6.5 km2)" ], [ "North Bend", "King", "6,030", "5,731", "4.27 sq mi (11.1 km2)" ], [ "North Bonneville", "Skamania", "963", "956", "2.41 sq mi (6.2 km2)" ], [ "Oak Harbor", "Island", "22,260", "22,075", "9.42 sq mi (24.4 km2)" ], [ "Oakville", "Grays Harbor", "682", "684", "0.50 sq mi (1.3 km2)" ], [ "Ocean Shores", "Grays Harbor", "5,622", "5,569", "8.51 sq mi (22.0 km2)" ], [ "Okanogan", "Okanogan", "2,568", "2,552", "1.95 sq mi (5.1 km2)" ], [ "Olympia", "Thurston", "47,698", "46,478", "17.82 sq mi (46.2 km2)" ], [ "Omak", "Okanogan", "4,881", "4,845", "3.50 sq mi (9.1 km2)" ], [ "Oroville", "Okanogan", "1,698", "1,686", "1.64 sq mi (4.2 km2)" ], [ "Orting", "Pierce", "6,872", "6,746", "2.73 sq mi (7.1 km2)" ], [ "Othello", "Adams", "7,532", "7,364", "3.81 sq mi (9.9 km2)" ], [ "Pacific", "King\nPierce", "6,838", "6,606", "2.42 sq mi (6.3 km2)" ], [ "Palouse", "Whitman", "1,011", "998", "1.08 sq mi (2.8 km2)" ], [ "Pasco", "Franklin", "65,398", "59,781", "30.50 sq mi (79.0 km2)" ], [ "Pateros", "Okanogan", "673", "667", "0.49 sq mi (1.3 km2)" ], [ "Pomeroy", "Garfield", "1,422", "1,425", "1.78 sq mi (4.6 km2)" ], [ "Port Angeles", "Clallam", "19,056", "19,038", "10.70 sq mi (27.7 km2)" ], [ "Port Orchard", "Kitsap", "11,680", "11,144", "7.24 sq mi (18.8 km2)" ], [ "Port Townsend", "Jefferson", "9,117", "9,113", "6.98 sq mi (18.1 km2)" ], [ "Poulsbo", "Kitsap", "9,393", "9,200", "4.67 sq mi (12.1 km2)" ], [ "Prescott", "Walla Walla", "323", "318", "0.40 sq mi (1.0 km2)" ], [ "Prosser", "Benton", "5,799", "5,714", "4.49 sq mi (11.6 km2)" ], [ "Pullman", "Whitman", "31,359", "29,799", "9.88 sq mi (25.6 km2)" ], [ "Puyallup", "Pierce", "38,147", "37,022", "13.93 sq mi (36.1 km2)" ], [ "Quincy", "Grant", "7,013", "6,750", "4.96 sq mi (12.8 km2)" ], [ "Rainier", "Thurston", "1,826", "1,794", "1.73 sq mi (4.5 km2)" ], [ "Raymond", "Pacific", "2,883", "2,882", "4.06 sq mi (10.5 km2)" ], [ "Redmond", "King", "56,561", "54,144", "16.28 sq mi (42.2 km2)" ], [ "Renton", "King", "95,448", "90,927", "23.12 sq mi (59.9 km2)" ], [ "Republic", "Ferry", "1,093", "1,073", "1.59 sq mi (4.1 km2)" ], [ "Richland", "Benton", "51,440", "48,058", "35.72 sq mi (92.5 km2)" ], [ "Ridgefield", "Clark", "5,260", "4,763", "7.08 sq mi (18.3 km2)" ], [ "Ritzville", "Adams", "1,699", "1,673", "1.70 sq mi (4.4 km2)" ], [ "Rock Island", "Douglas", "799", "788", "0.61 sq mi (1.6 km2)" ], [ "Roslyn", "Kittitas", "910", "893", "4.37 sq mi (11.3 km2)" ], [ "Roy", "Pierce", "803", "793", "0.49 sq mi (1.3 km2)" ], [ "Royal City", "Grant", "2,193", "2,140", "1.35 sq mi (3.5 km2)" ], [ "Ruston", "Pierce", "759", "749", "0.26 sq mi (0.67 km2)" ], [ "Sammamish", "King", "49,069", "45,780", "18.22 sq mi (47.2 km2)" ], [ "SeaTac", "King", "27,667", "26,909", "10.03 sq mi (26.0 km2)" ], [ "Seattle", "King", "634,535", "608,660", "83.94 sq mi (217.4 km2)" ], [ "Sedro-Woolley", "Skagit", "10,636", "10,540", "3.81 sq mi (9.9 km2)" ], [ "Selah", "Yakima", "7,333", "7,147", "4.44 sq mi (11.5 km2)" ], [ "Sequim", "Clallam", "6,624", "6,606", "6.31 sq mi (16.3 km2)" ], [ "Shelton", "Mason", "9,800", "9,834", "5.76 sq mi (14.9 km2)" ], [ "Shoreline", "King", "54,352", "53,007", "11.67 sq mi (30.2 km2)" ], [ "Snohomish", "Snohomish", "9,275", "9,098", "3.44 sq mi (8.9 km2)" ], [ "Snoqualmie", "King", "11,594", "10,670", "6.40 sq mi (16.6 km2)" ], [ "Soap Lake", "Grant", "1,550", "1,514", "1.25 sq mi (3.2 km2)" ], [ "South Bend", "Pacific", "1,631", "1,637", "1.62 sq mi (4.2 km2)" ], [ "Spangle", "Spokane", "280", "278", "0.36 sq mi (0.93 km2)" ], [ "Spokane", "Spokane", "209,525", "208,916", "59.25 sq mi (153.5 km2)" ], [ "Spokane Valley", "Spokane", "90,641", "89,755", "37.77 sq mi (97.8 km2)" ], [ "Sprague", "Lincoln", "441", "446", "0.63 sq mi (1.6 km2)" ], [ "Stanwood", "Snohomish", "6,422", "6,231", "2.82 sq mi (7.3 km2)" ], [ "Stevenson", "Skamania", "1,473", "1,465", "1.64 sq mi (4.2 km2)" ], [ "Sultan", "Snohomish", "4,710", "4,651", "3.15 sq mi (8.2 km2)" ], [ "Sumas", "Whatcom", "1,325", "1,307", "1.48 sq mi (3.8 km2)" ], [ "Sumner", "Pierce", "9,541", "9,451", "7.51 sq mi (19.5 km2)" ], [ "Sunnyside", "Yakima", "16,054", "15,858", "6.63 sq mi (17.2 km2)" ], [ "Tacoma", "Pierce", "202,010", "198,397", "49.72 sq mi (128.8 km2)" ], [ "Tekoa", "Whitman", "787", "778", "1.14 sq mi (3.0 km2)" ], [ "Tenino", "Thurston", "1,724", "1,695", "1.44 sq mi (3.7 km2)" ], [ "Tieton", "Yakima", "1,211", "1,191", "0.82 sq mi (2.1 km2)" ], [ "Toledo", "Lewis", "729", "725", "0.40 sq mi (1.0 km2)" ], [ "Tonasket", "Okanogan", "1,038", "1,032", "0.80 sq mi (2.1 km2)" ], [ "Toppenish", "Yakima", "9,017", "8,949", "2.09 sq mi (5.4 km2)" ], [ "Tukwila", "King", "19,611", "19,107", "9.17 sq mi (23.8 km2)" ], [ "Tumwater", "Thurston", "18,102", "17,371", "14.32 sq mi (37.1 km2)" ], [ "Union Gap", "Yakima", "6,060", "6,047", "5.05 sq mi (13.1 km2)" ], [ "University Place", "Pierce", "31,562", "31,144", "8.42 sq mi (21.8 km2)" ], [ "Vader", "Lewis", "626", "621", "0.93 sq mi (2.4 km2)" ], [ "Vancouver", "Clark", "165,489", "161,791", "46.46 sq mi (120.3 km2)" ], [ "Waitsburg", "Walla Walla", "1,235", "1,217", "1.11 sq mi (2.9 km2)" ], [ "Walla Walla", "Walla Walla", "31,864", "31,731", "12.80 sq mi (33.2 km2)" ], [ "Wapato", "Yakima", "5,065", "4,997", "1.17 sq mi (3.0 km2)" ], [ "Warden", "Grant", "2,758", "2,692", "2.58 sq mi (6.7 km2)" ], [ "Washougal", "Clark", "14,584", "14,095", "5.42 sq mi (14.0 km2)" ], [ "Wenatchee", "Chelan", "32,562", "31,925", "7.77 sq mi (20.1 km2)" ], [ "West Richland", "Benton", "12,663", "11,811", "21.92 sq mi (56.8 km2)" ], [ "Westport", "Grays Harbor", "2,092", "2,099", "3.70 sq mi (9.6 km2)" ], [ "White Salmon", "Klickitat", "2,266", "2,224", "1.22 sq mi (3.2 km2)" ], [ "Winlock", "Lewis", "1,346", "1,339", "1.29 sq mi (3.3 km2)" ], [ "Woodinville", "King", "11,234", "10,938", "5.60 sq mi (14.5 km2)" ], [ "Woodland", "Cowlitz\nClark", "5,540", "5,509", "3.37 sq mi (8.7 km2)" ], [ "Woodway", "Snohomish", "1,324", "1,307", "1.11 sq mi (2.9 km2)" ], [ "Yakima", "Yakima", "93,101", "91,067", "27.18 sq mi (70.4 km2)" ], [ "Yelm", "Thurston", "7,121", "6,848", "5.68 sq mi (14.7 km2)" ], [ "Zillah", "Yakima", "3,011", "2,964", "1.78 sq mi (4.6 km2)" ] ], "title": "", "original_id": "0e5d24e99ce2be597d1da273d8d0ed83" }, { "_id": "99a2e362a7713f5048f5bf509995e01e", "header": [ "Name", "Street address", "Years as tallest", "Height\nft (m)", "Floors" ], "rows": [ [ "Globe Building", "4th Street South", "1882–1886", "157 (48)", "8" ], [ "Lumber Exchange Building", "10 5th Street South", "1886–1887", "165 (50)", "12" ], [ "Industrial Exposition Building", "Central Avenue Southeast and Main Street Southeast", "1887–1890", "240 (73)", "8" ], [ "Metropolitan Building", "308 2nd Avenue South", "1890–1895", "258 (79)", "12" ], [ "Minneapolis City Hall", "350 5th Street South", "1895–1929", "341 (104)", "14" ], [ "Foshay Tower", "821 Marquette Avenue", "1929–1973", "448 (137)", "32" ], [ "IDS Tower", "80 8th Street South", "1973–present", "792 (241)", "55" ] ], "title": "", "original_id": "0f41d5fef6881d303cee5f6a37993555" }, { "_id": "16815a351b4e75a7da635bad706119d3", "header": [ "Year", "Total\npassengers", "Passenger\nChange", "Domestic", "International\n(total)", "International\n(non-CIS)", "CIS", "Aircraft\nLandings", "Cargo\n(tonnes)" ], "rows": [ [ "2000", "930 251", "+2%", "698 957", "231 294", "155 898", "75 396", "8 619", "18 344" ], [ "2001", "1 028 295", "+10,5%", "733 022", "295 273", "186 861", "108 412", "9 062", "22 178" ], [ "2002", "1 182 815", "+15,0%", "793 295", "389 520", "239 461", "150 059", "10 162", "20 153" ], [ "2003", "1 335 757", "+12,9%", "879 665", "456 092", "297 421", "158 671", "10 092", "18 054" ], [ "2004", "1 553 628", "+16,3%", "972 287", "581 341", "429 049", "152 292", "11 816", "20 457" ], [ "2005", "1 566 792", "+0,8%", "1 006 422", "560 370", "429 790", "130 580", "11 877", "11 545" ], [ "2006", "1 764 948", "+12,7%", "1 128 489", "636 459", "488 954", "147 505", "13 289", "15 519" ], [ "2007", "2 345 097", "+32,9%", "1 486 888", "858 209", "683 092", "175 117", "16 767", "16 965" ], [ "2008", "2 529 395", "+7,8%", "1 523 102", "1 006 293", "815 124", "191 169", "16 407", "17 142" ], [ "2009", "2 169 136", "−14,2%", "1 290 639", "878 497", "727 718", "150 779", "13 798", "13 585" ], [ "2010", "2 748 919", "+26,7%", "1 529 245", "1 219 674", "1 017 509", "202 165", "15 989", "22 946" ], [ "2011", "3 355 883", "+22,1%", "1 856 948", "1 498 935", "1 184 771", "314 164", "20 142", "24 890" ], [ "2012", "3 783 069", "+12.7%", "1 934 016", "1 849 053", "1 448 765", "439 668", "21 728", "25 866" ], [ "2013", "4 293 002", "+13.5%", "2 180 227", "2 112 775", null, null, "25 728", "27 800" ] ], "title": "", "original_id": "bf75201c615c8bb7f27ad1b146d5c447" }, { "_id": "3e7251a170b1325ea356c08e96b50669", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1", "Soviet Union (URS)", "4", "1", "6", "11" ], [ "2", "Yugoslavia (YUG)", "2", "0", "1", "3" ], [ "3", "West Germany (FRG)", "1", "1", "1", "3" ], [ "4", "Bulgaria (BUL)", "1", "1", "0", "2" ], [ "4", "Czechoslovakia (TCH)", "1", "1", "0", "2" ], [ "4", "East Germany (GDR)", "1", "1", "0", "2" ], [ "4", "Great Britain (GBR)", "1", "1", "0", "2" ], [ "8", "Norway (NOR)", "1", "0", "0", "1" ], [ "8", "Romania (ROU)", "1", "0", "0", "1" ], [ "10", "China (CHN)", "0", "1", "1", "2" ], [ "11", "Chile (CHI)", "0", "1", "0", "1" ], [ "11", "France (FRA)", "0", "1", "0", "1" ], [ "11", "Japan (JPN)", "0", "1", "0", "1" ], [ "11", "South Korea (KOR)", "0", "1", "0", "1" ], [ "11", "Sweden (SWE)", "0", "1", "0", "1" ], [ "11", "United States (USA)", "0", "1", "0", "1" ], [ "17", "Hungary (HUN)", "0", "0", "2", "2" ], [ "18", "Belgium (BEL)", "0", "0", "1", "1" ], [ "18", "Spain (ESP)", "0", "0", "1", "1" ], [ "Total", "Total", "13", "13", "13", "39" ] ], "title": "", "original_id": "a7f2932c5e2c34ae2d673fa9c9bb3e5c" }, { "_id": "ee1f2b3d96c295e9d59d5276e5ebf279", "header": [ "Game", "Date", "Opponent", "Location", "Score", "OT", "Attendance", "Record" ], "rows": [ [ "1", "January 8, 2005", "Philadelphia Wings", "Arrowhead Pond", "W 13–10", null, "5,732", "1–0" ], [ "2", "January 22, 2005", "Rochester Knighthawks", "Arrowhead Pond", "L 11–15", null, "4,053", "1–1" ], [ "3", "January 28, 2005", "@ Minnesota Swarm", "Xcel Energy Center", "W 8–7", null, "12,514", "2–1" ], [ "4", "January 29, 2005", "Calgary Roughnecks", "Arrowhead Pond", "L 12–13", null, "4,159", "2–2" ], [ "5", "February 4, 2005", "@ Arizona Sting", "Jobing.com Arena", "L 10–17", null, "6,313", "2–3" ], [ "6", "February 11, 2005", "@ Buffalo Bandits", "HSBC Arena", "L 9–20", null, "8,805", "2–4" ], [ "7", "February 18, 2005", "@ Calgary Roughnecks", "Pengrowth Saddledome", "L 15–18", null, "9,550", "2–5" ], [ "8", "March 4, 2005", "Colorado Mammoth", "Arrowhead Pond", "L 12–13", null, "4,500", "2–6" ], [ "9", "March 13, 2005", "Toronto Rock", "Arrowhead Pond", "L 6–14", null, "4,499", "2–7" ], [ "10", "March 19, 2005", "@ Colorado Mammoth", "Pepsi Center", "L 8–16", null, "16,270", "2–8" ], [ "11", "March 25, 2005", "@ San Jose Stealth", "HP Pavilion at San Jose", "L 14–15", null, "5,022", "2–9" ], [ "12", "March 26, 2005", "San Jose Stealth", "Arrowhead Pond", "W 13–12", "OT", "4,834", "3–9" ], [ "13", "April 2, 2005", "@ Colorado Mammoth", "Pepsi Center", "W 10–6", null, "18,326", "4–9" ], [ "14", "April 9, 2005", "Minnesota Swarm", "Arrowhead Pond", "L 11–12", "OT", "4,967", "4–10" ], [ "15", "April 15, 2005", "Arizona Sting", "Arrowhead Pond", "L 12–14", null, "5,891", "4–11" ], [ "16", "April 16, 2005", "@ Arizona Sting", "Jobing.com Arena", "W 11–10", null, "7,731", "5–11" ] ], "title": "", "original_id": "d6d1f7594c6772b9f7a3b8f4ae21d647" }, { "_id": "fb34f174327a8b2b21bd7ee09184aac8", "header": [ "Year", "Network", "NASCAR\nCountdown", "Lap-by-lap", "Color commentator(s)", "Pit reporters", "Ratings", "Viewers" ], "rows": [ [ "2007", "ESPN", "Brent Musburger\nSuzy Kolber\nBrad Daugherty", "Jerry Punch", "Rusty Wallace\nAndy Petree", "Dave Burns\nJamie Little\nAllen Bestwick\nMike Massaro", "4.2 (4.9 cable)", "6.574 million" ], [ "2008", "ESPN", "Allen Bestwick\nRusty Wallace\nBrad Daugherty", "Jerry Punch", "Dale Jarrett\nAndy Petree", "Dave Burns\nJamie Little\nShannon Spake\nMike Massaro", "4.3 (5.1 cable)", "6.668 million" ], [ "2009", "ESPN", "Allen Bestwick\nRusty Wallace\nBrad Daugherty\nRay Evernham", "Jerry Punch", "Dale Jarrett\nAndy Petree", "Dave Burns\nJamie Little\nShannon Spake\nVince Welch", "4.1 (4.8 cable)", "6.487 million" ], [ "2010", "ESPN", "Allen Bestwick\nRusty Wallace\nBrad Daugherty\nRay Evernham", "Marty Reid", "Dale Jarrett\nAndy Petree", "Dave Burns\nJamie Little\nJerry Punch\nVince Welch", "3.6 (4.2 cable)", "5.709 million" ], [ "2011", "ESPN", "Nicole Briscoe\nRusty Wallace\nBrad Daugherty", "Allen Bestwick", "Dale Jarrett\nAndy Petree", "Dave Burns\nJamie Little\nJerry Punch\nVince Welch", "4.0 (4.6 cable)", "6.337 million" ], [ "2012", "ESPN", "Nicole Briscoe\nRusty Wallace\nBrad Daugherty\nRay Evernham", "Allen Bestwick", "Dale Jarrett\nAndy Petree", "Dave Burns\nJamie Little\nJerry Punch\nVince Welch", "3.3", "5.1 million" ], [ "2013", "ESPN", "Nicole Briscoe\nRusty Wallace\nBrad Daugherty\nRay Evernham", "Allen Bestwick", "Dale Jarrett\nAndy Petree", "Dave Burns\nJamie Little\nJerry Punch\nVince Welch", "3.6", "5.5 million" ], [ "2014", "ESPN", null, null, null, null, null, null ] ], "title": "", "original_id": "981a69b6740520bc07087f0d51cbd353" }, { "_id": "06d2d58b097954f97c107fc8e113f159", "header": [ "Club", "Winners", "Runner-ups", "Winning Years", "Runner-up Years" ], "rows": [ [ "FK Austria Wien", "6", "2", "1990, 1991, 1992, 1994, 2003, 2004", "1986, 1994" ], [ "SK Rapid Wien", "4", "1", "1986, 1987, 1988, 2008", "1995, 1996" ], [ "SK Sturm Graz", "3", "2", "1996, 1998, 1999", "1997, 2002" ], [ "SV Austria Salzburg", "3", "0", "1994, 1995, 1997", "–" ], [ "Grazer AK", "2", "1", "2000, 2002", "2004" ], [ "VfB Admira Wacker Mödling", "1", "1", "1989", "1992" ], [ "FC Kärnten", "1", "1", "2001", "2003" ], [ "FC Swarovski Tirol / FC Tirol Innsbruck", "0*", "6", "–", "1987, 1989, 1990, 1993, 2000, 2001" ], [ "Kremser SC", "0", "1", "–", "1988" ], [ "SV Stockerau", "0", "1", "–", "1991" ], [ "SV Ried", "0", "1", "–", "1998" ], [ "LASK Linz", "0", "1", "–", "1999" ], [ "SV Horn", "0", "1", "–", "2008" ] ], "title": "", "original_id": "498ad888af0138fb83a16a69d424fde5" }, { "_id": "3e06f5f7df7c1dfd5ff2b02c00c6834f", "header": [ "#", "Date", "Venue", "Opponent", "Score", "Result", "Competition" ], "rows": [ [ "1.0", "24 December 2005", "Phang Nga, Thailand", "Latvia", "1–1", "Draw", "2005 King's Cup" ], [ "2.0", "26 March 2006", "Chonburi, Thailand", "Philippines", "5–0", "Win", "Friendly" ], [ "3.0", "26 March 2006", "Chonburi, Thailand", "Philippines", "5–0", "Win", "Friendly" ], [ "4.0", "8 October 2007", "Bangkok, Thailand", "Macau", "6–1", "Win", "2010 FIFA World Cup Qualification" ], [ "5.0", "6 February 2008", "Saitama, Japan", "Japan", "4–1", "Loss", "2010 FIFA World Cup Qualification" ], [ "6.0", "15 March 2008", "Kunming, China", "China PR", "3–3", "Draw", "Friendly" ], [ "7.0", "15 March 2008", "Kunming, China", "China PR", "3–3", "Draw", "Friendly" ], [ "8.0", "20 May 2008", "Bangkok, Thailand", "Nepal", "7–0", "Win", "Friendly" ], [ "9.0", "20 May 2008", "Bangkok, Thailand", "Nepal", "7–0", "Win", "Friendly" ], [ "10.0", "25 May 2008", "Bangkok, Thailand", "Iraq", "2–1", "Win", "Friendly" ], [ "11.0", "2 June 2008", "Bangkok, Thailand", "Bahrain", "2–3", "Loss", "2010 FIFA World Cup Qualification" ], [ "12.0", "20 December 2008", "Bangkok, Thailand", "Indonesia", "2–1", "Win", "2008 AFF Suzuki Cup" ], [ "13.0", "18 July 2009", "Bangkok, Thailand", "Pakistan", "4–0", "Win", "Friendly" ], [ "14.0", "8 November 2009", "Bangkok, Thailand", "Syria", "1–1", "Draw", "Friendly" ], [ "15.0", "8 September 2010", "New Delhi, India", "India", "2–1", "Win", "Friendly" ], [ "16.0", "15 January 2012", "Bangkok, Thailand", "South Korea", "1–3", "Loss", "2012 King's Cup" ], [ "17.0", "26 January 2013", "Chiangmai, Thailand", "North Korea", "2–2", "Draw", "2013 King's Cup" ], [ "18.0", "5 March 2014", "Bangkok, Thailand", "Lebanon", "2–5", "Loss", "2015 AFC Asian Cup qualification" ] ], "title": "", "original_id": "148dedc65365084819c4c9faddbe9be8" }, { "_id": "f634197399f4f0130f567573f6bded49", "header": [ "Date", "Name", "Nationality", "Tonnage\n(GRT)", "Fate" ], "rows": [ [ "18 January 1940", "Flandria", "Sweden", "1,179", "Sunk" ], [ "19 January 1940", "Patria", "Sweden", "1,188", "Sunk" ], [ "11 February 1940", "Linda", "Estonia", "1,213", "Sunk" ], [ "4 May 1940", "San Tiburcio", "United Kingdom", "5,995", "Sunk (mine)" ], [ "9 May 1940", "Doris", "French Navy", "552", "Sunk" ], [ "11 May 1940", "Tringa", "United Kingdom", "1,930", "Sunk" ], [ "11 May 1940", "Viiu", "Estonia", "1,908", "Sunk" ], [ "23 May 1940", "Sigurd Faulbaum", "Belgium", "3,256", "Sunk" ], [ "11 May 1944", "Shtorm", "Soviet Union", "412", "Damaged" ] ], "title": "", "original_id": "c6efb6d1181b8e94551ca81c9073a942" }, { "_id": "a24a1f632f5eb1382891ad1eb3abaca8", "header": [ "Rank", "Heat", "Nation", "Competitors", "Time", "Notes" ], "rows": [ [ "1.0", "2", "United States", "Kelly Willie, Derrick Brew, Andrew Rock, Darold Williamson", "2:59.30", "Q" ], [ "2.0", "2", "Nigeria", "James Godday, Musa Audu, Saul Weigopwa, Enefiok Udo-Obong", "3:01.60", "Q, SB" ], [ "3.0", "2", "Bahamas", "Andrae Williams, Dennis Darling, Nathaniel McKinney, Christopher Brown", "3:01.74", "Q, SB" ], [ "4.0", "1", "Great Britain", "Timothy Benjamin, Sean Baldock, Malachi Davis, Matthew Elias", "3:02.40", "Q, SB" ], [ "5.0", "1", "Japan", "Yuki Yamaguchi, Jun Osakada, Tomohiro Ito, Mitsuhiro Sato", "3:02.71", "Q" ], [ "6.0", "1", "Germany", "Ingo Schultz, Kamghe Gaba, Ruwen Faller, Bastian Swillims", "3:02.77", "Q" ], [ "7.0", "1", "Australia", "John Steffensen, Clinton Hill, Patrick Dwyer, Mark Ormrod", "3:03.06", "q" ], [ "8.0", "1", "Botswana", "Oganeditse Moseki, Johnson Kubisa, California Molefe, Kagiso Kilego", "3:03.32", "q, SB" ], [ "9.0", "2", "Russia", "Aleksandr Larin, Andrey Rudnitskiy, Oleg Mishukov, Ruslan Mashchenko", "3:03.35", null ], [ "10.0", "2", "Poland", "Piotr Rysiukiewicz, Piotr Klimczak, Marcin Marciniszyn, Marek Plawgo", "3:03.69", null ], [ "11.0", "2", "Ukraine", "Volodymyr Demchenko, Yevgeniy Zyukov, Myhaylo Knysh, Andriy Tverdostup", "3:04.01", null ], [ "12.0", "1", "Greece", "Stilianos Dimotsios, Anastasios Gousis, Panagiotis Sarris, Periklis Iakovakis", "3:04.27", "SB" ], [ "13.0", "1", "France", "Ahmed Douhou, Ibrahima Wade, Abderrahim El Haouzy, Leslie Djhone", "3:04.39", null ], [ "14.0", "2", "Spain", "Eduardo Ivan Rodriguez, David Canal, Luis Flores, Antonio Manuel Reina", "3:05.03", "SB" ], [ null, "2", "South Africa", "Marcus la Grange, Hendrick Mokganyetsi, Ockert Cilliers, Arnaud Malherbe", "DNF", null ], [ null, "1", "Jamaica", "Michael Campbell, Michael Blackwood, Jermaine Gonzales, Davian Clarke", "DSQ", null ] ], "title": "", "original_id": "a6b59f9af78c3d51a9219fe299c43ca2" }, { "_id": "e6068fc4f49d3ee5f48ae44afb24e9d7", "header": [ "Year", "Total", "Serbs", "Hungarians", "Germans", "Romanians", "Slovaks" ], "rows": [ [ "1910", "566,400", "229,568 (40.5%)", "108,622 (19.2%)", "125,374 (22.1%)", "73,303 (12.9%)", "16,223 (2,9%)" ], [ "1921", "559,096", "235,148 (42.1%)", "98,463 (17.6%)", "126,519 (22.6%)", "66,433 (11,9%)", "17,595 (3,2%)" ], [ "1931", "585,579", "261,123 (44,6%)", "95,867 (16,4%)", "120,541 (20,6%)", "62,365 (10,7%)", "17,900 (2,1%)" ], [ "1948", "601,626", "358,067 (59,6%)", "110,446 (18,4%)", "17,522 (2,9%)", "55,678 (9,3%)", "20,685 (2,4%)" ], [ "1953", "617,163", "374,258 (60,6%)", "112,683 (18,4%)", null, "55,094 (8,9%)", "21,299 (3,4%)" ], [ "1961", "655,868", "423,837 (64,6%)", "111,944 (17,1%)", null, "54,447 (8,3%)", "22,306 (3,4%)" ], [ "1971", "666,559", "434,810 (65,2%)", "103,090 (15.5%)", null, "49,455 (7,4%)", "22,173 (3,3%)" ], [ "1981", "672,884", "424,765 (65,7%)", "90,445 (14,0%)", null, "43,474 (6,7%)", "21,392 (3,3%)" ], [ "1991", "648,390", "423,475 (65,1%)", "76,153 (11.7%)", null, "35,935 (5,5%)", "19,903 (3.1%)" ], [ "2002", "665,397", "477,890 (71.8%)", "63,047 (9.5%)", "908 (0,1%)", "27,661 (4,1%)", "17,994 (2,7%)" ] ], "title": "", "original_id": "de91298e29cf142ece5d370e2687c1fc" }, { "_id": "552915f9e063dcfe34d140d6400622c6", "header": [ "Rank", "City", "Passengers", "Ranking", "Airline" ], "rows": [ [ "1", "Quintana Roo, Cancún", "132,046", null, "Aeroméxico Connect, Interjet, Volaris" ], [ "2", "Nuevo León, Monterrey", "106,513", null, "Aeroméxico Connect, Interjet" ], [ "3", "Guerrero, Acapulco", "56,069", null, "Aeroméxico Connect, Interjet" ], [ "4", "Jalisco, Guadalajara", "52,584", null, "Aeroméxico Connect, Volaris" ], [ "5", "Jalisco, Puerto Vallarta", "43,419", "1.0", "Interjet" ], [ "6", "Baja California Sur, Los Cabos", "37,526", "1.0", "Interjet" ], [ "7", "Guerrero, Ixtapa/Zihuatanejo", "35,507", null, "Interjet" ], [ "8", "Baja California, Tijuana", "14,906", null, "Interjet" ], [ "9", "Tabasco, Villahermosa", "6,928", "1.0", "VivaAerobus" ], [ "10", "Tamaulipas, Tampico", "3,619", "1.0", "VivaAerobus" ] ], "title": "", "original_id": "7cfdc47e6cfdc865ffb5d0a9ddd1d380" }, { "_id": "d72604ef234fe3dee907507769107263", "header": [ "Painter", "Composition", "Drawing", "Color", "Expression" ], "rows": [ [ "Andrea del Sarto", "12", "16", "9", "8" ], [ "Federico Barocci", "14", "15", "6", "10" ], [ "Jacopo Bassano", "6", "8", "17", "0" ], [ "Giovanni Bellini", "4", "6", "14", "O" ], [ "Sebastian Bourdon", "10", "8", "8", "4" ], [ "Charles Le Brun", "16", "16", "8", "16" ], [ "I Carracci", "15", "17", "13", "13" ], [ "Cavalier D'Arpino", "10", "10", "6", "2" ], [ "Correggio", "13", "13", "15", "12" ], [ "Daniele da Volterra", "12", "15", "5", "8" ], [ "Abraham van Diepenbeeck", "11", "10", "14", "6" ], [ "Il Domenichino", "15", "17", "9", "17" ], [ "Albrecht Dürer", "8", "10", "10", "8" ], [ "Giorgione", "8", "9", "18", "4" ], [ "Giovanni da Udine", "10", "8", "16", "3" ], [ "Giulio Romano", "15", "16", "4", "14" ], [ "Guercino", "18", "10", "10", "4" ], [ "Guido Reni", "x", "13", "9", "12" ], [ "Holbein", "9", "10", "16", "3" ], [ "Jacob Jordaens", "10", "8", "16", "6" ], [ "Lucas Jordaens", "13", "12", "9", "6" ], [ "Giovanni Lanfranco", "14", "13", "10", "5" ], [ "Leonardo da Vinci", "15", "16", "4", "14" ], [ "Lucas van Leyden", "8", "6", "6", "4" ], [ "Michelangelo", "8", "17", "4", "8" ], [ "Caravaggio", "6", "6", "16", "O" ], [ "Murillo", "6", "8", "15", "4" ], [ "Otho Venius", "13", "14", "10", "10" ], [ "Palma il Vecchio", "5", "6", "16", "0" ], [ "Palma il Giovane", "12", "9", "14", "6" ], [ "Il Parmigianino", "10", "15", "6", "6" ], [ "Gianfrancesco Penni", "O", "15", "8", "0" ], [ "Perin del Vaga", "15", "16", "7", "6" ], [ "Sebastiano del Piombo", "8", "13", "16", "7" ], [ "Primaticcio", "15", "14", "7", "10" ], [ "Raphael", "17", "18", "12", "18" ], [ "Rembrandt", "15", "6", "17", "12" ], [ "Rubens", "18", "13", "17", "17" ], [ "Francesco Salviati", "13", "15", "8", "8" ], [ "Eustache Le Sueur", "15", "15", "4", "15" ], [ "Teniers", "15", "12", "13", "6" ], [ "Pietro Testa", "11", "15", "0", "6" ], [ "Tintoretto", "15", "14", "16", "4" ], [ "Titian", "12", "15", "18", "6" ], [ "Van Dyck", "15", "10", "17", "13" ], [ "Vanius", "15", "15", "12", "13" ], [ "Veronese", "15", "10", "16", "3" ], [ "Taddeo Zuccari", "13", "14", "10", "9" ], [ "Federico Zuccari", "10", "10", "8", "8" ] ], "title": "", "original_id": "186b646cdd698ceabbb2738e0e5e9e6b" }, { "_id": "4dd6c3e8e1e5733c6a31aab9c0438b47", "header": [ "Year", "Majors", "ATP wins", "Total wins", "Earnings (US$)", "Money list rank" ], "rows": [ [ "2002", "0", "0", "0", "101,122", "165.0" ], [ "2003", "0", "0", "0", "277,743", "79.0" ], [ "2004", "0", "0", "0", "579,375", "38.0" ], [ "2005", "0", "1", "1", "702,670", "27.0" ], [ "2006", "0", "2", "2", "1,276,265", "9.0" ], [ "2007", "0", "0", "0", "209,610", "146.0" ], [ "2008", "0", "0", "0", "600,326", "44.0" ], [ "2009", "0", "0", "0", "197,818", "133.0" ], [ "2010", "0", "0", "0", "52,464", "284.0" ], [ "Career", "0", "3", "3", "4,024,686", null ] ], "title": "", "original_id": "3f2df3c4c7b0a42c92cd2ee6ef61ac49" }, { "_id": "64d149c36f83dcf7d409856b1d99f750", "header": [ "Leg", "Stage", "Time", "Name", "Length", "Winner", "Time.1", "Avg. spd.", "Rally leader" ], "rows": [ [ "1\n(16 Feb)", "SS1", "07:43", "Loten 1", "30.30 km", "M. Hirvonen", "16:14.1", "111.98 km/h", "M. Hirvonen" ], [ "1\n(16 Feb)", "SS2", "08:34", "Haslemoen", "11.92 km", "S. Loeb", "8:08.4", "87.86 km/h", "M. Hirvonen" ], [ "1\n(16 Feb)", "SS3", "11:24", "Loten 2", "30.30 km", "M. Hirvonen", "16:09.9", "112.47 km/h", "M. Hirvonen" ], [ "1\n(16 Feb)", "SS4", "12:30", "Grue", "14.36 km", "S. Loeb", "7:31.8", "114.42 km/h", "M. Hirvonen" ], [ "1\n(16 Feb)", "SS5", "13:52", "Opaker", "14.64 km", "J. Latvala", "7:59.8", "109.85 km/h", "M. Hirvonen" ], [ "1\n(16 Feb)", "SS6", "14:36", "Kongsvinger", "14.60 km", "S. Loeb", "9:44.5", "89.92 km/h", "M. Hirvonen" ], [ "1\n(16 Feb)", "SS7", "15:30", "Finnskogen", "21.29 km", "S. Loeb", "12:42.3", "100.54 km/h", "M. Hirvonen" ], [ "1\n(16 Feb)", "SS8", "16:33", "Kirkanaer", "6.75 km", "S. Loeb", "5:48.9", "69.65 km/h", "M. Hirvonen" ], [ "2\n(17 Feb)", "SS9", "08:09", "Eleverum 1", "44.27 km", "M. Hirvonen", "24:40.3", "107.66 km/h", "M. Hirvonen" ], [ "2\n(17 Feb)", "SS10", "09:23", "Terningmoen", "12.71 km", "D. Sordo", "7:59.1", "95.5 km/h", "M. Hirvonen" ], [ "2\n(17 Feb)", "SS11", "12:05", "Mountain 1", "24.36 km", "M. Hirvonen", "14:01.8", "104.18 km/h", "M. Hirvonen" ], [ "2\n(17 Feb)", "SS12", "13:06", "Lillehammar", "5.98 km", "M. Grönholm", "4:33.9", "78.6 km/h", "M. Hirvonen" ], [ "2\n(17 Feb)", "SS13", "14:00", "Ringsaker 1", "27.30 km", "M. Grönholm", "16:29.7", "99.3 km/h", "M. Hirvonen" ], [ "2\n(17 Feb)", "SS14", "15:10", "Hamar 1", "1.14 km", "M. Grönholm", "1:13.8", "55.61 km/h", "M. Hirvonen" ], [ "3\n(18 Feb)", "SS15", "08:08", "Mountain 2", "24.36 km", "S. Loeb", "13:18.2", "109.87 km/h", "M. Hirvonen" ], [ "3\n(18 Feb)", "SS16", "08:55", "Ringsaker 2", "27.30 km", "H. Solberg", "15:28.6", "105.84 km/h", "M. Hirvonen" ], [ "3\n(18 Feb)", "SS17", "10:05", "Hamar 2", "1.14 km", "X. Pons\n S. Loeb\n P. Solberg", "1:11.8", "57.16 km/h", "M. Hirvonen" ], [ "3\n(18 Feb)", "SS18", "12:14", "Eleverum 2", "44.27 km", "M. Grönholm", "24:10.3", "109.89 km/h", "M. Hirvonen" ] ], "title": "", "original_id": "83152b654dce2311e6036b3d951bfc77" }, { "_id": "5401058c154fe0ddb1b2deecac708a83", "header": [ "League", "League.1", "Position", "Teams", "Matches", "Win", "Lose" ], "rows": [ [ "V.League", "7th (2000-01)", "4th", "10", "18", "9", "9" ], [ "V.League", "8th (2001-02)", "4th", "9", "16", "14", "2" ], [ "V.League", "9th (2002-03)", "3rd", "8", "21", "12", "9" ], [ "V.League", "10th (2003-04)", "Runner-up", "10", "18", "13", "5" ], [ "V.League", "11th (2004-05)", "8th", "10", "27", "11", "16" ], [ "V.League", "12th (2005-06)", "4th", "10", "27", "20", "7" ], [ "V・Premier", "2006-07", "6th", "10", "27", "11", "16" ], [ "V・Premier", "2007-08", "Champion", "10", "27", "23", "4" ], [ "V・Premier", "2008-09", "Champion", "10", "27", "20", "7" ], [ "V・Premier", "2009-10", "Champion", "8", "28", "21", "7" ], [ "V・Premier", "2010-11", "Runner-up", "8", "26", "19", "7" ], [ "V・Premier", "2011-12", "Champion", "8", "21", "18", "3" ], [ "V・Premier", "2012-13", "Runner-up", "8", "28", "20", "8" ] ], "title": "", "original_id": "b4eb57e9a160eb8d608dd549f1d97112" }, { "_id": "e9e25283d34e5a97f5a038d5a44233c4", "header": [ "Position", "Team", "Points", "Played", "Won", "Drawn", "Lost", "For", "Against", "Difference" ], "rows": [ [ "1", "Paulistano", "30", "18", "14", "2", "2", "62", "19", "43" ], [ "2", "Palestra Itália-SP", "29", "18", "14", "1", "3", "59", "21", "38" ], [ "3", "Corinthians", "26", "18", "12", "2", "4", "51", "16", "35" ], [ "4", "Ypiranga-SP", "25", "18", "11", "3", "4", "56", "34", "22" ], [ "5", "AA São Bento", "16", "18", "7", "2", "9", "38", "44", "-6" ], [ "6", "Santos", "13", "18", "6", "1", "11", "36", "43", "-7" ], [ "7", "SC Internacional de São Paulo", "11", "15", "3", "5", "7", "26", "44", "-18" ], [ "8", "Minas Gerais", "10", "15", "4", "2", "9", "18", "49", "-31" ], [ "9", "AA das Palmeiras", "6", "15", "3", "0", "12", "27", "57", "-30" ], [ "10", "Mackenzie", "2", "15", "1", "0", "14", "11", "57", "-46" ] ], "title": "", "original_id": "10374c30d690bc6605ca2037c06541ef" }, { "_id": "ec90ba87bd325b684657c1d8e546f52a", "header": [ "Interferometer and observing mode\tWaveband\tLimiting magnitude\tMinimum baseline (m)\\n(un-projected)\tMaximum baseline (m)\tApprox. no. visibility measurements per year\\n(measurements per night x nights used per year)\tMax ratio of no. phase / no. amplitude measurements\\n(measure of imaging performance", " 0 = none)\tAccuracy of amplitude2 measurements\tAccuracy of phase measurements\\n(milli-radians)\tNumber of spectral channels\\n(max in use simultaneously)\tComments" ], "rows": [ [ " H", " K\t8\t34\t330\t7500\t0.7\t1%\t10\t30000\tYes... 30000 in the visible band; maxiumum baseline 330-m" ], [ " No imaging on a single baseline instrument. CLOSED 2009.", null ] ], "title": "", "original_id": "ac9369e40bb0b3a23bbb92a0bae9b678" }, { "_id": "21223de9850aaebdfae5dda2e0d2e265", "header": [ "year", "typhus", "typhoid fever", "relapsing fever", "smallpox", "malaria" ], "rows": [ [ "1913", "120", "424", "30", "67", "3600" ], [ "191822", "1300", "293", "639", "106", "2940 (avg)" ], [ "1929", "40", "170", "6", "8", "3000" ], [ "1930", "60", "190", "5", "10", "2700" ], [ "1931", "80", "260", "4", "30", "3200" ], [ "1932", "220", "300", "12", "80", "4500" ], [ "1933", "800", "210", "12", "38", "6500" ], [ "1934", "410", "200", "10", "16", "9477" ], [ "1935", "120", "140", "6", "4", "9924" ] ], "title": "", "original_id": "a289c37617f27573e8568ede1ef81561" }, { "_id": "40899c93f8ce71f696618d14d61b20b9", "header": [ "song", "mobiles", "northern ireland", "northern england", "scotland", "southern england", "wales", "total" ], "rows": [ [ "groovy chick", "10", "3", "2", "3", "2", "3", "23" ], [ "clear the air", "5", "5", "10", "8", "3", "4", "35" ], [ "devil in a hood", "4", "1", "3", "4", "4", "1", "17" ], [ "in my life", "2", "6", "8", "5", "5", "10", "36" ], [ "how does it feel", "8", "8", "4", "10", "8", "5", "43" ], [ "the girl", "1", "2", "1", "1", "6", "2", "13" ], [ "about you", "3", "4", "6", "6", "1", "6", "26" ] ], "title": "", "original_id": "effc38cfdbb5023b3a88c474e66e3f83" }, { "_id": "e9a6175904be7ad9f9cbb1e2fa5fbd7c", "header": [ "Row Header", "Quarter Ended March 31 ", "Quarter Ended June 30 ", "Quarter Ended September 30 ", "Quarter Ended December 31 " ], "rows": [ [ "Operating revenue", "$9,589", "$11,402", "$11,380", "$10,888" ], [ "Income from operations", "495", "1,472", "1,473", "861" ], [ "Net income", "292", "1,052", "1,024", "641" ], [ "Basic earnings per share", "1.09", "4.03", "4.01", "2.54" ], [ "Diluted earnings per share", "1.09", "4.02", "3.99", "2.53" ], [ "2018 Operating revenue", "$9,032", "$10,777", "$11,003", "$10,491" ], [ "2018 Income from operations (a)", "262", "1,145", "1,187", "635" ], [ "2018 Net income (a)", "145", "683", "833", "461" ], [ "2018 Basic earnings per share (a)", "0.51", "2.48", "3.06", "1.70" ], [ "2018 Diluted earnings per share (a)", "0.51", "2.48", "3.05", "1.69" ] ], "title": "", "original_id": "82f9c9423754f76241ef44ad06504164" }, { "_id": "973f8c87936ce6ab0c21a90e717b95da", "header": [ "county", "obama%", "obama", "mccain%", "mccain", "total" ], "rows": [ [ "bernalillo", "60.66%", "168406", "39.34%", "109212", "277618" ], [ "catron", "32.07%", "659", "67.93%", "1396", "2055" ], [ "chaves", "37.45%", "8160", "62.55%", "13630", "21790" ], [ "cibola", "64.91%", "3176", "35.09%", "1717", "4893" ], [ "colfax", "55.31%", "3465", "44.69%", "2800", "6265" ], [ "curry", "32.69%", "4655", "67.31%", "9585", "14240" ], [ "debaca", "34.62%", "358", "65.38%", "676", "1034" ], [ "doã±a ana", "58.64%", "38574", "41.36%", "27211", "65785" ], [ "eddy", "36.89%", "7289", "63.11%", "12468", "19757" ], [ "grant", "60.06%", "8092", "39.94%", "5381", "13473" ], [ "guadalupe", "71.47%", "1541", "28.53%", "615", "2156" ], [ "harding", "41.76%", "256", "58.24%", "357", "613" ], [ "hidalgo", "51.46%", "990", "48.54%", "934", "1924" ], [ "lea", "27.65%", "5084", "72.35%", "13301", "18385" ], [ "lincoln", "37.09%", "3482", "62.91%", "5906", "9388" ], [ "los alamos", "53.38%", "5709", "46.62%", "4986", "10695" ], [ "luna", "52.65%", "4289", "47.35%", "3857", "8146" ], [ "mckinley", "72.12%", "15993", "27.88%", "6183", "22176" ], [ "mora", "79.24%", "2156", "20.76%", "565", "2721" ], [ "otero", "40.21%", "8602", "59.79%", "12791", "21393" ], [ "quay", "39.55%", "1546", "60.45%", "2363", "3909" ], [ "rio arriba", "75.51%", "11245", "24.49%", "3648", "14893" ], [ "roosevelt", "34.63%", "2270", "65.37%", "4285", "6555" ], [ "san juan", "39.16%", "17645", "60.84%", "27418", "45063" ], [ "san miguel", "80.71%", "10128", "19.29%", "2421", "12549" ], [ "sandoval", "56.33%", "32102", "43.67%", "24887", "56989" ], [ "santa fe", "77.70%", "53802", "22.30%", "15443", "69245" ], [ "sierra", "43.85%", "2351", "56.15%", "3011", "5362" ], [ "socorro", "60.66%", "4643", "39.34%", "3011", "7654" ], [ "taos", "82.56%", "13384", "17.44%", "2827", "16211" ], [ "torrance", "45.19%", "3068", "54.81%", "3721", "6789" ], [ "union", "28.77%", "492", "71.23%", "1218", "1710" ] ], "title": "", "original_id": "1c5c0e7e18b6e11f8c7b9ef00ef8b137" }, { "_id": "9271af3f840b1b645d48aa9920987a53", "header": [ "township", "county", "pop (2010)", "land ( sqmi )", "water (sqmi)", "latitude", "longitude", "geo id", "ansi code" ], "rows": [ [ "tacoma", "bottineau", "61", "39.385", "2.644", "48.668771", "- 100.852516", "3800977740", "1759300" ], [ "taft", "burleigh", "32", "35.809", "0.142", "46.771542", "- 100.258025", "3801577780", "1037068" ], [ "talbot", "bowman", "104", "35.822", "0.03", "46.166803", "- 103.304095", "3801177900", "1037226" ], [ "tanner", "kidder", "26", "34.098", "2.246", "46.758863", "- 99.506850", "3804377940", "1037057" ], [ "tappen", "kidder", "91", "34.677", "0.237", "46.841224", "- 99.647480", "3804378020", "2397881" ], [ "tatman", "ward", "2992", "35.922", "0.155", "48.418099", "- 101.249373", "3810178100", "1759694" ], [ "taylor", "sargent", "39", "36.03", "0.196", "45.979191", "- 97.696346", "3808178140", "1036786" ], [ "taylor butte", "adams", "14", "35.893", "0.006", "46.169023", "- 102.559886", "3800178220", "1037209" ], [ "teddy", "towner", "36", "35.847", "0.241", "48.747117", "- 99.077078", "3809578260", "1759667" ], [ "telfer", "burleigh", "74", "36.016", "0.062", "46.685192", "- 100.500785", "3801578300", "1759348" ], [ "tepee butte", "hettinger", "39", "35.799", "0.008", "46.415037", "- 102.735539", "3804178460", "1037233" ], [ "tewaukon", "sargent", "54", "37.499", "1.536", "45.976518", "- 97.426205", "3808178500", "1036784" ], [ "thelma", "burleigh", "17", "34.163", "1.942", "46.74648", "- 100.111760", "3801578580", "1037070" ], [ "thingvalla", "pembina", "101", "36.032", "0.009", "48.677597", "- 97.848487", "3806778620", "1036722" ], [ "thordenskjold", "barnes", "67", "35.623", "0.005", "46.668028", "- 97.874181", "3800378700", "1036401" ], [ "thorson", "burke", "26", "35.552", "0.355", "48.691017", "- 102.790846", "3801378780", "1037112" ], [ "tiber", "walsh", "72", "35.805", "0.093", "48.503371", "- 97.981576", "3809978820", "1036549" ], [ "tiffany", "eddy", "31", "35.94", "0.185", "47.715191", "- 98.848133", "3802778860", "1759415" ], [ "tioga", "williams", "104", "34.437", "0.151", "48.423224", "- 102.961858", "3810578980", "1037030" ], [ "tolgen", "ward", "29", "33.679", "2.213", "48.149479", "- 101.724985", "3810179100", "1036984" ], [ "torgerson", "pierce", "62", "33.181", "2.255", "48.425558", "- 99.924452", "3806979220", "1759561" ], [ "torning", "ward", "64", "34.401", "1.783", "48.071326", "- 101.482912", "3810179260", "1036955" ], [ "tower", "cass", "54", "34.556", "0.003", "46.941938", "- 97.608616", "3801779300", "1036378" ], [ "trenton", "williams", "541", "30.527", "1.956", "48.071095", "- 103.805216", "3810579500", "1036977" ], [ "tri", "mckenzie", "104", "113.817", "10.99", "48.016174", "- 103.665710", "3805379520", "1954181" ], [ "trier", "cavalier", "50", "30.346", "1.924", "48.681579", "- 98.895032", "3801979540", "1759383" ], [ "triumph", "ramsey", "38", "36.106", "0.493", "48.332618", "- 98.497709", "3807179580", "1759597" ], [ "troy", "divide", "45", "34.379", "1.584", "48.858036", "- 103.388573", "3802379660", "1036927" ], [ "truax", "williams", "190", "49.301", "7.797", "48.12222", "- 103.283768", "3810579740", "1036979" ], [ "truman", "pierce", "54", "35.36", "0.457", "47.898085", "- 99.994799", "3806979780", "1759562" ], [ "trygg", "burleigh", "40", "36.028", "0.0", "47.025735", "- 100.431786", "3801579820", "1037132" ], [ "tuller", "ransom", "107", "36.008", "0.01", "46.50733", "- 97.710566", "3807379860", "1036872" ], [ "turtle lake", "mclean", "43", "33.978", "1.982", "47.548602", "- 100.985957", "3805579980", "2397883" ], [ "turtle river", "grand forks", "174", "33.291", "0.272", "48.142938", "- 97.202245", "3803580060", "1036622" ], [ "tuscarora", "pierce", "62", "34.634", "1.241", "48.239469", "- 100.031162", "3806980100", "1759563" ], [ "tuttle", "kidder", "39", "34.48", "1.013", "47.1052", "- 100.051684", "3804380180", "1037159" ], [ "twelve mile", "williams", "74", "62.235", "7.737", "48.121003", "- 103.422014", "3810580220", "1036998" ], [ "twin butte", "divide", "18", "34.69", "1.361", "48.851599", "- 103.530568", "3802380260", "1759398" ], [ "twin hill", "towner", "39", "34.908", "0.901", "48.681853", "- 99.032808", "3809580340", "1759668" ], [ "twin lake", "benson", "39", "33.869", "2.113", "48.239127", "- 99.663851", "3800580380", "1759260" ], [ "twin tree", "benson", "143", "36.341", "0.213", "47.8974", "- 98.979574", "3800580420", "1759261" ], [ "twin valley", "mckenzie", "114", "79.127", "19.604", "48.045233", "- 103.184756", "3805380460", "1036972" ], [ "tyrol", "griggs", "116", "36.673", "0.191", "47.530487", "- 98.186907", "3803980580", "1036650" ] ], "title": "", "original_id": "4f6dce1f412de0aafbf367e0f8b8bbb7" }, { "_id": "bc5b42c87ff559468fdc5876ac8f06aa", "header": [ "MGWR No.", "Name", "Builder", "Introduced", "D-bogie", "GSR No.", "Withdrawn" ], "rows": [ [ "2", "Jupiter", "Beyer-Peacock", "1880", "1900", "534", "1949" ], [ "3", "Juno", "Beyer-Peacock", "1880", "1901", "535", "1949" ], [ "25→4", "Cyclops", "Beyer-Peacock", "1880", "1901", "531", "1945" ], [ "26→5", "Britania", "Beyer-Peacock", "1880", "1900", "532", "1949" ], [ "36→1", "Empress of Austria", "Beyer-Peacock", "1881", "1900", "530", "1949" ], [ "37→35→6", "Wolfdog", "Beyer-Peacock", "1881", "1900", "533", "1953" ] ], "title": "", "original_id": "1c37b8e9a57afaa04e2549ddc058b08c" }, { "_id": "0003513246ece2818a7e51111afe6658", "header": [ "rank", "surname", "number of bearers 1971", "number of bearers 2009", "type", "etymology" ], "rows": [ [ "1", "jensen", "368.631", "278.782", "patronymic", "son of jens" ], [ "2", "nielsen", "349.126", "275.744", "patronymic", "son of niels" ], [ "3", "hansen", "297.937", "231.221", "patronymic", "son of hans" ], [ "4", "pedersen", "203.426", "173.639", "patronymic", "son of peder" ], [ "5", "andersen", "188.359", "165.871", "patronymic", "son of anders" ], [ "6", "christensen", "159.943", "125.192", "patronymic", "son of christen" ], [ "7", "larsen", "148.214", "122.712", "patronymic", "son of lars" ], [ "8", "sørensen", "139.111", "117.3", "patronymic", "son of søren" ], [ "9", "rasmussen", "117.355", "99.238", "patronymic", "son of rasmus" ], [ "10", "jørgensen", "110.132", "93.182", "patronymic", "son of jørgen" ], [ "11", "petersen", "130.236", "85.268", "patronymic", "son of peter" ], [ "12", "madsen", "76.441", "67.075", "patronymic", "son of mads" ], [ "13", "kristensen", "58.99", "62.549", "patronymic", "son of kristen" ], [ "14", "olsen", "65.194", "50.904", "patronymic", "son of ole" ], [ "15", "thomsen", "40.18", "39.86", "patronymic", "son of thomas" ], [ "16", "christiansen", "45.984", "38.528", "patronymic", "son of christian" ], [ "17", "poulsen", "36.544", "33.106", "patronymic", "son of poul" ], [ "18", "johansen", "36.47", "32.166", "patronymic", "son of johan" ], [ "19", "knudsen", "34.66", "30.634", "patronymic", "son of knud" ], [ "20", "møller", "31.645", "30.516", "occupational", "miller" ] ], "title": "", "original_id": "d4d6a955f12c1e81e21bcb9aebb17f0c" }, { "_id": "613e0212b6e50376be8a166a12e61dc6", "header": [ "specimen weight / size", "calculated activity ( bq )", "calculated activity ( ci )", "estimated activity gr (api)", "estimated exposure ( mrem ) / hr" ], "rows": [ [ "1000 g / 8.79 cm", "183355", "4.9610 6", "8449.31", "2.78" ], [ "100 g / 4.08 cm", "18336", "4.9610 7", "844.93", "0.28" ], [ "10 g / 1.89 cm", "1834", "4.9610 8", "84.49", "0.03" ], [ "1 g / 8.79 mm", "183", "4.9610 9", "8.45", "0.0" ], [ "0.1 g / 4.08 mm", "18", "4.9610 10", "0.84", "0.0" ], [ "0.01 g / 1.89 mm", "2", "4.9610 11", "0.08", "0.0" ] ], "title": "", "original_id": "bbda9a858ef116f491529e0fe820e1a9" }, { "_id": "333f44070b8013f68b25e3d09cfb95b2", "header": [ "position", "club", "played", "points", "wins", "draws", "losses", "goals for", "goals against", "goal difference" ], "rows": [ [ "1", "rcd español", "38", "52", "20", "12", "6", "59", "25", "+ 34" ], [ "2", "real betis", "38", "51", "22", "7", "9", "66", "38", "+ 28" ], [ "3", "sd compostela", "38", "49", "21", "7", "10", "56", "36", "+ 20" ], [ "4", "cd toledo", "38", "47", "18", "11", "9", "50", "32", "+ 18" ], [ "5", "rcd mallorca", "38", "47", "20", "7", "11", "66", "39", "+ 27" ], [ "6", "real madrid b", "38", "46", "19", "8", "11", "57", "41", "+ 16" ], [ "7", "hércules cf", "38", "44", "16", "12", "10", "41", "35", "+ 6" ], [ "8", "barcelona b", "38", "39", "11", "17", "10", "59", "51", "+ 8" ], [ "9", "cp mérida", "38", "37", "12", "13", "13", "47", "41", "+ 6" ], [ "10", "sd eibar", "38", "35", "10", "15", "13", "30", "40", "- 10" ], [ "11", "cd badajoz", "38", "35", "12", "11", "15", "45", "46", "- 1" ], [ "12", "atlético marbella", "38", "35", "10", "15", "13", "40", "41", "- 1" ], [ "13", "palamós cf", "38", "34", "11", "12", "15", "40", "49", "- 9" ], [ "14", "athletic de bilbao b", "38", "34", "10", "14", "14", "46", "52", "- 6" ], [ "15", "cd leganés", "38", "34", "11", "12", "15", "53", "59", "- 6" ], [ "16", "villarreal cf", "38", "34", "14", "6", "18", "29", "48", "- 19" ], [ "17", "cd castellón", "38", "32", "9", "14", "15", "30", "48", "- 18" ], [ "18", "real murcia", "38", "31", "10", "11", "17", "40", "64", "- 24" ], [ "19", "real burgos 1", "38", "26", "10", "6", "22", "38", "68", "- 30" ], [ "20", "cádiz cf", "38", "18", "4", "10", "24", "28", "67", "- 39" ] ], "title": "", "original_id": "92dd1f500ae353c8d3cb4561626c578f" }, { "_id": "5e61bdf43fa4a276c2ebbc51106a9a53", "header": [ "epoch (utc)", "periselene (km)", "aposelene (km)", "eccentricity", "inclination (deg) (to moon equator)", "period (h)" ], "rows": [ [ "november 15 , 2004 , 17:47:12.1", "6700.72", "53215.151", "0.776329", "81.085", "129.247777" ], [ "december 4 , 2004 10:37:47.3", "5454.925", "20713.095", "0.583085", "83.035", "37.304959" ], [ "january 9 , 2005 , 15:24:55.0", "2751.511", "6941.359", "0.432261", "87.892", "8.409861" ], [ "february 28 , 2005 , 05:18:39.9", "2208.659", "4618.22", "0.352952", "90.063603", "4.970998" ], [ "april 25 , 2005 , 08:19:05.4", "2283.738", "4523.111", "0.328988", "90.141407", "4.949137" ], [ "may 16 , 2005 , 09:08:52.9", "2291.25", "4515.857", "0.326807", "89.734929", "4.949919" ], [ "june 20 , 2005 , 10:21:37.1", "2256.09", "4549.196", "0.33696", "90.232619", "4.947432" ] ], "title": "", "original_id": "a28aa98e66b222fe527ad474b890709b" }, { "_id": "02421fec8ead5657c34019abe248c181", "header": [ "rank", "company", "headquarters", "industry", "sales (billion )", "profits (billion )", "assets (billion )", "market value (billion )" ], "rows": [ [ "1", "jpmorgan chase", "usa", "banking", "115.5", "17.4", "2117.6", "182.2" ], [ "2", "hsbc", "uk", "banking", "103.3", "13.3", "2467.9", "186.5" ], [ "3", "general electric", "usa", "conglomerate", "156.2", "11.6", "751.2", "216.2" ], [ "4", "exxonmobil", "usa", "oil and gas", "341.6", "30.5", "302.5", "407.2" ], [ "5", "royal dutch shell", "netherlands", "oil and gas", "369.1", "20.1", "317.2", "212.9" ], [ "6", "petrochina", "china", "oil and gas", "222.3", "21.2", "251.3", "320.8" ], [ "7", "industrial and commercial bank of china", "china", "banking", "69.2", "18.8", "1723.5", "239.5" ], [ "8", "berkshire hathaway", "usa", "conglomerate", "136.2", "13.0", "372.2", "211.0" ], [ "8", "petrobras", "brazil", "oil and gas", "121.3", "21.2", "313.2", "238.8" ], [ "10", "citigroup", "usa", "banking", "111.5", "10.6", "1913.9", "132.8" ], [ "11", "bnp paribas", "france", "banking", "130.4", "10.5", "2680.7", "88.0" ], [ "11", "wells fargo", "usa", "banking", "93.2", "12.4", "1258.1", "170.6" ], [ "13", "santander group", "spain", "banking", "109.7", "12.8", "1570.6", "94.7" ], [ "14", "at&t inc", "usa", "telecommunications", "124.3", "19.9", "268.5", "168.2" ], [ "15", "gazprom", "russia", "oil and gas", "98.7", "25.7", "275.9", "172.9" ], [ "16", "chevron", "usa", "oil and gas", "189.6", "19.0", "184.8", "200.6" ], [ "17", "china construction bank", "china", "banking", "58.2", "15.6", "1408.0", "224.8" ], [ "18", "walmart", "usa", "retailing", "421.8", "16.4", "180.7", "187.3" ], [ "19", "total", "france", "oil and gas", "188.1", "14.2", "192.8", "138.0" ], [ "20", "allianz", "germany", "insurance", "142.9", "6.7", "838.4", "62.7" ] ], "title": "", "original_id": "93ba281742f9dcacc81800f11074ddcc" }, { "_id": "2d18837de425d14c8c9e54a1f3ef975e", "header": [ "Model", "Fuel Type", "mpg (US gallons)", "L/100 km", "NZ Rating\n(Stars)" ], "rows": [ [ "Volkswagen Polo 1.4 TDI BLUEMOTION", "diesel", "62.0", "3.8", "5.5" ], [ "Volkswagen Polo 1.4 TDI 5M", "diesel", "52.0", "4.5", "5.5" ], [ "Volkswagen Polo 1.4 MAN", "petrol", "36.7", "6.4", "4.5" ], [ "Volkswagen Polo 1.4 6A", "petrol", "34.0", "6.9", "4.5" ], [ "Fiat 500 1.3 JTD POP", "diesel", "56.0", "4.2", "5.5" ], [ "Fiat 500 1.2 POP", "petrol", "46.0", "5.1", "5.0" ], [ "Fiat 500 1.4 LOUNGE 3D", "petrol", "37.3", "6.3", "4.5" ], [ "Fiat 500 1.4 POP", "petrol", "37.3", "6.3", "4.5" ], [ "Fiat 500 1.4 SPORT", "petrol", "37.3", "6.3", "4.5" ], [ "Mini Cooper HATCH 6M 2DR 1.5L Diesel", "diesel", "53.0", "4.4", "5.5" ], [ "Mini Cooper COUPE 6M 3DR 1.6L Diesel", "diesel", "52.0", "4.5", "5.5" ], [ "Mini Cooper COUPE 6A 3DR 1.6L Diesel", "diesel", "43.5", "5.4", "5.0" ], [ "Mini Cooper HATCH 6M 2DR 1.6I", "petrol", "40.5", "5.8", "5.0" ], [ "Mini Cooper COUPE 6M 3DR 1.6L", "petrol", "39.2", "6.0", "5.0" ], [ "Mini Cooper HATCH 6M 2DR 1.5L", "petrol", "35.0", "6.7", "4.5" ], [ "Mini Cooper COUPE 6A 3DR 1.6L", "petrol", "34.6", "6.8", "4.5" ], [ "Citroen C4 1.6 HDI 6A EGS 5DR", "diesel", "52.0", "4.5", "5.5" ], [ "Citroen C4 1.6 SX 5DR 5SP M D", "diesel", "50.0", "4.7", "5.0" ], [ "Citroen C4 2.0 SX 5DR 6SP A D", "diesel", "37.3", "6.3", "4.5" ], [ "Hyundai Getz 1.5D CRDI 5D M5", "diesel", "52.0", "4.5", "5.5" ], [ "Hyundai Getz 1.4 5D M5", "petrol", "38.5", "6.1", "4.5" ], [ "Kia Rio 1.5 DIESEL HATCH MAN", "diesel", "52.0", "4.5", "5.5" ], [ "Kia Rio 1.5 DIESEL SEDAN MAN", "diesel", "52.0", "4.5", "5.5" ], [ "Kia Rio 1.6 HATCH MANUAL", "petrol", "34.6", "6.8", "4.5" ], [ "Volkswagen Golf 1.9 TDI BLUEMOTION", "diesel", "52.0", "4.5", "5.5" ], [ "Volkswagen Golf 1.9 TDI 7DSG", "diesel", "44.3", "5.3", "5.0" ], [ "Volkswagen Golf 90KW TSI 7DSG", "petrol", "39.8", "5.9", "5.0" ], [ "Volkswagen Golf 1.9 TDI 6DSG", "diesel", "39.2", "6.0", "5.0" ], [ "Volkswagen Golf 2.0 TDI 4 MOTION MAN", "diesel", "39.2", "6.0", "5.0" ], [ "Volkswagen Golf 2.0 TDI DSG", "diesel", "39.2", "6.0", "5.0" ], [ "Volkswagen Golf TDI 103KW 6DSG", "diesel", "38.5", "6.1", "4.5" ], [ "Volkswagen Golf TDI 103KW 4MOTION", "diesel", "37.3", "6.3", "4.5" ], [ "Fiat Grande Punto 1.3 JTD 5D 6SP", "diesel", "51.0", "4.6", "5.0" ], [ "Fiat Grande Punto 1.3 JTD 5D DUALOGIC", "diesel", "51.0", "4.6", "5.0" ], [ "Fiat Grande Punto 1.3 JTD DUAL LOGIC", "diesel", "46.0", "5.1", "5.0" ], [ "Fiat Grande Punto 1.9 JTD SPORT 3D 6SP", "diesel", "42.0", "5.6", "5.0" ], [ "Fiat Grande Punto 1.9 EMOTION 5DR 6SPD", "diesel", "42.0", "5.6", "5.0" ], [ "Fiat Grande Punto 1.9 JTD 5D 6SPEED", "diesel", "42.0", "5.6", "5.0" ], [ "Fiat Grande Punto 1.4 DYNAMIC 5 SPEED", "petrol", "38.5", "6.1", "4.5" ], [ "Fiat Grande Punto 1.4 5D DUAL LOGIC", "petrol", "35.0", "6.7", "4.5" ], [ "Honda Civic Hybrid", "petrol", "51.0", "4.6", "5.0" ], [ "Hyundai Accent 1.5 CRDI 4D M5 SEDAN", "diesel", "51.0", "4.6", "5.0" ], [ "Hyundai Accent 1.6 GLS 4D M5", "petrol", "36.7", "6.4", "4.5" ], [ "Peugeot 308 HDI AT 1.6", "diesel", "51.0", "4.6", "5.0" ], [ "Peugeot 308 XS MANUAL", "petrol", "35.0", "6.7", "4.5" ], [ "Peugeot 308 HDI AUTO", "diesel", "34.6", "6.8", "4.5" ], [ "Skoda Fabia 1.4 TDI", "diesel", "51.0", "4.6", "5.0" ], [ "Skoda Fabia 1.9 TDI COMBI", "diesel", "48.0", "4.9", "5.0" ], [ "Volkswagen Jetta 1.9 TDI 7DSG", "diesel", "51.0", "4.6", "5.0" ], [ "Volkswagen Jetta 2.0 TDI DSG", "diesel", "43.5", "5.4", "5.0" ], [ "Volkswagen Jetta TDI 103KW 6DSG", "diesel", "37.9", "6.2", "4.5" ], [ "Hyundai i30 1.6 CRDI ELITE M5", "diesel", "50.0", "4.7", "5.0" ], [ "Hyundai i30 1.6 CRDI 5D M5", "diesel", "50.0", "4.7", "5.0" ], [ "Hyundai i30 1.6 CRDI ELITE A4", "diesel", "39.2", "6.0", "5.0" ], [ "Hyundai i30 1.6 5D M5", "petrol", "37.9", "6.2", "4.5" ], [ "Peugeot 207 HDI 1.6 5DR 5 SP M D", "diesel", "49.0", "4.8", "5.0" ], [ "Peugeot 207 XS 1.4 5DR 5SPD M P", "petrol", "37.3", "6.3", "4.5" ], [ "Citroen C3 1.6 HDI 5DR 5SPD", "diesel", "48.0", "4.9", "5.0" ], [ "Citroen C3 1.6 5DR 5SPD", "petrol", "36.2", "6.5", "4.5" ], [ "Kia Cerato 1.6 DIESEL 5M SEDAN", "diesel", "48.0", "4.9", "5.0" ], [ "Daihatsu Sirion 1.0 HATCH 5MT", "petrol", "47.0", "5.0", "5.0" ], [ "Daihatsu Sirion 1.3P HATCH 5M", "petrol", "40.5", "5.8", "5.0" ], [ "Daihatsu Sirion 1.3P HATCH 4A", "petrol", "36.2", "6.5", "4.5" ], [ "Daihatsu Sirion 1.5P SX HATCH 4AT", "petrol", "35.0", "6.7", "4.5" ], [ "Smart Fortwo CAB", "petrol", "47.0", "5.0", "5.0" ], [ "Smart Fortwo COUPE", "petrol", "47.0", "5.0", "5.0" ], [ "Toyota Corolla 1.4D HATCH5 5M", "diesel", "47.0", "5.0", "5.0" ], [ "Toyota Corolla 2.0D HATCH5 6M", "diesel", "43.5", "5.4", "5.0" ], [ "Toyota Corolla 1.5P WAGON 5DR 5M", "petrol", "40.5", "5.8", "5.0" ], [ "Volkswagen Passat TDI BLUEMOTION SED", "diesel", "46.0", "5.1", "5.0" ], [ "Volkswagen Passat TDI BLUEMOTION VAR", "diesel", "44.3", "5.3", "5.0" ], [ "Volkswagen Passat 2.0 TDI DSG SEDAN", "diesel", "38.5", "6.1", "4.5" ], [ "Volkswagen Passat 2.0 TDI DSG VARIANT", "diesel", "37.9", "6.2", "4.5" ], [ "Volkswagen Passat TDI 125KW 6DSG SED", "diesel", "36.2", "6.5", "4.5" ], [ "Volkswagen Passat TDI 125KW 6DSG VAR", "diesel", "35.6", "6.6", "4.5" ], [ "Volkswagen Passat TDI 103KW 4M VAR", "diesel", "35.0", "6.7", "4.5" ], [ "Kia Picanto 1.1 MANUAL", "petrol", "45.2", "5.2", "5.0" ], [ "Kia Picanto 1.1 AUTO", "petrol", "40.5", "5.8", "5.0" ], [ "Skoda Octavia 1.9 TDI MAN COMBI", "diesel", "45.2", "5.2", "5.0" ], [ "Skoda Octavia RS 2.0 TDI SEDAN MAN", "diesel", "41.2", "5.7", "5.0" ], [ "Skoda Octavia RS 2.0 TDI COMBI MAN", "diesel", "40.5", "5.8", "5.0" ], [ "Skoda Octavia 1.9 TDI AUTO", "diesel", "40.5", "5.8", "5.0" ], [ "Skoda Octavia 1.9 TDI COMBI AUTO", "diesel", "40.5", "5.8", "5.0" ], [ "Skoda Octavia 4X4 2.0 TDI COMBI M", "diesel", "37.9", "6.2", "4.5" ], [ "Skoda Octavia SCOUT 2.0 TDI", "diesel", "36.7", "6.4", "4.5" ], [ "BMW 118D HATCH 6M 5DR 1.8L", "diesel", "44.3", "5.3", "5.0" ], [ "BMW 118D HATCH 6A 5DR 1.8L", "diesel", "39.2", "6.0", "5.0" ], [ "Ford Focus 1.8TD WAGON", "diesel", "44.3", "5.3", "5.0" ], [ "Ford Focus 1.6 M HATCH", "petrol", "35.0", "6.7", "4.5" ], [ "Ford Focus WAG 1.6 MAN", "petrol", "35.0", "6.7", "4.5" ], [ "Mercedes Benz A 180 CDI CLASSIC", "diesel", "44.3", "5.3", "5.0" ], [ "Mercedes Benz A 180 CDI ELEGANCE", "diesel", "44.3", "5.3", "5.0" ], [ "Mercedes Benz A 180 CDI AVANTGARDE", "diesel", "44.3", "5.3", "5.0" ], [ "Mercedes Benz A 200 CDI AVANTGARDE", "diesel", "43.5", "5.4", "5.0" ], [ "Skoda Roomster 1.9 TDI COMFORT", "diesel", "43.5", "5.4", "5.0" ], [ "Skoda Roomster 1.9 TDI STYLE", "diesel", "43.5", "5.4", "5.0" ], [ "Audi A4 2.0 TDI MULTI SEDAN", "diesel", "42.7", "5.5", "5.0" ], [ "Audi A4 2.0 TDI MULTI", "diesel", "37.9", "6.2", "4.5" ], [ "Audi A4 2.0 TDI MULTI AVANT", "diesel", "37.9", "6.2", "4.5" ], [ "Audi A4 2.7 TDI MULTI SEDAN", "diesel", "35.6", "6.6", "4.5" ], [ "BMW 120D 5 DOOR M E87", "diesel", "42.7", "5.5", "5.0" ], [ "BMW 120D 5 DOOR A E87", "diesel", "38.5", "6.1", "4.5" ], [ "Fiat Bravo SPORT JTD 16V 5DR", "diesel", "42.0", "5.6", "5.0" ], [ "Mitsubishi Colt 1.5P LS 5DR HATCH A", "petrol", "42.0", "5.6", "5.0" ], [ "Mitsubishi Colt 1.5P VRX 5DR HATCH", "petrol", "42.0", "5.6", "5.0" ], [ "Mitsubishi Colt 1.5P VRX 5DR HATCH A", "petrol", "42.0", "5.6", "5.0" ], [ "Mitsubishi Colt 1.5P VRX 5DR HATCHA", "petrol", "42.0", "5.6", "5.0" ], [ "Mitsubishi Colt 1.5P LS 5DR HATCH M", "petrol", "39.8", "5.9", "5.0" ], [ "BMW 520D SEDAN 6A 4DR 2.0L", "diesel", "41.2", "5.7", "5.0" ], [ "Holden Astra MY8.5 CDTI WAGON MAN", "diesel", "41.2", "5.7", "5.0" ], [ "Holden Astra MY8.5 CDTI HATCH MAN", "diesel", "41.2", "5.7", "5.0" ], [ "Holden Astra CDTI 5DR HATCH MT", "diesel", "39.2", "6.0", "5.0" ], [ "Holden Astra CDTI 5DR MAN", "diesel", "39.2", "6.0", "5.0" ], [ "Mini One HATCH 6M 2DR 1.4I", "petrol", "41.2", "5.7", "5.0" ], [ "Mini One HATCH 6A 2DR 1.4I", "petrol", "35.6", "6.6", "4.5" ], [ "Subaru Legacy WAGON 2.0 TD MANUAL", "diesel", "41.2", "5.7", "5.0" ], [ "Audi A3 2.0 TDI S TRONIC", "diesel", "40.5", "5.8", "5.0" ], [ "Audi A3 SPORTBACK 1.4T FSI", "petrol", "40.5", "5.8", "5.0" ], [ "Audi A3 2.0 TDI SP A TRONIC", "diesel", "38.5", "6.1", "4.5" ], [ "Subaru Outback WAGON 2.0 TD MANUAL", "diesel", "40.5", "5.8", "5.0" ], [ "BMW 123D COUPE 6M 3DR 2.0L", "diesel", "39.8", "5.9", "5.0" ], [ "BMW 123D Saloon 6M 5DR 2.3L", "diesel", "39.8", "5.9", "5.0" ], [ "BMW 123D HATCH 6M 5DR 2.3L", "diesel", "38.5", "6.1", "4.5" ], [ "BMW 123D 2.3L 6A 3DR COUPE", "diesel", "38.5", "6.1", "4.5" ], [ "Daihatsu Charade 1.0P HATCH5 4A", "petrol", "39.8", "5.9", "5.0" ], [ "Saab 9-3 Linear SPCOMBI1.9MT", "diesel", "39.8", "5.9", "5.0" ], [ "Saab 9-3 Linear CONVERTIBLE 1.9TID M", "diesel", "37.3", "6.3", "4.5" ], [ "Volkswagen Caddy DELIVERY 1.9TDI DSG", "diesel", "39.8", "5.9", "5.0" ], [ "Volkswagen Caddy DELIVERY 1.9TDI MAN", "diesel", "38.5", "6.1", "4.5" ], [ "Volkswagen Caddy LIFE 1.9 TDI DSG", "diesel", "38.5", "6.1", "4.5" ], [ "Volkswagen Caddy LIFE 1.9 TDI MAN", "diesel", "37.9", "6.2", "4.5" ], [ "Alfa Romeo 147 1.9 JTD 16V 5DR 6 SP", "diesel", "39.2", "6.0", "5.0" ], [ "Alfa Romeo 159 1.9 JTD 4D 6SP SEDAN", "diesel", "39.2", "6.0", "5.0" ], [ "Alfa Romeo 159 2.4 JTD 4D 6SP SEDAN", "diesel", "34.6", "6.8", "4.5" ], [ "BMW 320D SEDAN 6A 4DR 2.0L", "diesel", "39.2", "6.0", "5.0" ], [ "BMW 320D TOURING 6A 5DR 2.0L", "diesel", "38.5", "6.1", "4.5" ], [ "Daihatsu Copen 1.3P COUPE CONV 5M", "petrol", "39.2", "6.0", "5.0" ], [ "Hyundai Sonata 2.0 CRDI M6", "diesel", "39.2", "6.0", "5.0" ], [ "Dodge Caliber SXT CRD", "diesel", "38.5", "6.1", "4.5" ], [ "Honda Jazz SPORT", "petrol", "38.5", "6.1", "4.5" ], [ "Holden Combo XC 1.4 MANUAL", "petrol", "37.9", "6.2", "4.5" ], [ "Mercedes Benz B 200 CDI", "diesel", "37.9", "6.2", "4.5" ], [ "Suzuki Swift GLX 1.5 5DR", "petrol", "37.3", "6.3", "4.5" ], [ "Suzuki Swift GLXH 1.5 5DR", "petrol", "37.3", "6.3", "4.5" ], [ "Suzuki Swift GLXH2 1.5 5DR", "petrol", "37.3", "6.3", "4.5" ], [ "Suzuki Swift GLXA 1.5 5DR", "petrol", "35.0", "6.7", "4.5" ], [ "Suzuki Swift GLXHA 1.5 5DR", "petrol", "35.0", "6.7", "4.5" ], [ "Suzuki Swift GLXHA2 1.5 5DR", "petrol", "35.0", "6.7", "4.5" ], [ "Fiat Multipla DYNAMIC 1.9 JTD 5D", "diesel", "36.7", "6.4", "4.5" ], [ "Mazda Mazda2 CLASSIC 5DR 1.5 M5", "petrol", "36.7", "6.4", "4.5" ], [ "Mazda Mazda2 SPORT 5 DR 1.5 M 5", "petrol", "36.7", "6.4", "4.5" ], [ "Mazda Mazda2 SPORT 5 DR 1.5 4AT", "petrol", "34.6", "6.8", "4.5" ], [ "Mazda Mazda2 CLASSIC 5DR 1.5 4AT", "petrol", "34.6", "6.8", "4.5" ], [ "Mitsubishi Colt Plus 1.5P RALLIART TURBO", "petrol", "36.7", "6.4", "4.5" ], [ "Peugeot 307 XS 1.6 5DR 4SPD A P", "petrol", "36.7", "6.4", "4.5" ], [ "Peugeot 307 XSP 2.0 5DR 5SPD M P", "petrol", "36.2", "6.5", "4.5" ], [ "Peugeot 307 HDI 2.0 5DR 6SPD A D", "diesel", "35.0", "6.7", "4.5" ], [ "Peugeot 307 HDI 2.0 5DR 6SPD M D", "diesel", "35.0", "6.7", "4.5" ], [ "Peugeot 607 HDI 2.2 5DR 6SPM P", "diesel", "36.7", "6.4", "4.5" ], [ "BMW 330D SEDAN 6M 4DR 3.0L", "diesel", "36.2", "6.5", "4.5" ], [ "Jeep Compass LTD 2.0L CRD", "diesel", "36.2", "6.5", "4.5" ], [ "Ford Fiesta 5DR 1.6 M", "petrol", "35.6", "6.6", "4.5" ], [ "Mitsubishi I-car 660P 5DR A", "petrol", "39.8", "5.9", "4.5" ], [ "Toyota RAV4 2.2D WAGON 6M L1", "diesel", "35.6", "6.6", "4.5" ], [ "BMW 118I 5 DOOR M E87", "petrol", "35.0", "6.7", "4.5" ], [ "Jeep Patriot 2.0L CRD HIGH LINE", "diesel", "35.0", "6.7", "4.5" ], [ "Renault Clio 1.6 3DR 4SP A P", "petrol", "35.0", "6.7", "4.5" ], [ "Alfa Romeo Brera 2.4 JTD 3D 6 SPEED", "diesel", "34.6", "6.8", "4.5" ], [ "Audi A6 2.7 TDI QUATTRO TIP", "diesel", "34.6", "6.8", "4.5" ], [ "BMW 535D SEDAN 6A 4D 3.0L", "diesel", "34.6", "6.8", "4.5" ], [ "Suzuki SX4 GLXF 1.6 5DR", "petrol", "34.6", "6.8", "4.5" ], [ "Suzuki SX4 GLXH2 1.6 5DR", "petrol", "34.6", "6.8", "4.5" ], [ "Volkswagen Crosstouran 103KW TDI 6DSG", "diesel", "34.6", "6.8", "4.5" ], [ "Volkswagen Touran 103KW TDI 6DSG", "diesel", "34.6", "6.8", "4.5" ], [ "Holden Barina 3DR HATCH MANUAL", "petrol", "34.0", "6.9", "4.5" ], [ "Holden Barina 5DR HATCH MANUAL", "petrol", "34.0", "6.9", "4.5" ] ], "title": "", "original_id": "62115c3dde92e599d85003e61d7debf3" }, { "_id": "be1deadcd3707d3743725bcfd5e958d3", "header": [ "year", "number of examinees", "number of passed students", "pass percentage", "obtained gpa - 5" ], "rows": [ [ "2005", "314", "239", "67.75%", "31" ], [ "2006", "331", "278", "72.37%", "54" ], [ "2007", "336", "260", "68.62%", "63" ], [ "2008", "346", "274", "75.54%", "79" ], [ "2009", "360", "297", "78.35%", "83" ], [ "2010", "364", "322", "79.68%", "85" ] ], "title": "", "original_id": "efaf118e6555dca460aef7313b577960" }, { "_id": "9d9999816fde80641419d3f569d33b22", "header": [ "year", "candidates", "total votes", "average votes per candidate", "% of total vote", "average % of vote per candidate", "saved deposits", "number of mps" ], "rows": [ [ "1974 - 02", "6", "4576", "763", "0.01", "1.67", "0", "0" ], [ "1974 - 10", "5", "1996", "399", "0.0", "0.91", "0", "0" ], [ "1979", "53", "39918", "753", "0.13", "1.46", "0", "0" ], [ "1983", "109", "54299", "498", "0.17", "1.04", "0", "0" ], [ "1987", "133", "89753", "675", "0.28", "1.35", "0", "0" ], [ "1992", "253", "170037", "672", "0.51", "1.27", "0", "0" ], [ "1997", "89", "61731", "694", "0.21", "1.34", "0", "0" ], [ "2001", "145", "166477", "1148", "0.63", "2.75", "10", "0" ], [ "2005", "182", "257758", "1416", "1.04", "3.29", "22", "0" ] ], "title": "", "original_id": "72e6ff55259803f7c3bcd7d3c4f49c58" }, { "_id": "507b1ff39985057ea31e574e51621ff0", "header": [ "township", "county", "pop (2010)", "land ( sqmi )", "water (sqmi)", "latitude", "longitude", "geo id", "ansi code" ], "rows": [ [ "oak creek", "bottineau", "24", "35.445", "0.0", "48.675399", "- 100.471642", "3800958700", "1759286" ], [ "oak valley", "bottineau", "52", "36.016", "0.087", "48.777318", "- 100.511814", "3800958860", "1759287" ], [ "oakhill", "barnes", "51", "35.414", "0.081", "46.679076", "- 98.017963", "3800358780", "1036402" ], [ "oakland", "mountrail", "26", "35.167", "0.785", "48.157497", "- 102.109269", "3806158820", "1036997" ], [ "oakville", "grand forks", "200", "35.059", "0.047", "47.883391", "- 97.305536", "3803558900", "1036604" ], [ "oakwood", "walsh", "228", "33.526", "0.0", "48.412107", "- 97.339101", "3809958980", "1036534" ], [ "oberon", "benson", "67", "57.388", "0.522", "47.925443", "- 99.244476", "3800559060", "2397849" ], [ "odessa", "hettinger", "16", "35.766", "0.06", "46.583226", "- 102.104455", "3804159100", "1759459" ], [ "odessa", "ramsey", "49", "37.897", "8.314", "47.968754", "- 98.587529", "3807159140", "1759587" ], [ "odin", "mchenry", "46", "34.424", "1.722", "47.986751", "- 100.637016", "3804959180", "1759507" ], [ "oliver", "williams", "8", "35.987", "0.024", "48.423293", "- 103.320183", "3810559260", "1037033" ], [ "olivia", "mchenry", "40", "35.874", "0.035", "47.900358", "- 100.769959", "3804959300", "1759508" ], [ "olson", "towner", "19", "35.033", "0.954", "48.505811", "- 99.287008", "3809559380", "1759659" ], [ "ontario", "ramsey", "72", "33.923", "1.99", "48.163172", "- 98.601321", "3807159460", "1759588" ], [ "ops", "walsh", "63", "36.015", "0.0", "48.238231", "- 97.578927", "3809959540", "1036518" ], [ "ora", "nelson", "69", "34.414", "0.697", "47.722982", "- 97.946877", "3806359580", "1036557" ], [ "orange", "adams", "22", "35.802", "0.133", "46.012558", "- 102.053893", "3800159620", "1037214" ], [ "oriska", "barnes", "65", "35.082", "0.087", "46.935397", "- 97.752733", "3800359700", "1036418" ], [ "orlien", "ward", "47", "35.645", "0.72", "47.985154", "- 101.796936", "3810159740", "1036954" ], [ "orthell", "williams", "12", "35.894", "0.034", "48.495353", "- 103.728983", "3810559860", "1759732" ], [ "osago", "nelson", "31", "35.4", "0.198", "47.800898", "- 98.328474", "3806359900", "1036565" ], [ "osborn", "mountrail", "285", "30.296", "4.988", "47.987208", "- 102.429987", "3806159940", "1034001" ], [ "osford", "cavalier", "47", "35.803", "0.052", "48.585234", "- 98.115821", "3801959980", "1759377" ], [ "oshkosh", "wells", "56", "34.747", "0.065", "47.623026", "- 99.576942", "3810360020", "1759708" ], [ "osloe", "mountrail", "41", "35.077", "0.903", "48.146259", "- 101.976499", "3806160060", "1036937" ], [ "osnabrock", "cavalier", "36", "35.505", "0.439", "48.594234", "- 98.241946", "3801960140", "2397851" ], [ "ostby", "bottineau", "45", "35.452", "0.027", "48.581052", "- 100.352948", "3800960180", "1759288" ], [ "otis", "mclean", "41", "35.152", "0.656", "47.799001", "- 100.896513", "3805560260", "1759541" ], [ "overland", "ramsey", "14", "35.602", "0.4", "48.406215", "- 98.644574", "3807160340", "1759589" ], [ "ovid", "lamoure", "46", "35.328", "0.505", "46.318992", "- 98.107769", "3804560420", "1036886" ], [ "owego", "ransom", "21", "36.034", "0.029", "46.50933", "- 97.319286", "3807360460", "1036866" ] ], "title": "", "original_id": "37125493373f4dba45a76bf2ae812a57" }, { "_id": "cf3d3ce5ae6d1086e26367d0d7b3dd4e", "header": [ "year (january)", "population (000)", "rural , %", "urban , %", "source" ], "rows": [ [ "1939", "6081", "72", "28", "census" ], [ "1959", "9295", "56", "44", "census" ], [ "1970", "13001", "50", "50", "census" ], [ "1979", "14685", "46", "54", "census" ], [ "1989", "16537", "43", "57", "census" ], [ "1999", "14953", "43", "57", "census" ], [ "2002", "14851", "43", "57", "estimate" ], [ "2005", "15075", "43", "57", "estimate" ], [ "2008", "15572", "47", "53", "estimate" ] ], "title": "", "original_id": "68f293a5fcdbc2dea70732f53710cb68" }, { "_id": "36411d9c5d9190d5266879b11cc5ca6b", "header": [ "place", "code", "area (km 2 )", "population", "most spoken language" ], "rows": [ [ "boipatong", "70401", "1.62", "16867", "sotho" ], [ "bophelong", "70402", "5.97", "37782", "sotho" ], [ "evaton", "70404", "35.2", "143157", "sotho" ], [ "orange farm", "70405", "3.79", "16720", "zulu" ], [ "sebokeng", "70406", "32.8", "222045", "sotho" ], [ "sharpeville", "70407", "5.04", "41032", "sotho" ], [ "tshepiso", "70408", "5.26", "22952", "sotho" ], [ "vanderbijlpark", "70409", "207.69", "80205", "afrikaans" ], [ "vereeniging", "70410", "191.33", "73283", "afrikaans" ], [ "remainder of the municipality", "70403", "498.77", "4378", "sotho" ] ], "title": "", "original_id": "01f66b6eca74f5c74f00158de9c93e86" }, { "_id": "131eee900e79ba1797c8cbdf9912d308", "header": [ "rank", "couple", "judges", "public", "total", "vote percentage", "result" ], "rows": [ [ "1", "hayley and daniel", "7", "6", "13", "25.1%", "safe" ], [ "2", "mikey and melanie", "3", "7", "10", "35.7%", "safe" ], [ "3", "gary and maria", "5", "5", "10", "13.5%", "safe" ], [ "4", "danny and frankie", "6", "3", "9", "6.2%", "safe" ], [ "5", "kieron and brianne", "4", "4", "8", "9.0%", "safe" ], [ "6", "danniella and matthew", "6", "1", "7", "4.2%", "bottom two" ] ], "title": "", "original_id": "faaef2c1a2e22fbcb12eb4f7176d0493" }, { "_id": "fdbfb2e55fb31d802ef856062d82cb70", "header": [ "2nd component", "bp 2nd comp (˚c)", "3rd component", "bp 3rd comp (˚c)", "bp azeo (˚c)", "% wt 1st", "% wt 2nd", "% wt 3rd" ], "rows": [ [ "ethanol", "78.4", "ethyl acetate", "77.1", "70.3degree", "7.8", "9.0", "83.2" ], [ "ethanol", "78.4", "cyclohexane", "80.8", "62.1", "7", "17", "76" ], [ "ethanol", "78.4", "benzene", "80.2", "64.9", "7.4 u 1.3 l 43.1", "18.5 u 12.7 l 52.1", "74.1 u 86.0 l 4.8" ], [ "ethanol", "78.4", "chloroform", "61.2", "55.5", "3.5 u 80.8 l 0.5", "4.0 u 18.2 l 3.7", "92.5 u 1.0 l 95.8" ], [ "ethanol", "78.4", "carbon tetrachloride", "86.8", "61.8", "4.3", "9.7", "86.0" ], [ "ethanol", "78.4", "carbon tetrachloride", "86.8", "61.8", "3.4 u 44.5 l<0.1", "10.3 u 48.5 l 5.2", "86.3 u 7.0 l 94.8" ], [ "ethanol", "78.4", "ethylene chloride", "83.7", "66.7", "5", "17", "78" ], [ "ethanol", "78.4", "acetonitrile", "82.0", "72.9", "1.0", "55.0", "44.0" ], [ "ethanol", "78.4", "toluene", "110.6", "74.4", "12.0 u 3.1 l 20.7", "37.0 u 15.6 l 54.8", "51.0 u 81.3 l 24.5" ], [ "ethanol", "78.4", "methyl ethyl ketone", "79.6", "73.2", "11.0", "14.0", "75.0" ], [ "ethanol", "78.4", "n - hexane", "69.0", "56.0", "3.0 u 0.5 l 19.0", "12.0 u 3.0 l 75.0", "85.0 u 96.5 l 6.0" ], [ "ethanol", "78.4", "n - heptane", "98.4", "68.8", "6.1 u 0.2 l 15.0", "33.0 u 5.0 l 75.9", "60.9 u 94.8 l 9.1" ], [ "ethanol", "78.4", "carbon disulfide", "46.2", "41.3", "1.6", "5.0", "93.4" ], [ "n - propanol", "97.2", "cyclohexane", "80.8", "66.6", "8.5", "10.0", "81.5" ], [ "n - propanol", "97.2", "benzene", "80.2", "68.5", "8.6", "9.0", "82.4" ], [ "n - propanol", "97.2", "carbon tetrachloride", "76.8", "65.4", "5 u 84.9 l 1.0", "11 u 15.0 l 11.0", "84 u 0.1 l 88.0" ], [ "n - propanol", "97.2", "diethyl ketone", "102.2", "81.2", "20", "20", "60" ], [ "n - propanol", "97.2", "n - propyl acetate", "101.6", "82.2", "21.0", "19.5", "59.5" ], [ "isopropanol", "82.5", "cyclohexane", "80.8", "64.3", "7.5", "18.5", "74.0" ], [ "isopropanol", "82.5", "cyclohexane", "80.8", "66.1", "7.5", "21.5", "71.0" ], [ "isopropanol", "82.5", "benzene", "80.2degree", "66.5", "7.5", "18.7", "73.8" ], [ "isopropanol", "82.5", "benzene", "80.2degree", "65.7degree", "8.2 u 2.3 l 85.1", "19.8 u 20.2 l 14.4", "72.0 u 77.5 l 0.5" ], [ "isopropanol", "82.5", "methyl ethyl ketone", "79.6", "73.4", "11.0", "1.0", "88.0" ], [ "isopropanol", "82.5", "toluene", "110.6", "76.3", "13.1 u 8.5 l 61.0", "38.2 u 38.2 l 38.0", "48.7 u 53.3 l 1.0" ], [ "allyl alcohol", "97.0", "n - hexane", "69.0", "59.7", "5 u 0.5 l 64.4", "5 u 3.6 l 34.8", "90 u 95.9 l 0.8" ], [ "allyl alcohol", "97.0", "benzene", "80.2", "68.2", "8.6 u 0.6 l 80.9", "9.2 u 8.7 l 17.7", "82.2 u 90.7 l 0.4" ], [ "allyl alcohol", "97.0", "cyclohexane", "80.8", "66.2", "8", "11", "81" ], [ "allyl alcohol", "97.0", "carbon tetrachloride", "76.8", "65.2", "5 u 71.7 l 0.8", "11 u 25.6 l 10.1", "84 u 2.7 l 89.1" ], [ "benzene", "80.1", "acetonitrile", "82.0", "66.0", "8.2", "68.5", "23.3" ], [ "benzene", "80.1", "methyl ethyl ketone", "79.6", "68.2", "8.8 u 0.6 l 94.7", "65.1 u 71.3 l 0.1", "26.1 u 28.1 l 5.2" ], [ "methyl ethyl ketone", "79.6", "carbon tetrachloride", "76.8", "65.7", "3.0 u 94.4 l 0.1", "22.2 u 5.5 l 22.6", "74.8 u 0.1 l 77.3" ], [ "methyl ethyl ketone", "79.6", "cyclohexane", "81.0", "63.6", "5.0 u 0.6 l 89.9", "60.0 u 37.0 l 10.0", "35.0 u 62.4 l 0.1" ], [ "chloroform", "61.2", "methanol", "64.65", "52.6", "4.0 u 27.0 l 3.0", "81.0 u 32.0 l 83.0", "15.0 u 41.0 l 14.0" ], [ "chloroform", "61.2", "acetone", "56.5", "60.4", "4.0", "57.6", "38.4" ] ], "title": "", "original_id": "2dbe1ffb001a27eda365ca2ed0808141" }, { "_id": "a76db1503ef0a25aa6816d98890686cf", "header": [ "country", "preliminaries", "interview", "swimsuit", "evening gown", "average" ], "rows": [ [ "missouri", "9.26", "9.84", "9.76", "9.77", "9.79" ], [ "california", "9.18", "9.76", "9.64", "9.66", "9.69" ], [ "pennsylvania", "9.32", "9.75", "9.63", "9.54", "9.64" ], [ "texas", "9.27", "9.39", "9.74", "9.72", "9.62" ], [ "arizona", "9.25", "9.56", "9.59", "9.7", "9.62" ], [ "maryland", "9.25", "9.4", "9.73", "9.55", "9.56" ], [ "oklahoma", "9.31", "9.44", "9.57", "9.63", "9.54" ], [ "michigan", "9.13", "9.37", "9.51", "9.4", "9.42" ], [ "north dakota", "9.4", "9.15", "9.3", "9.38", "9.27" ], [ "new york", "9.21", "9.19", "9.18", "9.32", "9.23" ] ], "title": "", "original_id": "508fe9a2f4bd075bc49909fb8e4743b6" }, { "_id": "9caa8c90d5ddcdad2d41fa0a5f656c3d", "header": [ "scorer", "club", "league goals", "fa cup goals", "league cup goals", "total" ], "rows": [ [ "albert kinsey", "wrexham", "27", "1", "1", "29" ], [ "jim hall", "peterborough united", "24", "3", "1", "28" ], [ "jack howarth", "aldershot", "19", "7", "0", "26" ], [ "stuart brace", "grimsby town", "25", "0", "0", "25" ], [ "john fairbrother", "northampton town", "23", "2", "0", "25" ], [ "nigel cassidy", "scunthorpe & lindsey", "21", "4", "0", "25" ], [ "billy best", "southend", "23", "1", "0", "24" ], [ "don masson", "notts county", "23", "0", "0", "23" ], [ "dave gwyther", "swansea city", "16", "5", "1", "22" ], [ "dennis brown", "aldershot", "17", "4", "0", "21" ], [ "ernie moss", "chesterfield", "20", "0", "0", "20" ], [ "richie barker", "notts county", "19", "1", "0", "20" ], [ "peter price", "peterborough united", "16", "3", "1", "20" ], [ "kevin randall", "chesterfield", "18", "0", "0", "18" ], [ "arfon griffiths", "wrexham", "16", "2", "0", "18" ], [ "rod fletcher", "lincoln city", "16", "1", "0", "17" ], [ "smith", "wrexham", "15", "2", "0", "17" ], [ "john james", "port vale", "14", "3", "0", "17" ], [ "ken jones", "colchester united", "15", "0", "0", "15" ], [ "terry heath", "scunthorpe & lindsey", "13", "2", "0", "15" ], [ "herbie williams", "swansea city", "13", "2", "0", "15" ], [ "bill dearden", "chester", "11", "3", "1", "15" ], [ "brian gibbs", "colchester united", "14", "0", "0", "14" ], [ "ray mabbutt", "newport county", "14", "0", "0", "14" ], [ "tommy robson", "peterborough united", "12", "1", "1", "14" ], [ "bobby ross", "brentford", "13", "0", "0", "13" ], [ "mike hickman", "grimsby town", "13", "0", "0", "13" ], [ "jim fryatt", "oldham / blackburn rovers", "2 + 11", "0", "0", "13" ], [ "frank large", "northampton town", "10", "2", "1", "13" ], [ "derek draper", "chester", "12", "0", "0", "12" ], [ "david shaw", "oldham", "12", "0", "0", "12" ], [ "geoffrey thomas", "swansea city", "11", "0", "1", "12" ], [ "alan banks", "exeter city", "10", "1", "1", "12" ], [ "phil boyer", "york city", "9", "3", "0", "12" ], [ "ronnie walton", "aldershot", "11", "0", "0", "11" ], [ "alan bradshaw", "crewe alexandra", "11", "0", "0", "11" ], [ "john archer", "chesterfield", "10", "1", "0", "11" ], [ "fred binney", "exeter city / torquay united", "1 + 9", "0", "1", "11" ], [ "jim beardall", "oldham", "10", "0", "1", "11" ], [ "alan tarbuck", "chester", "8", "3", "0", "11" ], [ "roy massey", "colchester united / crewe alexandra", "5 + 2", "0", "4", "11" ], [ "jimmy melia", "aldershot", "10", "0", "0", "10" ], [ "lance robson", "hartlepool / darlington", "2 + 8", "0", "0", "10" ], [ "kevin mcmahon", "york city", "10", "0", "0", "10" ], [ "john mitten", "exeter city", "9", "1", "0", "10" ], [ "roy young", "hartlepool", "8", "2", "0", "10" ], [ "gary moore", "southend", "8", "0", "2", "10" ] ], "title": "", "original_id": "b0d1c123cc2d1124e9ef5faf9b110b34" }, { "_id": "0f5d7b460d09fcb2577bed808ce86972", "header": [ "member state", "population in millions", "population % of eu", "area km 2", "area % of eu", "pop density people / km 2" ], "rows": [ [ "european union", "494.8", "100%", "4422773", "100%", "112.0" ], [ "austria", "8.3", "1.7%", "83858", "1.9%", "99.0" ], [ "belgium", "10.5", "2.1%", "30510", "0.7%", "344.0" ], [ "bulgaria", "7.7", "1.6%", "110912", "2.5%", "70.0" ], [ "croatia", "4.3", "0.9%", "56594", "1.3%", "75.8" ], [ "cyprus", "0.8", "0.2%", "9250", "0.2%", "84.0" ], [ "czech republic", "10.3", "2.1%", "78866", "1.8%", "131.0" ], [ "denmark", "5.4", "1.1%", "43094", "1.0%", "126.0" ], [ "estonia", "1.4", "0.3%", "45226", "1.0%", "29.0" ], [ "finland", "5.3", "1.1%", "337030", "7.6%", "16.0" ], [ "france", "65.03", "13.%", "643548", "14.6%", "111.0" ], [ "germany", "80.4", "16.6%", "357021", "8.1%", "225.0" ], [ "greece", "11.1", "2.2%", "131940", "3.0%", "84.0" ], [ "hungary", "10.1", "2.0%", "93030", "2.1%", "108.0" ], [ "ireland", "4.2", "0.8%", "70280", "1.6%", "60.0" ], [ "italy", "58.8", "11.9%", "301320", "6.8%", "195.0" ], [ "latvia", "2.3", "0.5%", "64589", "1.5%", "35.0" ], [ "lithuania", "3.4", "0.7%", "65200", "1.5%", "52.0" ], [ "luxembourg", "0.5", "0.1%", "2586", "0.1%", "181.0" ], [ "malta", "0.4", "0.1%", "316", "0.0%", "1261.0" ], [ "netherlands", "16.4", "3.3%", "41526", "0.9%", "394.0" ], [ "poland", "38.1", "7.7%", "312685", "7.1%", "122.0" ], [ "portugal", "10.6", "2.1%", "92931", "2.1%", "114.0" ], [ "romania", "21.6", "4.4%", "238391", "5.4%", "91.0" ], [ "spain", "44.7", "9.0%", "504782", "11.4%", "87.0" ], [ "slovakia", "5.4", "1.1%", "48845", "1.1%", "111.0" ], [ "slovenia", "2.0", "0.4%", "20253", "0.5%", "99.0" ], [ "sweden", "9.1", "1.8%", "449964", "10.2%", "20.0" ] ], "title": "", "original_id": "3d4a4379fab0e72179a4a20199c27a18" }, { "_id": "c7c0c13003d69473d24255bd7e33f0b8", "header": [ "rank", "location", "total passengers", "annual change", "capacity", "capacity in use" ], "rows": [ [ "1", "são paulo", "32777330", "9.24%", "26000000", "126 , 06%" ], [ "2", "rio de janeiro", "17495737", "17.00%", "18000000", "97 , 19%" ], [ "3", "são paulo", "16775770", "0.11%", "12000000", "139 , 79%" ], [ "4", "brasília", "15891530", "3.20%", "10000000", "158 , 91%" ], [ "5", "belo horizonte", "10398296", "9.05%", "5000000", "207 , 96%" ], [ "6", "rio de janeiro", "9002863", "5.73%", "6000000", "150 , 04%" ], [ "7", "campinas", "8858380", "17.04%", "3500000", "253 , 09%" ], [ "8", "salvador", "8811540", "4.96%", "6000000", "146 , 85%" ], [ "9", "porto alegre", "8261355", "5.45%", "6100000", "135 , 43%" ], [ "10", "curitiba", "6828334", "2.03%", "6000000", "113 , 80%" ], [ "11", "recife", "6433410", "0.78%", "9000000", "71 , 48%" ], [ "12", "fortaleza", "5964308", "5.61%", "3000000", "198 , 80%" ], [ "13", "vitória", "3642842", "14.46%", "560000", "650 , 50%" ], [ "14", "belém", "3342771", "11.56%", "2700000", "123 , 80%" ], [ "15", "florianópolis", "3395256", "8.75%", "1100000", "308 , 65%" ], [ "16", "manaus", "3131150", "3.70%", "1800000", "173 , 95%" ], [ "17", "goinia", "3076858", "9.80%", "600000", "512 , 80%" ], [ "18", "cuiabá", "2761588", "8.25%", "1600000", "172 , 59%" ], [ "19", "natal", "2660864", "2.88%", "1500000", "177 , 39%" ], [ "20", "são luís", "1991099", "8.01%", "1010000", "197 , 13%" ], [ "21", "foz do iguaçu", "1741526", "2.96%", "1500000", "116 , 10%" ], [ "22", "maceió", "1719979", "11.02%", "1200000", "143 , 31%" ], [ "23", "campo grande", "1655073", "9.20%", "900000", "183 , 89%" ], [ "24", "aracaju", "1373401", "25.63%", "1300000", "105 , 64%" ], [ "25", "navegantes", "1277486", "9.38%", "600000", "212 , 91%" ], [ "26", "joão pessoa", "1252559", "9.64%", "860000", "145 , 62%" ], [ "27", "londrina", "1098848", "14.23%", "800000", "137 , 35%" ], [ "28", "ribeirão preto", "1077010", "3.35%", "480000", "224 , 37%" ], [ "29", "porto velho", "1050682", "6.79%", "920000", "114 , 20%" ], [ "30", "teresina", "1044865", "2.86%", "450000", "232 , 19%" ], [ "31", "uberlndia", "1011490", "11.48%", "600000", "168 , 58%" ], [ "32", "são josé do rio preto", "770569", "15.13%", "270000", "285 , 39%" ], [ "33", "belo horizonte", "774881", "2.33%", "1200000", "64 , 57%" ], [ "34", "maringá", "757719", "13.61%", "430000", "176 , 21%" ], [ "35", "palmas", "579395", "15.09%", "370000", "156 , 59%" ], [ "36", "macapá", "573560", "2.36%", "170000", "337 , 38%" ], [ "37", "ilhéus", "532130", "3.70%", "300000", "177 , 37%" ], [ "38", "santarém", "487168", "5.62%", "225000", "216 , 51%" ], [ "39", "petrolina", "458588", "23.25%", "150000", "305 , 72%" ], [ "40", "juazeiro do norte", "451087", "31.51%", "100000", "451 , 08%" ] ], "title": "", "original_id": "671f211ea1ceee8e6abf1907bbe3afb7" }, { "_id": "d827f31162e3d8da5a6c9ed939457823", "header": [ "subject", "no sat", "no passed", "% pass", "highest mark", "lowest mark", "mean" ], "rows": [ [ "english", "55", "46", "84", "100", "37", "59" ], [ "mathematics", "55", "39", "71", "83", "36", "58" ], [ "biology", "17", "17", "100", "85", "54", "72" ], [ "chemistry", "20", "16", "80", "84", "43", "64" ], [ "physics", "10", "8", "80", "79", "47", "63" ], [ "accounting", "35", "27", "77", "75", "31", "58" ], [ "economics", "35", "33", "94", "88", "33", "63" ], [ "computer studies", "25", "19", "76", "78", "35", "56" ], [ "geography", "8", "7", "88", "76", "45", "64" ], [ "introduction to technology", "3", "3", "100", "69", "50", "61" ], [ "food technology", "9", "9", "100", "80", "50", "64" ] ], "title": "", "original_id": "fde54f80bfc55153ce8d62c818c381df" }, { "_id": "d44d3f9b6575ab0c6122d0ef9dff3db2", "header": [ "episode no", "airdate", "total viewers", "share", "bbc one weekly ranking" ], "rows": [ [ "1", "8 april 2010", "6700000", "24.8%", "6" ], [ "2", "15 april 2010", "5820000", "20.8%", "11" ], [ "3", "22 april 2010", "6367000", "23.7%", "7" ], [ "4", "6 may 2010", "5901000", "22.6%", "10" ], [ "5", "13 may 2010", "6751000", "26.6%", "7" ], [ "6", "20 may 2010", "6507000", "26.2%", "7" ] ], "title": "", "original_id": "dc21011c28cb6d8b786c04c5a531dbfb" }, { "_id": "c650e7a9045d9181d06f954e7d5e8165", "header": [ "Bank", "Foundation", "# of Branches\nAs of 30 September 2012", "Total Assets (million TL)\nAs of 30 September 2012" ], "rows": [ [ "Türkiye İş Bankası", "1924", "1,294", "210,535" ], [ "Ziraat Bankası", "1863", "1,510", "207,871" ], [ "Garanti Bank", "1946", "947", "154,550" ], [ "Akbank", "1948", "963", "150,241" ], [ "Yapı ve Kredi Bankası", "1944", "949", "160,309" ], [ "Halk Bankası", "1938", "807", "116,372" ], [ "VakıfBank", "1954", "741", "135,578" ], [ "Finansbank", "1987", "530", "49,902" ], [ "Türk Ekonomi Bankası", "1927", "510", "42,505" ], [ "Denizbank", "1997", "624", "40,457" ], [ "HSBC Bank", "1990", "331", "25,797" ], [ "ING Bank", "1984", "320", "23,184" ], [ "Türk Eximbank", "1987", "2", "14,724" ], [ "Şekerbank", "1953", "272", "14,656" ], [ "İller Bankası", "1933", "19", "12,309" ], [ "Türkiye Sınai Kalkınma Bankası", "1950", "4", "9,929" ], [ "Alternatif Bank", "1992", "63", "7,904" ], [ "Citibank", "1980", "37", "7,884" ], [ "Anadolubank", "1996", "88", "7,218" ], [ "Burgan Bank", "1992", "60", "4,275" ], [ "İMKB Takas ve Saklama Bankası", "1995", "1", "3,587" ], [ "Tekstilbank", "1986", "44", "3,502" ], [ "Deutsche Bank", "1988", "1", "3,426" ], [ "Fibabanka", "1984", "27", "3,120" ], [ "Aktif Yatırım Bankası", "1999", "7", "2,997" ], [ "The Royal Bank of Scotland", "1921", "3", "2,750" ], [ "Türkiye Kalkınma Bankası", "1975", "1", "2,651" ], [ "Turkland Bank", "1991", "27", "2,649" ], [ "Arap Türk Bankası", "1977", "7", "2,147" ], [ "Merrill Lynch", "1992", "1", "1,898" ], [ "BankPozitif", "1999", "1", "1,788" ], [ "Société Générale", "1989", "16", "1,457" ], [ "Turkish Bank", "1982", "20", "837" ], [ "JPMorgan Chase", "1984", "1", "830" ], [ "Birleşik Fon Bankası", "1958", "1", "801" ], [ "Bank Mellat", "1982", "3", "729" ], [ "Portigon", "1985", "1", "279" ], [ "Nurol Yatırım Bankası", "1999", "2", "227" ], [ "Diler Yatırım Bankası", "1998", "1", "108" ], [ "GSD Yatırım Bankası", "1998", "1", "108" ], [ "Habib Bank Limited", "1983", "1", "80" ], [ "Credit Agricole", "1990", "1", "72" ], [ "Adabank", "1985", "1", "51" ], [ "Taib Yatırım Bank", "1987", "1", "18" ] ], "title": "", "original_id": "084783c5325f5e96c17f174c4bf121d9" }, { "_id": "e7ec6cce9b307aafea0f84f7d5b98993", "header": [ "rank", "company", "headquarters", "industry", "sales (billion )", "profits (billion )", "assets (billion )", "market value (billion )" ], "rows": [ [ "1", "citigroup", "usa", "banking", "146.56", "21.54", "1884.32", "247.42" ], [ "2", "bank of america", "usa", "banking", "116.57", "21.13", "1459.74", "226.61" ], [ "3", "hsbc", "uk", "banking", "121.51", "16.63", "1860.76", "202.29" ], [ "4", "general electric", "usa", "conglomerate", "163.39", "20.83", "697.24", "358.98" ], [ "5", "jpmorgan chase", "usa", "banking", "99.3", "14.44", "1351.52", "170.97" ], [ "6", "american international group", "usa", "insurance", "113.19", "14.01", "979.41", "174.47" ], [ "7", "exxonmobil", "usa", "oil and gas", "335.09", "39.5", "223.95", "410.65" ], [ "8", "royal dutch shell", "netherlands", "oil and gas", "318.85", "25.44", "232.31", "208.25" ], [ "9", "ubs", "switzerland", "diversified financials", "105.59", "9.78", "1776.89", "116.84" ], [ "10", "ing group", "netherlands", "diversified financials", "153.44", "9.65", "1615.05", "93.99" ], [ "11", "bp", "uk", "oil and gas", "265.91", "22.29", "217.6", "198.14" ], [ "12", "toyota", "japan", "automotive", "179.02", "11.68", "243.6", "217.69" ], [ "13", "the royal bank of scotland", "uk", "banking", "77.41", "12.51", "1705.35", "124.13" ], [ "14", "bnp paribas", "france", "banking", "89.16", "9.64", "1898.19", "97.03" ], [ "15", "allianz", "germany", "insurance", "125.33", "8.81", "1380.88", "87.22" ], [ "16", "berkshire hathaway", "usa", "diversified financials", "98.54", "11.02", "248.44", "163.79" ], [ "17", "walmart", "usa", "retailing", "348.65", "11.29", "151.19", "201.36" ], [ "18", "barclays", "uk", "banking", "67.71", "8.95", "1949.17", "94.79" ], [ "19", "chevron", "usa", "oil and gas", "195.34", "17.14", "132.63", "149.37" ], [ "19", "total sa", "france", "oil and gas", "175.05", "15.53", "138.82", "152.62" ] ], "title": "", "original_id": "20e1c96525644ffc2d2b4f807f0c8901" }, { "_id": "68de1e224ae93322a888d33f4ae1b9d6", "header": [ "Year", "Conservative\ncouncillors", "Labour\ncouncillors", "Independent\ncouncillors", "Liberal\ncouncillors" ], "rows": [ [ "1947", "3", "2", "18", "1" ], [ "1951", "5", "2", "17", "0" ], [ "1952", "3", "3", "18", "0" ], [ "1953", "4", "3", "17", "0" ], [ "1954", "3", "4", "17", "0" ], [ "1955", "2", "5", "17", "0" ], [ "1956", "2", "6", "16", "0" ], [ "1957", "2", "5", "17", "0" ], [ "1958", "2", "6", "16", "0" ], [ "1960", "2", "5", "16", "1" ], [ "1961", "2", "5", "15", "2" ], [ "1963", "2", "6", "12", "4" ], [ "1964", "3", "6", "11", "4" ], [ "1965", "4", "5", "11", "3" ], [ "1966", "9", "4", "6", "5" ], [ "1967", "9", "4", "9", "2" ], [ "1972", "10", "10", "3", "1" ] ], "title": "", "original_id": "cec848df4b55e22fe694af2b6fcb7632" }, { "_id": "edc3ee5fb109c03b6bbe7e7b1574c833", "header": [ "group", "half - life (s)", "decay constant (s 1 )", "yield , neutrons per fission", "fraction" ], "rows": [ [ "1", "55.72", "0.0124", "0.00052", "0.000215" ], [ "2", "22.72", "0.0305", "0.00546", "0.001424" ], [ "3", "6.22", "0.111", "0.0031", "0.001274" ], [ "4", "2.3", "0.301", "0.00624", "0.002568" ], [ "5", "0.614", "1.14", "0.00182", "0.000748" ], [ "6", "0.23", "3.01", "0.00066", "0.000273" ] ], "title": "", "original_id": "9fdf969b7c66712da4f22c788a31c120" }, { "_id": "336c12b29a70ee82c6d268d96a715b29", "header": [ "rocket", "country", "type", "launches", "successes", "failures", "partial failures" ], "rows": [ [ "ariane 5eca", "europe", "ariane 5", "6", "6", "0", "0" ], [ "atlas v 401", "united states", "atlas v", "1", "1", "0", "0" ], [ "atlas v 501", "united states", "atlas v", "2", "2", "0", "0" ], [ "atlas v 531", "united states", "atlas v", "1", "1", "0", "0" ], [ "delta ii 7420", "united states", "delta ii", "1", "1", "0", "0" ], [ "delta iv - m + (4 , 2)", "united states", "delta iv", "2", "2", "0", "0" ], [ "delta iv - h", "united states", "delta iv", "1", "1", "0", "0" ], [ "dnepr - 1", "ukraine", "dnepr", "3", "3", "0", "0" ], [ "falcon 9", "united states", "falcon 9", "2", "2", "0", "0" ], [ "gslv mk i (c)", "india", "gslv", "1", "0", "1", "0" ], [ "gslv mk ii", "india", "gslv", "1", "0", "1", "0" ], [ "h - iia 202", "japan", "h - iia", "2", "2", "0", "0" ], [ "kosmos - 3 m", "russia", "kosmos", "1", "1", "0", "0" ], [ "long march 2d", "china", "long march 2", "3", "3", "0", "0" ], [ "long march 3a", "china", "long march 3", "3", "3", "0", "0" ], [ "long march 3b", "china", "long march 3", "1", "1", "0", "0" ], [ "long march 3c", "china", "long march 3", "4", "4", "0", "0" ], [ "long march 4b", "china", "long march 4", "1", "1", "0", "0" ], [ "long march 4c", "china", "long march 4", "3", "3", "0", "0" ], [ "minotaur iv", "united states", "minotaur iv", "1", "1", "0", "0" ], [ "minotaur iv / haps", "united states", "minotaur iv", "1", "1", "0", "0" ], [ "molniya - m / 2bl", "russia", "molniya", "1", "1", "0", "0" ], [ "naro - 1", "russia south korea", "naro", "1", "0", "1", "0" ], [ "proton - m / dm - 2", "russia", "proton", "2", "2", "0", "0" ], [ "proton - m / dm - 03", "russia", "proton", "1", "0", "1", "0" ], [ "proton - m / briz - m", "russia", "proton", "9", "9", "0", "0" ], [ "pslv - ca", "india", "pslv", "1", "1", "0", "0" ], [ "rokot / briz - km", "russia", "ur - 100", "2", "2", "0", "0" ], [ "shavit - 2", "israel", "shavit", "1", "1", "0", "0" ], [ "soyuz - 2.1a / fregat", "russia", "soyuz", "2", "2", "0", "0" ], [ "soyuz - u", "russia", "soyuz", "6", "6", "0", "0" ], [ "soyuz - fg", "russia", "soyuz", "4", "4", "0", "0" ], [ "space shuttle", "united states", "space shuttle", "3", "3", "0", "0" ] ], "title": "", "original_id": "d5edf188f93efcfec0bcbc664b3b8445" }, { "_id": "8ac9929fd0baa37756444a74da8fcb1b", "header": [ "rank", "airport", "total passengers", "% change 2007 / 2008", "international passengers", "domestic passengers", "transit passengers", "aircraft movements", "freight ( metric tonnes )" ], "rows": [ [ "1", "london heathrow", "67054745", "1.5%", "61344438", "5562516", "147791", "478693", "1397054" ], [ "2", "london gatwick", "34205887", "2.9%", "30431051", "3730963", "43873", "263653", "107702" ], [ "3", "london stansted", "22360364", "6.0%", "19996947", "2343428", "19989", "193282", "197738" ], [ "4", "manchester", "21219195", "4.0%", "18119230", "2943719", "156246", "204610", "141781" ], [ "5", "london luton", "10180734", "2.6%", "8853224", "1320678", "6832", "117859", "40518" ], [ "6", "birmingham airport", "9627589", "4.3%", "8105162", "1471538", "50889", "112227", "12192" ], [ "7", "edinburgh", "9006702", "0.5%", "3711140", "5281038", "14524", "125550", "12418" ], [ "8", "glasgow international", "8178891", "7.0%", "3943139", "4192121", "43631", "100087", "3546" ], [ "9", "bristol", "6267114", "5.7%", "5057051", "1171605", "38458", "76517", "3" ], [ "10", "east midlands", "5620673", "3.8%", "4870184", "746094", "4395", "93038", "261507" ], [ "11", "liverpool", "5334152", "2.5%", "4514926", "814900", "4326", "84890", "3740" ], [ "12", "belfast international", "5262354", "0.2%", "2122844", "3099995", "39515", "77943", "36115" ], [ "13", "newcastle", "5039993", "10.8%", "3506681", "1509959", "23353", "72904", "1938" ], [ "14", "aberdeen", "3290920", "3.6%", "1470099", "1820137", "684", "119831", "4006" ], [ "15", "london city", "3260236", "12.0%", "2600731", "659494", "11", "94516", "0" ], [ "16", "leeds bradford", "2873321", "0.3%", "2282358", "578089", "12874", "61699", "334" ], [ "17", "belfast city", "2570742", "17.5%", "70516", "2500225", "1", "42990", "168" ], [ "18", "glasgow prestwick", "2415755", "0.3%", "1728020", "685999", "1736", "42708", "22966" ], [ "19", "cardiff", "1994892", "5.5%", "1565991", "412728", "16173", "37123", "1334" ] ], "title": "", "original_id": "502645e77ad3f4a83adb38da6c6168b7" }, { "_id": "055fca74fa773081880677d245347536", "header": [ "year ended", "revenue (million)", "profit / (loss) before tax (m)", "net profit (m)", "earnings per share (p)" ], "rows": [ [ "2011", "5110", "193.7", "123.8", "38.2" ], [ "2010", "4830", "225.2", "159.0", "49.1" ], [ "2009", "4649", "257.8", "148.9", "46.4" ], [ "2008", "4177", "206.9", "142.2", "44.5" ], [ "2007", "3582", "191.1", "130.1", "39.8" ], [ "2006", "3333", "189.7", "129.4", "37.8" ], [ "2005", "2924", "176.7", "124.2", "35.4" ], [ "2004", "2438", "158.2", "141.4", "30.7" ], [ "2004", "2438", "200.9", "127.4", "28.7" ], [ "2003", "2276", "194.6", "124.6", "27.4" ] ], "title": "", "original_id": "f3e0cdd74f999348fb59a6fabee6691e" }, { "_id": "d766a1d3b8a893ce87d2880399e83b1d", "header": [ "Unnamed: 0", "Average population (x 1000)", "Live births", "Deaths", "Natural change", "Crude birth rate (per 1000)", "Crude death rate (per 1000)", "Natural change (per 1000)" ], "rows": [ [ "1970", "31", "683", "356", "327", "22.0", "11.5", "10.5" ], [ "1975", "33", "706", "374", "332", "21.4", "11.3", "10.1" ], [ "1980", "35", "701", "351", "350", "20.0", "10.0", "10.0" ], [ "1985", "37", "793", "289", "504", "21.4", "7.8", "13.6" ], [ "1990", "38", "635", "342", "293", "16.9", "9.1", "7.8" ], [ "1991", "38", "623", "350", "273", "16.6", "9.3", "7.3" ], [ "1992", "37", "611", "369", "242", "16.7", "10.1", "6.6" ], [ "1993", "34", "459", "433", "26", "13.3", "12.6", "0.8" ], [ "1994", "32", "433", "460", "- 27", "13.5", "14.3", "-0.8" ], [ "1995", "31", "382", "481", "- 99", "12.5", "15.8", "-3.2" ], [ "1996", "29", "374", "436", "- 62", "12.7", "14.8", "-2.1" ], [ "1997", "29", "373", "400", "- 27", "13.0", "13.9", "-0.9" ], [ "1998", "28", "396", "355", "41", "14.2", "12.7", "1.5" ], [ "1999", "27", "319", "397", "- 78", "11.8", "14.7", "-2.9" ], [ "2000", "26", "289", "391", "- 102", "11.0", "14.9", "-3.9" ], [ "2001", "26", "298", "390", "- 92", "11.6", "15.1", "-3.6" ], [ "2002", "25", "310", "376", "- 66", "12.3", "14.9", "-2.6" ], [ "2003", "24", "268", "462", "- 194", "11.0", "19.0", "-8.0" ], [ "2004", "24", "339", "463", "- 124", "14.4", "19.7", "-5.3" ], [ "2005", "23", "294", "466", "- 172", "12.9", "20.5", "-7.6" ], [ "2006", "22", "270", "366", "- 96", "12.3", "16.7", "-4.4" ], [ "2007", "21", "280", "351", "- 71", "13.2", "16.5", "-3.3" ], [ "2008", "20", "267", "368", "- 101", "13.0", "18.0", "-4.9" ], [ "2009", "20", "268", "365", "- 97", "13.6", "18.5", "-4.9" ], [ "2010", "19", "233", "397", "- 164", "12.3", "20.9", "-8.7" ] ], "title": "", "original_id": "ea9cf61bd99a190e303a617ba0abb869" }, { "_id": "5d5d877c6bc389d51f3dfc6b2e4c15ba", "header": [ "commune", "area (km 2 )", "2002 population", "pop density (km 2 )", "municipality website" ], "rows": [ [ "santiago (capital)", "22.4", "200792", "8963.9", "link" ], [ "vitacura", "28.3", "81499", "2879.8", "link" ], [ "san ramón", "6.5", "94906", "14600.9", "link" ], [ "san miguel", "9.5", "78872", "8302.3", "link" ], [ "san joaquín", "9.7", "97625", "10064.4", "link" ], [ "renca", "24.2", "133518", "5517.3", "link" ], [ "recoleta", "16.2", "148220", "9149.4", "link" ], [ "quinta normal", "12.4", "104012", "8388.1", "link" ], [ "quilicura", "57.5", "126518", "2200.3", "link" ], [ "pudahuel", "197.4", "195653", "991.1", "link" ], [ "providencia", "14.4", "120874", "8394.0", "link" ], [ "peñalolén", "54.2", "216060", "3986.3", "link" ], [ "pedro aguirre cerda", "9.7", "114560", "11810.3", "link" ], [ "ñuñoa", "16.9", "163511", "9675.2", "link" ], [ "maipú", "133.0", "468390", "3521.7", "link" ], [ "macul", "12.9", "112535", "8723.6", "link" ], [ "lo prado", "6.7", "104316", "15569.6", "link" ], [ "lo espejo", "7.2", "112800", "15666.7", "link" ], [ "lo barnechea", "1023.7", "74749", "73.0", "link" ], [ "las condes", "99.4", "249893", "2514.0", "link" ], [ "la reina", "23.4", "96762", "4135.1", "link" ], [ "la pintana", "30.6", "190085", "6211.9", "link" ], [ "la granja", "10.1", "132520", "13120.8", "link" ], [ "la florida", "70.8", "365674", "5164.9", "link" ], [ "la cisterna", "10.0", "85118", "8511.8", "link" ], [ "independencia", "7.4", "65479", "8848.5", "link" ], [ "huechuraba", "44.8", "74070", "1653.3", "link" ], [ "estación central", "14.1", "130394", "9247.8", "link" ], [ "el bosque", "14.1", "175594", "12453.5", "link" ], [ "conchalí", "70.7", "133256", "1884.8", "link" ], [ "cerro navia", "11.1", "148312", "13361.4", "link" ] ], "title": "", "original_id": "2c1aa2f249ca6fdf4a7fe2f47b3bd53c" }, { "_id": "0bf74c06a629e346db7d2de3a73d149b", "header": [ "country", "tourist arrivals (2011) (millions)", "tourism receipts (2011) (millions of us)", "tourism receipts (2011) (us per arrival)", "tourism receipts (2011) (us per capita)", "tourism receipts (2003) (as % of gdp)", "tourism receipts (2003) (as % of exports)", "tourism competitiveness (2011) (ttci)" ], "rows": [ [ "argentina", "5.663", "5353", "945", "133", "7.4", "1.8", "4.20" ], [ "bolivia", "0.807", "310", "384", "31", "9.4", "2.2", "3.35" ], [ "brazil", "5.433", "6555", "1207", "34", "3.2", "0.5", "4.36" ], [ "chile", "3.07", "1831", "596", "107", "5.3", "1.9", "4.27" ], [ "colombia", "4.356", "4061", "873", "45", "6.6", "1.4", "3.94" ], [ "costa rica", "2.196", "2156", "982", "459", "17.5", "8.1", "4.43" ], [ "cuba", "2.507", "2187", "872", "194", "n / a", "n / a", "n / a" ], [ "dominican republic", "4.306", "4353", "1011", "440", "36.2", "18.8", "3.99" ], [ "ecuador", "1.141", "837", "734", "58", "6.3", "1.5", "3.79" ], [ "el salvador", "1.184", "415", "351", "67", "12.9", "3.4", "3.68" ], [ "guatemala", "1.225", "1350", "1102", "94", "16.0", "2.6", "3.82" ], [ "haiti", "0.255", "167", "655", "17", "19.4", "3.2", "n / a" ], [ "honduras", "0.931", "701", "753", "92", "13.5", "5.0", "3.79" ], [ "mexico", "23.403", "11869", "507", "105", "5.7", "1.6", "4.43" ], [ "nicaragua", "1.06", "377", "356", "65", "15.5", "3.7", "3.56" ], [ "panama", "2.06", "1926", "1308", "550", "10.6", "6.3", "4.30" ], [ "paraguay", "0.524", "241", "460", "37", "4.2", "1.3", "3.26" ], [ "peru", "2.598", "2360", "908", "81", "9.0", "1.6", "4.04" ], [ "uruguay", "2.857", "2187", "765", "643", "14.2", "3.6", "4.24" ], [ "venezuela", "0.51", "739", "1449", "25", "1.3", "0.4", "3.46" ] ], "title": "", "original_id": "af979ad2c02be83e2c8dd7babeec312d" }, { "_id": "7624274d56083ae7c99730321ff9deb3", "header": [ "name", "municipal status", "census division", "population (2011)", "population (2006)", "change (%)", "area (km square)", "population density" ], "rows": [ [ "barrie", "single - tier", "simcoe", "136063", "128430", "5.9", "77.39", "1758.1" ], [ "belleville", "single - tier", "hastings", "49454", "48821", "1.3", "247.21", "200.0" ], [ "brampton brampton is canada 's ninth - largest city", "lower - tier", "peel", "523911", "433806", "20.8", "266.34", "1967.1" ], [ "brant", "single - tier", "brant", "35638", "34415", "3.6", "843.29", "42.3" ], [ "brockville", "single - tier", "leeds and grenville", "21870", "21957", "- 0.4", "20.9", "1046.2" ], [ "burlington", "lower - tier", "halton", "175779", "164415", "6.9", "185.66", "946.8" ], [ "clarence - rockland", "lower - tier", "prescott and russell", "23185", "20790", "11.5", "297.86", "77.8" ], [ "cornwall", "single - tier", "stormont , dundas and glengarry", "46340", "45965", "0.8", "61.52", "753.2" ], [ "elliot lake", "single - tier", "algoma", "11348", "11549", "- 1.7", "714.56", "15.9" ], [ "haldimand county", "single - tier", "haldimand", "44876", "45212", "- 0.7", "1251.57", "35.9" ], [ "kawartha lakes", "single - tier", "kawartha lakes", "73214", "74561", "- 1.8", "3083.06", "23.7" ], [ "kenora", "single - tier", "kenora", "15348", "15177", "1.1", "211.75", "72.5" ], [ "norfolk county", "single - tier", "norfolk", "63175", "62563", "1", "1607.6", "39.3" ], [ "north bay", "single - tier", "nipissing", "53651", "53966", "- 0.6", "319.05", "168.2" ], [ "orillia", "single - tier", "simcoe", "30586", "30259", "1.1", "28.61", "1069.2" ], [ "owen sound", "lower - tier", "grey", "21688", "21753", "- 0.3", "24.22", "895.5" ], [ "pickering", "lower - tier", "durham", "88721", "87838", "1", "231.59", "383.1" ], [ "port colborne", "lower - tier", "niagara", "18424", "18599", "- 0.9", "121.97", "151.1" ], [ "prince edward county", "single - tier", "prince edward", "25258", "25496", "- 0.9", "1050.45", "24.0" ], [ "quinte west", "single - tier", "hastings", "43086", "42697", "0.9", "494.15", "87.2" ], [ "sarnia", "lower - tier", "lambton", "72366", "71419", "1.3", "164.71", "439.4" ], [ "sault ste marie", "single - tier", "algoma", "75141", "74948", "0.3", "223.26", "336.6" ], [ "st thomas", "single - tier", "elgin", "37905", "36110", "5", "35.52", "1067.3" ], [ "stratford", "single - tier", "perth", "30886", "30516", "1.2", "26.95", "1146.0" ], [ "temiskaming shores", "single - tier", "timiskaming", "10400", "10442", "- 0.4", "177.91", "58.5" ], [ "thorold", "lower - tier", "niagara", "17931", "18224", "- 1.6", "83.0", "216.0" ], [ "timmins", "single - tier", "cochrane", "43165", "42997", "0.4", "2979.15", "14.5" ], [ "vaughan", "lower - tier", "york", "288301", "238866", "20.7", "273.52", "1054.0" ], [ "welland", "lower - tier", "niagara", "50631", "50331", "0.6", "81.09", "624.4" ], [ "woodstock", "lower - tier", "oxford", "37754", "35822", "5.4", "49.0", "770.5" ] ], "title": "", "original_id": "f039bcce7051c77924a8e9b2775e23c4" }, { "_id": "602595cf88b2a12fa6c6b9cc3a566a44", "header": [ "region", "land area (km 2 )", "rainfall by depth (mm / year)", "rainfall by volume (km 3 / year)", "surface run off (km 3 / year)", "infiltration (km 3 / year)", "evapotranspiration (km 3 / year)" ], "rows": [ [ "chorotega", "9552.4", "2006", "19.2", "5.7", "3.5", "10.3" ], [ "huetar norte", "9001.5", "3527", "31.8", "14.9", "9.6", "7.5" ], [ "huetar atlántico", "9688.5", "3933", "38.1", "17.6", "9.3", "11.1" ], [ "pacífico central", "4722.9", "2801", "13.2", "5.2", "2.2", "4.9" ], [ "central", "8543.2", "3461", "29.6", "13.0", "7.0", "8.6" ], [ "brunca", "9294.5", "3809", "35.4", "18.6", "5.6", "12.2" ] ], "title": "", "original_id": "4a9ffbf9e8babf2558133ff3ffa87d19" }, { "_id": "bbfb01739f742b3008669ff46c05468b", "header": [ "season", "season premiere", "season finale", "tv season", "rank", "viewers (in millions)" ], "rows": [ [ "1", "september 23 , 1995", "may 22 , 1996", "1995 - 1996", "79", "11.56" ], [ "2", "january 3 , 1997", "april 18 , 1997", "1996 - 1997", "68", "11.8" ], [ "3", "september 23 , 1997", "may 19 , 1998", "1997 - 1998", "36", "12.9" ], [ "4", "september 22 , 1998", "may 25 , 1999", "1998 - 1999", "17", "14.2" ], [ "5", "september 21 , 1999", "may 23 , 2000", "1999 - 2000", "25", "14.07" ], [ "6", "october 3 , 2000", "may 22 , 2001", "2000 - 2001", "26", "14.6" ], [ "7", "september 25 , 2001", "may 21 , 2002", "2001 - 2002", "15", "14.8" ], [ "8", "september 24 , 2002", "may 20 , 2003", "2002 - 2003", "26", "12.97" ], [ "9", "september 26 , 2003", "may 21 , 2004", "2003 - 2004", "37", "10.8" ] ], "title": "", "original_id": "7cc8b2834fad4efc63736b5d45f4617d" }, { "_id": "467e6439489065bc3ede668faf623099", "header": [ "annual ridership (2012)", "rider per mile", "opened", "stations", "lines" ], "rows": [ [ "2544892400", "37613", "1904", "468", "24" ], [ "280904200", "9227", "1976", "86", "5" ], [ "231154300", "7095", "1892", "145", "8" ], [ "165028800", "13982", "1897", "53", "3" ], [ "123219300", "4056", "1972", "44", "5" ], [ "98171300", "9172", "1907", "74", "3" ], [ "70548400", "18123", "1908", "13", "4" ], [ "70506800", "4594", "1979", "38", "4" ], [ "48703700", "9115", "1993", "16", "2" ], [ "19242800", "2904", "1984", "23", "2" ], [ "15399400", "3871", "1983", "14", "1" ], [ "11023500", "3794", "2004", "16", "1" ], [ "10619900", "2606", "1936", "13", "1" ], [ "6239900", "881", "1955", "18", "1" ], [ "4445100", "1071", "1860", "22", "1" ] ], "title": "", "original_id": "b068e116439a5805a7d328e24829a00e" }, { "_id": "46b0f529103809ad08a3bc5a1bf2f704", "header": [ "type", "numbers", "year built", "quantity built", "power (horsepower)", "max speed (km / h)" ], "rows": [ [ "rhn", "1011 - 1048 (power cars) 11 - 48 (trailer cars)", "1967", "38 + 38", "220", "90" ], [ "rts", "d9 - d16 (power cars) ts4 - ts7 (center / trailer cars)", "1971", "8 + 4", "220", "70" ], [ "thn", "1101 - 1140", "1983", "40", "235", "105" ], [ "nkf", "1201 - 1264 , (center) 2101 - 2112", "1985", "64 + 12", "235", "105" ], [ "asr ( class 158 express sprinter )", "2501 - 2512 , (center) 2113 - 2120", "1991", "12 + 8", "285", "120" ], [ "apd 20", "2513 - 2524 (center) 2121 - 2128", "1995", "10 + 8", "298", "120" ], [ "apd 60", "2525 - 2544", "1996", "20 + 40", "298", "120" ] ], "title": "", "original_id": "e41eb9209114381d9de98dc4c249ed76" }, { "_id": "3cc8273ccf0a4f15c573cd0294425731", "header": [ "season", "series", "team", "races", "wins", "poles", "laps", "podiums", "points", "position" ], "rows": [ [ "2008", "adac formel masters", "team abt sportsline", "16", "0", "1", "1", "3", "91.0", "8th" ], [ "2009", "adac formel masters", "team abt sportsline", "16", "8", "7", "3", "10", "224.0", "1st" ], [ "2010", "german formula three", "van amersfoort racing", "18", "2", "6", "5", "10", "112.0", "2nd" ], [ "2011", "formula 3 euro series", "signature", "27", "0", "0", "1", "4", "150.0", "7th" ], [ "2012", "gp3 series", "lotus gp", "16", "2", "1", "0", "7", "149.5", "2nd" ], [ "2012", "formula renault 3.5 series", "tech 1 racing", "4", "0", "0", "0", "0", "0.0", "34th" ] ], "title": "", "original_id": "f34a3a13b56566338cc4338ae502c668" }, { "_id": "c812df0f82d991b5e640047cfda6b089", "header": [ "Province", "DC", "PSDI", "PSI", "PCI" ], "rows": [ [ "Verona", "53.4", "4.7", "18.2", "10.8" ], [ "Vicenza", "62.2", "4.4", "9.2", "9.4" ], [ "Padua", "59.6", "4.0", "11.1", "14.2" ], [ "Treviso", "59.9", "8.0", "11.9", "8.6" ], [ "Belluno", "53.7", "12.3", "11.3", "11.6" ], [ "Venice", "43.2", "6.0", "21.6", "19.7" ], [ "Rovigo", "39.6", "4.6", "19.8", "28.2" ], [ "Veneto", "53.4", "5.6", "14.6", "14.2" ] ], "title": "", "original_id": "a728f926b6fe622a13dedab334d8c0ed" }, { "_id": "2992664cb93ee94d79e17b8cb3d509de", "header": [ "State", "Swimsuit", "Interview", "Evening Gown", "Average", "Finalists" ], "rows": [ [ "Iowa", "9.267", "9.651", "9.62", "9.513", "9.8" ], [ "Oklahoma", "9.226", "9.309", "9.487", "9.341", "9.586" ], [ "Kansas", "9.221", "9.6", "9.6", "9.474", "9.486" ], [ "Alabama", "9.01", "9.326", "9.449", "9.262", "9.471" ], [ "North Carolina", "9.079", "9.207", "9.5", "9.262", "9.414" ], [ "California", "9.34", "9.514", "9.486", "9.447", "9.4" ], [ "Rhode Island", "9.087", "9.279", "9.341", "9.235", null ], [ "Maryland", "9.021", "9.206", "9.271", "9.166", null ], [ "Indiana", "8.966", "9.103", "9.37", "9.146", null ], [ "Virginia", "8.984", "9.112", "9.279", "9.125", null ], [ "Mississippi", "8.917", "9.2", "9.247", "9.121", null ], [ "Illinois", "8.897", "8.969", "9.286", "9.05", null ] ], "title": "", "original_id": "0bee2233eca7e83249d4dc7f850f47f8" }, { "_id": "044ad1f01d197812af7d2338fdb04e46", "header": [ "lga name", "area (km 2 )", "census 2006 population", "administrative capital", "postal code" ], "rows": [ [ "port harcourt", "109", "541115", "port harcourt", "500" ], [ "obio - akpor", "260", "464789", "rumuodumaya", "500" ], [ "okrika", "222", "222026", "okrika", "500" ], [ "ogu / bolo", "89", "74683", "ogu", "500" ], [ "eleme", "138", "190884", "eleme", "501" ], [ "tai", "159", "117797", "sakpenwa", "501" ], [ "gokana", "126", "228828", "kpor", "501" ], [ "khana", "560", "294217", "bori", "502" ], [ "oyigbo", "248", "122687", "afam", "502" ], [ "opobo / nkoro", "130", "151511", "opobo town", "503" ], [ "andoni", "233", "211009", "ngo", "503" ], [ "bonny", "642", "215358", "bonny", "503" ], [ "degema", "1011", "249773", "degema", "504" ], [ "asari - toru", "113", "220100", "buguma", "504" ], [ "akuku - toru", "1443", "156006", "abonnema", "504" ], [ "abua / odual", "704", "282988", "abua", "510" ], [ "ahoada west", "403", "249425", "akinima", "510" ], [ "ahoada east", "341", "166747", "ahoada", "510" ], [ "ogba / egbema / ndoni", "969", "284010", "omuku", "510" ], [ "emohua", "831", "201901", "emohua", "511" ], [ "ikwerre", "655", "189726", "isiokpo", "511" ], [ "etche", "805", "249454", "okehi", "512" ] ], "title": "", "original_id": "ebfb7f83b151375b826603749c259ed6" }, { "_id": "e9781e88e087675f7a5f33e643512a4e", "header": [ "year ended", "passengers flown", "employees (average / year)", "net profit / loss (sek)", "basic eps (sek)" ], "rows": [ [ "2010", "25200000", "14801", "- 2218000000", "- 7.79" ], [ "2009", "24900000", "18786", "- 2947000000", "- 18.20" ], [ "2008", "29000000", "24635", "- 6360000000", "- 6.29" ], [ "2007", "29200000", "26538", "1234000000", "3.87" ], [ "2006", "38609000", "26554", "4936000000", "28.10" ], [ "2005", "36312000", "32363", "418000000", "1.06" ], [ "2004", "32400000", "32481", "- 1813000000", "- 11.38" ], [ "2003", "31004000", "34544", "- 2221000000", "- 8.60" ], [ "2002", "33254000", "35506", "- 736000000", "- 0.81" ], [ "2001", "35640000", "31035", "- 1140000000", "- 6.58" ], [ "2000", "23240000", "30939", "2273000000", "11.79" ], [ "1999", "21991000", "30310", "1846000000", "8.41" ] ], "title": "", "original_id": "42d1e8631647f00f264fa84a37b4e899" }, { "_id": "4b7598ebaa178b56fcad4550545c72be", "header": [ "year", "competition", "location", "event", "final - rank", "final - score", "qualifying rank", "qualifying score" ], "rows": [ [ "2008", "2008 summer olympics", "beijing", "team", "2", "186.525", "2", "246.8" ], [ "2008", "2008 summer olympics", "beijing", "uneven bars", "dnq", "n / a", "23", "14.8" ], [ "2008", "olympic trials", "philadelphia", "all around", "4", "61.850", "4", "61.4" ], [ "2008", "olympic trials", "philadelphia", "balance beam", "4", "15.550", "4", "15.8" ], [ "2008", "olympic trials", "philadelphia", "floor exercise", "2", "15.500", "3", "15.65" ], [ "2008", "olympic trials", "philadelphia", "uneven bars", "6", "15.200", "5", "15.3" ], [ "2008", "olympic trials", "philadelphia", "vault", "4", "15.150", "3", "15.1" ], [ "2008", "us championships", "boston", "all around", "4", "61.250", "4", "60.75" ], [ "2008", "us championships", "boston", "balance beam", "5", "16.000", "5", "15.4" ], [ "2008", "us championships", "boston", "floor exercise", "10", "14.750", "4", "15.2" ], [ "2008", "us championships", "boston", "uneven bars", "6", "15.550", "6", "15.15" ] ], "title": "", "original_id": "485cc8d1dba2799b064e4b40e6294bd8" }, { "_id": "4005f2e626bfb4915e4147160c038818", "header": [ "region", "capital", "area (km square)", "area (sq mi)", "population" ], "rows": [ [ "abruzzo", "l'aquila", "10763", "4156", "1342177" ], [ "aosta valley", "aosta", "3263", "1260", "128129" ], [ "apulia", "bari", "19358", "7474", "4090577" ], [ "basilicata", "potenza", "9995", "3859", "587680" ], [ "calabria", "catanzaro", "15080", "5822", "2011537" ], [ "campania", "naples", "13590", "5247", "5833131" ], [ "emilia - romagna", "bologna", "22446", "8666", "4429766" ], [ "friuli - venezia giulia", "trieste", "7858", "3034", "1235761" ], [ "lazio", "rome", "17236", "6655", "5724365" ], [ "liguria", "genoa", "5422", "2093", "1616993" ], [ "lombardy", "milan", "23844", "9206", "9909348" ], [ "marche", "ancona", "9366", "3616", "1564886" ], [ "molise", "campobasso", "4438", "1713", "319834" ], [ "piedmont", "turin", "25402", "9808", "4456532" ], [ "sardinia", "cagliari", "24090", "9301", "1675286" ], [ "sicily", "palermo", "25711", "9927", "5050486" ], [ "tuscany", "florence", "22993", "8878", "3749074" ], [ "trentino - alto adige / südtirol", "trento", "13607", "5254", "1036639" ], [ "umbria", "perugia", "8456", "3265", "906675" ] ], "title": "", "original_id": "25f235b2c12daacbafcf8299558bb29f" }, { "_id": "432439ecc56369fc3342c1cebe820281", "header": [ "election", "of candidates nominated", "of seats won", "of total votes", "% of popular vote" ], "rows": [ [ "1984", "60", "0", "26921", "0.21%" ], [ "1988", "68", "0", "47228", "0.36%" ], [ "1993", "79", "0", "32979", "0.24%" ], [ "1997", "79", "0", "55583", "0.43%" ], [ "2000", "111", "0", "104402", "0.81%" ], [ "2004", "308", "0", "582247", "4.32%" ], [ "2006", "308", "0", "665940", "4.48%" ], [ "2008", "303", "0", "941097", "6.80%" ] ], "title": "", "original_id": "82326e0b5694b7754ab781cca80298e4" }, { "_id": "b0af1a8f390273fa1efb6393c7401dbc", "header": [ "position", "team", "played", "wins", "draws", "losses", "scored", "conceded", "points" ], "rows": [ [ "1", "olimpia", "9", "4", "4", "1", "14", "6", "16" ], [ "2", "12 de octubre", "9", "3", "6", "0", "14", "8", "15" ], [ "3", "cerro porteño", "9", "3", "5", "1", "16", "10", "14" ], [ "4", "guaraní", "9", "3", "5", "1", "8", "6", "14" ], [ "5", "cerro corá", "9", "3", "4", "2", "9", "8", "13" ], [ "6", "atl colegiales", "9", "3", "4", "2", "9", "9", "13" ], [ "7", "sol de américa", "9", "2", "5", "2", "11", "10", "11" ], [ "8", "san lorenzo", "9", "3", "1", "5", "13", "18", "10" ], [ "9", "universal", "9", "1", "3", "5", "9", "17", "6" ] ], "title": "", "original_id": "afe4150d5541286e91c8fabe0b055b73" }, { "_id": "9fe7646cdb5fa16db06aa5a7c8e4a6d4", "header": [ "rank", "railway station", "annual entry / exit (millions) 2011 - 12", "annual interchanges (millions) 2011 - 12", "total passengers (millions) 2011 - 12", "location", "number of platforms" ], "rows": [ [ "1", "london waterloo", "94.046", "9.489", "103.534", "london", "19" ], [ "2", "london victoria", "76.231", "9.157", "85.38", "london", "19" ], [ "3", "london bridge", "52.634", "8.742", "61.376", "london", "12" ], [ "4", "london liverpool street", "57.107", "2.353", "59.46", "london", "18" ], [ "5", "clapham junction", "21.918", "21.61", "43.528", "london", "17" ], [ "6", "london euston", "36.609", "3.832", "40.44", "london", "18" ], [ "7", "london charing cross", "38.005", "1.99", "39.995", "london", "6" ], [ "8", "london paddington", "33.737", "2.678", "36.414", "london", "14" ], [ "9", "birmingham new street", "31.214", "5.118", "36.331", "birmingham", "13" ], [ "10", "london king 's cross", "27.875", "3.022", "30.896", "london", "12" ], [ "11", "glasgow central", "26.639", "3.018", "29.658", "glasgow", "17" ], [ "12", "leeds", "25.02", "2.639", "27.659", "leeds", "17" ], [ "13", "east croydon", "20.551", "6.341", "26.892", "london", "6" ], [ "14", "london st pancras", "22.996", "3.676", "26.672", "london", "15" ], [ "15", "stratford", "21.797", "2.064", "23.862", "london", "15" ], [ "16", "edinburgh waverley", "22.585", "1.143", "23.728", "edinburgh", "18" ], [ "17", "glasgow queen street", "20.93", "1.56", "22.489", "glasgow", "9" ], [ "18", "manchester piccadilly", "18.585", "3.796", "22.381", "manchester", "14" ], [ "19", "london cannon street", "20.152", "0.441", "20.593", "london", "7" ], [ "20", "wimbledon", "18.246", "1.591", "19.836", "london", "10" ], [ "21", "reading", "15.276", "3.794", "19.07", "reading", "15" ], [ "22", "vauxhall", "18.158", "0.0", "18.158", "london", "8" ], [ "23", "brighton", "16.051", "1.859", "17.91", "brighton", "8" ], [ "24", "london fenchurch street", "17.021", "0.345", "17.366", "london", "4" ], [ "25", "gatwick airport", "14.758", "1.115", "15.873", "gatwick airport", "6" ], [ "26", "london marylebone", "14.41", "0.439", "14.849", "london", "6" ], [ "27", "liverpool central", "14.209", "0.412", "14.622", "liverpool", "3" ], [ "28", "liverpool lime street", "13.835", "0.778", "14.613", "liverpool", "10" ], [ "29", "london blackfriars", "12.79", "1.059", "13.85", "london", "4" ], [ "30", "highbury and islington", "11.801", "1.971", "13.772", "london", "8" ] ], "title": "", "original_id": "ad74d81ab4aa956a6be905809321e014" }, { "_id": "fc17b66219dfa477635a3453c66ac047", "header": [ "name", "innings", "runs scored", "balls faced", "average", "sr" ], "rows": [ [ "adam gilchrist (wk)", "8", "313", "318", "39.13", "98.43" ], [ "matthew hayden", "6", "161", "231", "26.83", "69.7" ], [ "ricky ponting (c)", "8", "189", "256", "23.63", "73.83" ], [ "michael clarke", "7", "293", "416", "48.83", "70.43" ], [ "andrew symonds", "8", "100", "125", "14.29", "80.0" ], [ "michael hussey", "7", "189", "283", "47.25", "66.78" ], [ "james hopes", "7", "115", "125", "16.43", "92.0" ], [ "brett lee", "5", "49", "102", "12.25", "48.04" ], [ "mitchell johnson", "5", "21", "44", "7.0", "47.73" ], [ "nathan bracken", "4", "16", "43", "5.33", "37.21" ], [ "stuart clark", "2", "8", "10", "8.0", "80.0" ], [ "brad haddin", "2", "12", "44", "6.0", "27.27" ], [ "brad hogg", "4", "62", "100", "15.5", "62.0" ] ], "title": "", "original_id": "b6117222265436180797b4690779708c" }, { "_id": "6127207cab8109307eaf0a5294fa3b67", "header": [ "member countries", "population", "area (km square)", "gdp (billion us)", "gdp per capita (us)" ], "rows": [ [ "denmark", "5021861", "43094", "70.032", "59928" ], [ "ireland", "3073200", "70273", "21.103", "39638" ], [ "united kingdom", "56210000", "244820", "675.941", "36728" ], [ "accession countries", "64305061", "358187", "767.076", "11929" ], [ "existing members (1973)", "192457106", "1299536", "2381396", "12374" ], [ "ec9 (1973)", "256762167 ( + 33.41%)", "1657723 ( + 25.44%)", "3148.472 ( + 32.21%)", "12262 (0.91%)" ] ], "title": "", "original_id": "3c41ec8ccc63a0ad8bac5638db8b4721" }, { "_id": "2ebe5b2394d98693af8bb4342c0d0f21", "header": [ "Fiscal Year", "Total External Debt in Million of US Dollars ($)", "Total Debt Service in Million of US Dollars ($)", "External Debt to GDP Ratio (%)", "Debt Service Ratio (%)" ], "rows": [ [ "1999", "51,157", "6,583", "61.6", "14.6" ], [ "2000", "51,358", "6,268", "63.4", "13.0" ], [ "2001", "52,047", "6,536", "68.2", "15.7" ], [ "2002", "53,802", "7,765", "66.1", "17.1" ], [ "2003", "57,567", "7,951", "68.6", "16.9" ], [ "2004", "55,027", "7,220", "60.2", "13.8" ], [ "2005", "61,555", "7,499", "59.7", "16.2" ], [ "2006", "61,372", "7,530", "50.2", "13.0" ], [ "2007", "66,508", "6,993", "44.5", "10.7" ], [ "2008", "65,228", "7,042", "37.6", "10.5" ], [ "2009", "64,738", "6,880", "38.4", "11.0" ], [ "2010", "73,594", "7,402", "36.9", "9.9" ], [ "2011", "75,569", "7,793", "33.7", "9.9" ], [ "2012", "79,949", "6,604", "32.0", "7.3" ], [ "2013", "78,489", "7,535", "28.9", "8.2" ], [ "2014", "77,674", "6,318", "27.3", "6.2" ], [ "2015", "77,474", "5,584", "26.5", "-" ], [ "2016", "74,763", "7,188", "24.5", "-" ], [ "2017", "73,098", "7,323", "23.3", "-" ], [ "2018", "76,415", "5,884", "23.5", "-" ] ], "title": "", "original_id": "8b7423e214d1e60f3bb63d2a0328faf6" }, { "_id": "a86edb7acbd9025ef7523bcfd63c722f", "header": [ "autonomous community", "hydroelectric power", "wind power", "solar power", "biomass power", "solid waste power", "total renewable generation", "total electricity demand", "% renewable of total electricity demand" ], "rows": [ [ "castile and leã cubicn", "6960", "3840", "14", "274", "87", "11175", "15793", "70.8%" ], [ "galicia", "7561", "5970", "1", "242", "317", "14091", "20279", "69.5%" ], [ "la rioja", "124", "897", "1", "3", "2", "1027", "1860", "55.2%" ], [ "aragã cubicn", "3073", "3342", "1", "63", "8", "6487", "11885", "54.6%" ], [ "navarre", "379", "2248", "28", "269", "0", "2924", "5401", "54.1%" ], [ "extremadura", "2244", "0", "1", "0", "0", "2245", "5076", "44.2%" ], [ "castile - la mancha", "710", "3935", "8", "99", "34", "4786", "12686", "37.7%" ], [ "asturias", "1680", "357", "0", "221", "400", "2658", "12391", "21.5%" ], [ "cantabria", "875", "0", "0", "11", "41", "927", "5693", "16.3%" ], [ "catalonia", "3223", "301", "7", "77", "241", "3849", "48498", "7.9%" ], [ "andalusia", "946", "1042", "5", "728", "0", "2721", "40737", "6.7%" ], [ "basque country", "336", "339", "3", "55", "326", "1059", "20934", "5.1%" ], [ "valencia", "1041", "266", "13", "55", "0", "1375", "27668", "5.0%" ], [ "canary islands", "0", "288", "0", "0", "0", "288", "9372", "3.1%" ], [ "balearic islands", "0", "5", "0", "0", "133", "138", "6235", "2.2%" ], [ "murcia", "65", "93", "6", "12", "0", "176", "8334", "2.1%" ], [ "madrid", "83", "0", "8", "58", "330", "479", "30598", "1.6%" ], [ "ceuta & melilla", "0", "0", "0", "0", "2", "2", "391", "0.5%" ] ], "title": "", "original_id": "17d8fd87a89dd0f3f9d6a827bc20df42" }, { "_id": "ba8527fd64c864468fd258456bec5da6", "header": [ "player", "tackles", "solo", "assisted", "sack", "yards", "td 's" ], "rows": [ [ "rex motes", "26.0", "24", "4", "0", "0", "0" ], [ "nathan creer", "25.5", "24", "3", "0", "0", "0" ], [ "walter holman", "21.0", "17", "8", "2", "3", "0" ], [ "pete stubbs", "19.5", "18", "3", "3", "0", "0" ], [ "michael witteck", "16.0", "14", "4", "2", "0", "0" ], [ "jon roehlk", "15.0", "11", "8", "6", "0", "0" ], [ "dwayne dixon", "13.0", "12", "2", "0", "0", "0" ], [ "sean mcinerney", "9.0", "8", "2", "3", "0", "0" ], [ "robert goins", "9.0", "9", "0", "0", "0", "0" ], [ "richard dupree", "8.5", "6", "5", "0", "0", "0" ], [ "brett wilson", "8.0", "7", "2", "0", "0", "0" ], [ "wes walton", "7.0", "4", "6", "2", "0", "0" ], [ "fernando mcwherter", "5.0", "5", "0", "0", "0", "0" ], [ "mike calhoun", "3.0", "2", "2", "3", "0", "0" ], [ "kendall walls", "2.0", "2", "0", "0", "0", "0" ], [ "steve griffin", "1.0", "1", "0", "0", "0", "0" ] ], "title": "", "original_id": "73cb636df01548c38396262253f15f4f" }, { "_id": "5c036b98095d07d528f24cfaa8dd6c09", "header": [ "name", "team", "laps", "grid", "points" ], "rows": [ [ "lee holdsworth", "garry rogers motorsport", "46", "4", "24" ], [ "garth tander", "toll hsv dealer team", "46", "19", "20" ], [ "russell ingall", "stone brothers racing", "46", "9", "17" ], [ "jamie whincup", "teamvodafone", "46", "30", "15" ], [ "steven richards", "ford performance racing", "46", "6", "13" ], [ "jason richards", "tasman motorsport", "46", "5", "12" ], [ "andrew jones", "team boc", "46", "17", "11" ], [ "steve owen", "autobarn racing", "46", "21", "10" ], [ "max wilson", "wps racing", "46", "11", "9" ], [ "paul dumbrell", "supercheap auto racing", "46", "25", "8" ], [ "todd kelly", "holden racing team", "46", "2", "6" ], [ "steven johnson", "jim beam racing", "46", "12", "5" ], [ "jason bargwanna", "wps racing", "45", "27", "4" ], [ "craig lowndes", "teamvodafone", "45", "1", "3" ], [ "rick kelly", "toll hsv dealer team", "45", "15", "2" ], [ "will davison", "jim beam racing", "45", "8", "0" ], [ "simon wills", "team boc", "45", "10", "0" ], [ "jack perkins", "jack daniel 's racing", "45", "26", "0" ], [ "john bowe", "paul cruickshank racing", "45", "24", "0" ], [ "shane price", "jack daniel 's racing", "45", "18", "0" ], [ "paul morris", "team sirromet wines", "45", "29", "0" ], [ "greg murphy", "tasman motorsport", "45", "31", "0" ], [ "shane van gisbergen", "team kiwi racing", "45", "13", "0" ], [ "mark winterbottom", "ford performance racing", "43", "3", "0" ], [ "cameron mcconville", "supercheap auto racing", "43", "22", "0" ], [ "fabian coulthard", "team sirromet wines", "34", "14", "0" ], [ "mark skaife", "holden racing team", "31", "20", "0" ], [ "alan gurr", "britek motorsport", "29", "28", "0" ], [ "dean canto", "garry rogers motorsport", "27", "23", "0" ], [ "jason bright", "britek motosport", "22", "16", "0" ], [ "james courtney", "stone brothers racing", "17", "7", "0" ] ], "title": "", "original_id": "40ae3a1a5040527ccb57ea9a6b89ca2d" }, { "_id": "3216d4d36b3a57e206866c4207240e13", "header": [ "sno", "power plant", "state", "total capacity (mw)", "completion schedule" ], "rows": [ [ "1", "kishenganga", "jammu & kashmir", "330", "2016" ], [ "2", "parbati - ii", "himachal pradesh", "800", "2013" ], [ "3", "subansiri (lower)", "assam", "2000", "2014" ], [ "4", "teesta low dam - iv", "west bengal", "160", "2011" ], [ "5", "parbati - iii", "himachal pradesh", "520", "2012" ], [ "6", "nimmo - bazgo", "jammu & kashmir", "45", "2011" ], [ "7", "chutak", "jammu & kashmir", "44", "2011" ], [ "8", "uri - ii", "jammu & kashmir", "240", "2011" ] ], "title": "", "original_id": "d4a5c36f72e87f2eeac0751416cafcb4" }, { "_id": "250a5440def821ac84029722054acbde", "header": [ "selected caribbean and n latin america countries", "internl tourist arrivals 2011 (x1000)", "internl tourism receipts 2011 (million usd )", "receipts per arrival 2010 (col 2) / (col 1) ( usd )", "receipts per capita 2005 usd", "revenues as % of exports goods and services 2011" ], "rows": [ [ "bahamas (1)", "1368", "2059", "1505", "6288", "74.6" ], [ "barbados", "568", "974", "1715", "2749", "58.5" ], [ "brazil", "5433", "6555", "1207", "18", "3.2" ], [ "chile", "3070", "1831", "596", "73", "5.3" ], [ "costa rica", "2196", "2156", "982", "343", "17.5" ], [ "colombia (1)", "2385", "2083", "873", "25", "6.6" ], [ "cuba", "2688", "n / d", "n / d", "169", "n / d" ], [ "dominican republic", "4306", "4353", "1011", "353", "36.2" ], [ "guatemala", "1225", "1350", "1102", "66", "16.0" ], [ "jamaica", "1952", "2012", "1031", "530", "49.2" ], [ "mexico", "23403", "11869", "507", "103", "5.7" ], [ "panama", "1473", "1926", "1308", "211", "10.6" ], [ "peru", "2598", "2360", "908", "41", "9.0" ] ], "title": "", "original_id": "00793dacf25441e231d6efb276f73d52" }, { "_id": "c87610ad2f6fe61a7b907e80c14d5a36", "header": [ "year", "number of tropical storms", "number of hurricanes", "number of major hurricanes", "deaths", "strongest storm" ], "rows": [ [ "1850", "0", "3", "0", "not known", "one" ], [ "1851", "6", "3", "1", "24", "four" ], [ "1852", "5", "5", "1", "100 +", "one" ], [ "1853", "8", "4", "2", "40", "three" ], [ "1854", "5", "3", "1", "30 +", "three" ], [ "1855", "5", "4", "1", "not known", "five" ], [ "1856", "6", "4", "2", "200 +", "one" ], [ "1857", "4", "3", "0", "424", "two & four" ], [ "1858", "6", "6", "0", "none", "three & six" ] ], "title": "", "original_id": "01ebe5f7371f583d215d73cd4266b44c" }, { "_id": "2a1e327516015eafed163c8d278c642a", "header": [ "peak", "metres", "feet", "latitude (n)", "longitude (e)", "prominence (m)" ], "rows": [ [ "gasherbrum i", "8080", "26509", "35 degree43′27″", "76 degree41′48″", "2155" ], [ "broad peak", "8047", "26400", "35 degree48′35″", "76 degree34′06″", "1701" ], [ "gasherbrum ii", "8035", "26360", "35 degree45′27″", "76 degree39′15″", "1523" ], [ "gasherbrum iii", "7952", "26089", "35 degree45′34″", "76 degree38′31″", "355" ], [ "gasherbrum iv", "7925", "26001", "35 degree45′39″", "76 degree37′00″", "725" ], [ "gasherbrum v", "7147", "23448", "35 degree43′45″", "76 degree36′48″", "654" ], [ "gasherbrum vi", "6979", "22897", "35 degree42′30″", "76 degree37′54″", "520" ] ], "title": "", "original_id": "5220eb200c2770c0628f7f45f794fbc2" }, { "_id": "3438e8196d0fe5d3ef4d1280e9d26c43", "header": [ "2nd component", "bp 2nd comp (˚c)", "3rd component", "bp 3rd comp (˚c)", "bp azeo (˚c)" ], "rows": [ [ "acetone", "56.5", "chloroform", "61.2", "57.5" ], [ "acetone", "56.5", "methyl acetate", "57.0", "53.7" ], [ "acetone", "56.5", "cyclohexane", "81.4", "51.5" ], [ "methyl acetate", "57.1", "carbon disulfide", "46.2", "37.0" ], [ "methyl acetate", "57.1", "cyclohexane", "81.4", "50.8" ], [ "methyl acetate", "57.1", "n - hexane", "69.0", "45.0" ] ], "title": "", "original_id": "a47d987b05bf1b6dd1441a073679477c" }, { "_id": "f1131ab164f863e12ee7c94d6bb88517", "header": [ "episode", "18 - 49", "viewers (m)", "rating", "share" ], "rows": [ [ "hero", "3.2 / 8", "12.16", "7.2", "11" ], [ "project run away", "2.8 / 7", "10.69", "6.3", "10" ], [ "dmv", "2.6 / 6", "10.86", "6.6", "10" ], [ "40 days", "2.4 / 6", "9.91", "6.0", "9" ], [ "burn , bougainvillea , burn", "1.0 / 3", "2.83", "1.9", "4" ], [ "if the shoe fits , steal it", "0.6 / 3", "2.87", "1.3", "3" ], [ "dirty stevie", "0.6 / 3", "2.59", "1.8", "4" ], [ "the game of life", "0.7 / 3", "2.76", "1.7", "4" ], [ "nothing for money", "0.5 / 2", "2.23", "1.8", "4" ], [ "school council", "0.7 / 3", "2.62", "1.7", "4" ], [ "three end tables", "0.6 / 3", "2.42", "tba", "tba" ], [ "desperate housewife", "0.6 / 3", "2.6", "1.6", "4" ], [ "no reception", "0.7 / 3", "2.73", "1.8", "4" ] ], "title": "", "original_id": "2a81093974f2cc5cb278ad23d0b23d74" }, { "_id": "e119c4fc5eba785ee69da8bab16d4a00", "header": [ "county", "per capita income", "median household income", "median family income", "population", "number of households" ], "rows": [ [ "los alamos", "49474", "103643", "118993", "17950", "7663" ], [ "santa fe", "32188", "52696", "64041", "144170", "61963" ], [ "united states", "27334", "51914", "62982", "308745538", "116716292" ], [ "bernalillo", "26143", "47481", "59809", "662564", "266000" ], [ "sandoval", "25979", "57158", "65906", "131561", "47602" ], [ "eddy", "24587", "46583", "56646", "53829", "20411" ], [ "lincoln", "24290", "43750", "53871", "20497", "9219" ], [ "new mexico", "22966", "43820", "52565", "2059179", "791395" ], [ "taos", "22145", "35441", "43236", "32937", "14806" ], [ "mora", "22035", "37784", "42122", "4881", "2114" ], [ "grant", "21164", "36591", "44360", "29514", "12586" ], [ "colfax", "21047", "39216", "48450", "13750", "6011" ], [ "catron", "20895", "31914", "40906", "3725", "1787" ], [ "de baca", "20769", "30643", "36618", "2022", "912" ], [ "san juan", "20725", "46189", "53540", "130044", "44404" ], [ "valencia", "19955", "42044", "48767", "76569", "27500" ], [ "curry", "19925", "38090", "48933", "48376", "18015" ], [ "rio arriba", "19913", "41437", "47840", "40246", "15768" ], [ "lea", "19637", "43910", "48980", "64727", "22236" ], [ "otero", "19255", "39615", "46210", "63797", "24464" ], [ "union", "19228", "39975", "41687", "4549", "1695" ], [ "san miguel", "18508", "32213", "42888", "29393", "11978" ], [ "chaves", "18504", "37524", "43464", "65645", "23691" ], [ "doã±a ana", "18315", "36657", "43184", "209233", "75532" ], [ "quay", "18234", "28773", "41766", "9041", "4072" ], [ "socorro", "17801", "33284", "41964", "17866", "7014" ], [ "hidalgo", "17451", "36733", "41594", "4894", "1936" ], [ "torrance", "17278", "37117", "43914", "16383", "6264" ], [ "roosevelt", "16933", "37762", "43536", "19846", "7299" ], [ "sierra", "16667", "25583", "38641", "11988", "5917" ], [ "luna", "15687", "27997", "33312", "25095", "9593" ], [ "cibola", "14712", "37361", "41187", "27213", "8860" ], [ "harding", "14684", "33750", "56563", "695", "349" ], [ "guadalupe", "13710", "28488", "37535", "4687", "1766" ], [ "mckinley", "12932", "31335", "37345", "71492", "21968" ] ], "title": "", "original_id": "91d8eb2652379f81c62a5eaa91ef1545" }, { "_id": "5603c47b6c23347727dfb95297a5738e", "header": [ "Temperature T (°C)", "Speed of sound c (m/s)", "Density of air ρ (kg/m3)", "Characteristic specific acoustic impedance z0 (Pa·s/m)" ], "rows": [ [ "35", "351.88", "1.1455", "403.2" ], [ "30", "349.02", "1.1644", "406.5" ], [ "25", "346.13", "1.1839", "409.4" ], [ "20", "343.21", "1.2041", "413.3" ], [ "15", "340.27", "1.2250", "416.9" ], [ "10", "337.31", "1.2466", "420.5" ], [ "5", "334.32", "1.2690", "424.3" ], [ "0", "331.30", "1.2922", "428.0" ], [ "−5", "328.25", "1.3163", "432.1" ], [ "−10", "325.18", "1.3413", "436.1" ], [ "−15", "322.07", "1.3673", "440.3" ], [ "−20", "318.94", "1.3943", "444.6" ], [ "−25", "315.77", "1.4224", "449.1" ] ], "title": "", "original_id": "766afe58ffd3cac9bbdec711f8b9b2ef" }, { "_id": "ad30fbe40e238f185d9673362de9a4fe", "header": [ "aircraft", "1990", "destroyed", "damaged", "to iran", "survived" ], "rows": [ [ "france mirage f1 eq", "76", "23", "6", "24", "23" ], [ "france mirage f1 k (kuwaiti)", "8", "2", "2", "0", "4" ], [ "ussr mig - 23bn", "38", "17", "0", "4", "18" ], [ "ussr su - 20", "18", "4", "2", "4", "8" ], [ "ussr su - 22 r", "10", "1", "0", "0", "9" ], [ "ussr su - 22 m2", "24", "2", "6", "5", "11" ], [ "ussr su - 22 m3", "16", "7", "0", "9", "0" ], [ "ussr su - 22 m4", "28", "7", "0", "15", "6" ], [ "ussr su - 24 mk", "30", "5", "0", "24", "1" ], [ "ussr su - 25", "66", "31", "8", "7", "20" ], [ "ussr mig - 21 / china f7", "236", "65", "46", "0", "115" ], [ "ussr mig - 23 ml", "39", "14", "1", "7", "17" ], [ "ussr mig - 23 mf", "14", "2", "5", "0", "7" ], [ "ussr mig - 23 ms", "15", "2", "4", "0", "9" ], [ "ussr mig - 25 rb", "9", "3", "3", "0", "3" ], [ "ussr mig - 25 pds", "19", "13", "1", "0", "5" ], [ "ussr mig - 29", "37", "17", "4", "4", "12" ], [ "ussr mig - 23 um", "21", "8", "0", "1", "12" ], [ "ussr tu - 16", "3", "3", "0", "0", "0" ], [ "china xian h - 6", "4", "4", "0", "0", "0" ], [ "ussr an - 26", "5", "0", "3", "0", "2" ], [ "ussr il - 76", "19", "3", "1", "15", "0" ], [ "france dassault falcon 20", "2", "0", "0", "2", "0" ], [ "france dassault falcon 50", "3", "0", "0", "3", "0" ], [ "usa lockheed jetstar", "6", "4", "0", "1", "1" ], [ "ussr mig - 25 u", "7", "3", "2", "0", "2" ], [ "ussr su - 22 - um3", "25", "3", "1", "0", "21" ], [ "czechoslovakia l - 39", "67", "0", "1", "0", "66" ], [ "brazil tucano", "78", "1", "6", "0", "64" ], [ "switzerland ffa as - 202 bravo", "34", "5", "5", "0", "17" ], [ "eloris trainer", "12", "0", "0", "0", "12" ], [ "united kingdom jet provost", "15", "0", "0", "0", "15" ], [ "bk - 117", "14", "1", "6", "0", "6" ], [ "france mirage f1 bq", "10", "0", "0", "0", "10" ], [ "ussr mig - 29ub", "4", "0", "0", "0", "4" ] ], "title": "", "original_id": "197880d573a4d526da262e794d318af6" }, { "_id": "9b1bb7c6c63c66d78d5484566d05d083", "header": [ "frequency (hz)", "r (î / km)", "l (mh / km)", "g (î¼s / km)", "c (nf / km)" ], "rows": [ [ "1", "172.24", "0.6129", "0.0", "51.57" ], [ "1k", "172.28", "0.6125", "0.072", "51.57" ], [ "10k", "172.7", "0.6099", "0.531", "51.57" ], [ "100k", "191.63", "0.5807", "3.327", "51.57" ], [ "1 m", "463.59", "0.5062", "29.111", "51.57" ], [ "2 m", "643.14", "0.4862", "53.205", "51.57" ] ], "title": "", "original_id": "fc48b080b4db6a50c2dc1b6b0cfa678c" }, { "_id": "39c67458a69012e466d092d08577fa46", "header": [ "rank", "peak", "country", "island", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "1", "finisterre range high point", "papua new guinea", "new guinea", "4175", "3734", "441" ], [ "2", "mount suckling", "papua new guinea", "new guinea", "3676", "2976", "700" ], [ "3", "mount wilhelm", "papua new guinea", "new guinea", "4509", "2969", "1540" ], [ "4", "mount victoria", "papua new guinea", "new guinea", "4038", "2738", "1300" ], [ "5", "mount balbi", "papua new guinea", "bougainville island", "2715", "2715", "0" ], [ "6", "mount oiautukekea", "papua new guinea", "goodenough island", "2536", "2536", "0" ], [ "7", "mount giluwe", "papua new guinea", "new guinea", "4367", "2507", "1860" ], [ "8", "new ireland high point", "papua new guinea", "new ireland", "2340", "2340", "0" ], [ "9", "mount ulawun", "papua new guinea", "new britain", "2334", "2334", "0" ], [ "10", "mount kabangama", "papua new guinea", "new guinea", "4104", "2284", "1820" ], [ "11", "nakanai mountains high point", "papua new guinea", "new britain", "2316", "2056", "260" ], [ "12", "mount kilkerran", "papua new guinea", "fergusson island", "1947", "1947", "0" ], [ "13", "mount piora", "papua new guinea", "new guinea", "3557", "1897", "1660" ], [ "14", "mount bosavi", "papua new guinea", "new guinea", "2507", "1887", "620" ], [ "15", "mount karoma", "papua new guinea", "new guinea", "3623", "1883", "1740" ], [ "16", "mount simpson", "papua new guinea", "new guinea", "2883", "1863", "1020" ], [ "17", "mount kunugui", "papua new guinea", "karkar island", "1833", "1833", "0" ], [ "18", "mount victory", "papua new guinea", "new guinea", "1891", "1831", "60" ], [ "19", "manam high point", "papua new guinea", "manam", "1807", "1807", "0" ], [ "20", "mount michael", "papua new guinea", "new guinea", "3647", "1787", "1860" ], [ "21", "mount talawe", "papua new guinea", "new britain", "1824", "1773", "51" ], [ "22", "barurumea ridge", "papua new guinea", "new britain", "2063", "1723", "340" ], [ "23", "mount sarawaget", "papua new guinea", "new guinea", "4121", "1701", "2420" ], [ "24", "bewani mountains high point", "papua new guinea", "new guinea", "1980", "1664", "316" ], [ "25", "mount bel", "papua new guinea", "umboi island", "1658", "1658", "0" ], [ "26", "unnamed summit", "papua new guinea", "new britain", "1951", "1651", "300" ], [ "27", "mount maybole", "papua new guinea", "fergusson island", "1665", "1597", "68" ], [ "28", "adelbert range high point", "papua new guinea", "new guinea", "1716", "1576", "140" ], [ "29", "sibium mountains high point", "papua new guinea", "new guinea", "2295", "1555", "740" ], [ "30", "mount shungol", "papua new guinea", "new guinea", "2752", "1518", "1234" ] ], "title": "", "original_id": "15bffb7b518116bf353c08583e80a77a" }, { "_id": "0fee7d42f3c898d7442b2bd047fbf6d3", "header": [ "metropolitan ring", "localities", "total", "jews and others 1", "thereof : jews", "arabs", "population density (per km square)", "annual population growth rate" ], "rows": [ [ "core 2", "1", "187200", "184100", "164600", "3100", "2220.6", "0.6%" ], [ "inner ring 3", "32", "151000", "55900", "53900", "95100", "145.2", "3.9%" ], [ "northern section", "11", "69100", "9200", "9000", "59900", "195.3", "3.8%" ], [ "western section", "13", "32400", "32300", "30600", "100", "65.2", "1.0%" ], [ "middle ring 4", "83", "210700", "140400", "128500", "70300", "61.7", "1.6%" ], [ "eastern section", "8", "126100", "57900", "50100", "68200", "149.6", "1.6%" ], [ "southern section", "10", "13000", "11100", "9700", "1900", "9.5", "0.9%" ], [ "western section", "65", "71600", "71400", "68600", "200", "59.3", "1.7%" ], [ "outer ring 5", "13", "10800", "9500", "9000", "1300", "2.5", "1.8%" ], [ "eastern section", "5", "2300", "1100", "1100", "1100", "1.5", "- 1.7%" ], [ "southern section", "8", "8500", "8400", "8000", "100", "3.0", "2.7%" ] ], "title": "", "original_id": "72886da909eefe9863c211e4747e3e07" }, { "_id": "4d1e553b8fe64221af6a1fa9d2b00513", "header": [ "interval name", "size (steps)", "size (cents)", "just ratio", "just (cents)", "error", "audio" ], "rows": [ [ "perfect fifth", "9", "720", "3:2", "701.96", "+ 18.04", "play category : articles with haudio microformats" ], [ "septimal tritone", "7", "560", "7:5", "582.51", "22.51", "play category : articles with haudio microformats" ], [ "11:8 wide fourth", "7", "560", "11:8", "551.32", "+ 8.68", "play category : articles with haudio microformats" ], [ "15:11 wide fourth", "7", "560", "15:11", "536.95", "+ 23.05", "play category : articles with haudio microformats" ], [ "perfect fourth", "6", "480", "4:3", "498.04", "18.04", "play category : articles with haudio microformats" ], [ "septimal major third", "5", "400", "9:7", "435.08", "35.08", "play category : articles with haudio microformats" ], [ "undecimal major third", "5", "400", "14:11", "417.51", "17.51", "play category : articles with haudio microformats" ], [ "major third", "5", "400", "5:4", "386.31", "+ 13.69", "play category : articles with haudio microformats" ], [ "minor third", "4", "320", "6:5", "315.64", "+ 4.36", "play category : articles with haudio microformats" ], [ "septimal minor third", "3", "240", "7:6", "266.87", "26.87", "play category : articles with haudio microformats" ], [ "septimal whole tone", "3", "240", "8:7", "231.17", "+ 8.83", "play category : articles with haudio microformats" ], [ "major tone", "3", "240", "9:8", "203.91", "+ 36.09", "play category : articles with haudio microformats" ], [ "minor tone", "2", "160", "10:9", "182.4", "22.40", "play category : articles with haudio microformats" ], [ "greater undecimal neutral second", "2", "160", "11:10", "165.0", "5.00", "play category : articles with haudio microformats" ], [ "lesser undecimal neutral second", "2", "160", "12:11", "150.63", "+ 9.36", "play category : articles with haudio microformats" ], [ "just diatonic semitone", "1", "80", "16:15", "111.73", "31.73", "play category : articles with haudio microformats" ], [ "septimal chromatic semitone", "1", "80", "21:20", "84.46", "4.47", "play category : articles with haudio microformats" ] ], "title": "", "original_id": "1b234165005ad86450164ddaec89aee3" }, { "_id": "72daff4fd44678397ade4768122a070f", "header": [ "season", "episodes", "timeslot (et)", "season premiere", "season finale", "tv season", "rank", "viewers (in millions)" ], "rows": [ [ "1", "10", "saturday 8:00 pm", "february 21 , 2004", "august 14 , 2004", "2003 - 2004", "123", "6.21" ], [ "2", "17", "saturday 8:00 pm", "september 25 , 2004", "august 27 , 2005", "2004 - 2005", "107", "6.41" ], [ "3", "25", "saturday 8:00 pm", "september 17 , 2005", "august 12 , 2006", "2005 - 2006", "126", "5.74" ], [ "4", "25", "saturday 8:00 pm", "october 21 , 2006", "august 25 , 2007", "2006 - 2007", "180", "5.12" ], [ "5", "23", "saturday 8:00 pm", "december 8 , 2007", "august 23 , 2008", "2007 - 2008", "160", "4.69" ], [ "6", "21", "saturday 8:00 pm", "december 13 , 2008", "august 29 , 2009", "2008 - 2009", "149", "3.8" ], [ "7", "18", "saturday 8:00 pm", "december 12 , 2009", "august 28 , 2010", "2009 - 2010", "119", "3.55" ], [ "8", "22", "saturday 8:00 pm", "december 11 , 2010", "august 20 , 2011", "2010 - 2011", "170", "3.53" ], [ "9", "14", "saturday 8:00 pm", "december 24 , 2011", "august 18 , 2012", "2011 - 2012", "156", "3.46" ] ], "title": "", "original_id": "46be461d6cbfbb137a063587f8aaeef6" }, { "_id": "e2099829a9308a753ff4145f2c01f7e5", "header": [ "year of marriage", "name", "her age", "his age", "of children" ], "rows": [ [ "1835", "louisa maria tanner", "17", "22", "8" ], [ "1843", "diontha walker", "27", "30", "0" ], [ "1844", "caroline partridge", "17", "31", "6" ], [ "1846", "eliza maria partridge", "23", "33", "5" ], [ "1846", "paulina eliza phelps", "19", "33", "7" ], [ "1846", "priscilla turley", "17", "33", "6" ], [ "1846", "cornelia leavitt", "21", "33", "2" ], [ "1853", "lydia partridge", "23", "40", "4" ] ], "title": "", "original_id": "e617dfb780c7add548b0874e476724e6" }, { "_id": "ac2e4f0e452392491a4e08914876f827", "header": [ "STAPLE:", "Maize / Corn", "Rice", "Wheat", "Potato", "Cassava", "Soybean (Green)", "Sweet potato", "Sorghum", "Yam", "Plantain" ], "rows": [ [ "Component (per 100g portion)", "Amount", "Amount", "Amount", "Amount", "Amount", "Amount", "Amount", "Amount", "Amount", "Amount" ], [ "Water (g)", "10", "12", "13", "79", "60", "68", "77", "9", "70", "65" ], [ "Energy (kJ)", "1528", "1528", "1369", "322", "670", "615", "360", "1419", "494", "511" ], [ "Protein (g)", "9.4", "7.1", "12.6", "2.0", "1.4", "13.0", "1.6", "11.3", "1.5", "1.3" ], [ "Fat (g)", "4.74", "0.66", "1.54", "0.09", "0.28", "6.8", "0.05", "3.3", "0.17", "0.37" ], [ "Carbohydrates (g)", "74", "80", "71", "17", "38", "11", "20", "75", "28", "32" ], [ "Fiber (g)", "7.3", "1.3", "12.2", "2.2", "1.8", "4.2", "3", "6.3", "4.1", "2.3" ], [ "Sugar (g)", "0.64", "0.12", "0.41", "0.78", "1.7", "0", "4.18", "0", "0.5", "15" ], [ "Calcium (mg)", "7", "28", "29", "12", "16", "197", "30", "28", "17", "3" ], [ "Iron (mg)", "2.71", "0.8", "3.19", "0.78", "0.27", "3.55", "0.61", "4.4", "0.54", "0.6" ], [ "Magnesium (mg)", "127", "25", "126", "23", "21", "65", "25", "0", "21", "37" ], [ "Phosphorus (mg)", "210", "115", "288", "57", "27", "194", "47", "287", "55", "34" ], [ "Potassium (mg)", "287", "115", "363", "421", "271", "620", "337", "350", "816", "499" ], [ "Sodium (mg)", "35", "5", "2", "6", "14", "15", "55", "6", "9", "4" ], [ "Zinc (mg)", "2.21", "1.09", "2.65", "0.29", "0.34", "0.99", "0.3", "0", "0.24", "0.14" ], [ "Copper (mg)", "0.31", "0.22", "0.43", "0.11", "0.10", "0.13", "0.15", "-", "0.18", "0.08" ], [ "Manganese (mg)", "0.49", "1.09", "3.99", "0.15", "0.38", "0.55", "0.26", "-", "0.40", "-" ], [ "Selenium (μg)", "15.5", "15.1", "70.7", "0.3", "0.7", "1.5", "0.6", "0", "0.7", "1.5" ], [ "Vitamin C (mg)", "0", "0", "0", "19.7", "20.6", "29", "2.4", "0", "17.1", "18.4" ], [ "Thiamin (mg)", "0.39", "0.07", "0.30", "0.08", "0.09", "0.44", "0.08", "0.24", "0.11", "0.05" ], [ "Riboflavin (mg)", "0.20", "0.05", "0.12", "0.03", "0.05", "0.18", "0.06", "0.14", "0.03", "0.05" ], [ "Niacin (mg)", "3.63", "1.6", "5.46", "1.05", "0.85", "1.65", "0.56", "2.93", "0.55", "0.69" ], [ "Pantothenic acid (mg)", "0.42", "1.01", "0.95", "0.30", "0.11", "0.15", "0.80", "-", "0.31", "0.26" ], [ "Vitamin B6 (mg)", "0.62", "0.16", "0.3", "0.30", "0.09", "0.07", "0.21", "-", "0.29", "0.30" ], [ "Folate Total (μg)", "19", "8", "38", "16", "27", "165", "11", "0", "23", "22" ], [ "Vitamin A (IU)", "214", "0", "9", "2", "13", "180", "14187", "0", "138", "1127" ], [ "Vitamin E, alpha-tocopherol (mg)", "0.49", "0.11", "1.01", "0.01", "0.19", "0", "0.26", "0", "0.39", "0.14" ], [ "Vitamin K1 (μg)", "0.3", "0.1", "1.9", "1.9", "1.9", "0", "1.8", "0", "2.6", "0.7" ], [ "Beta-carotene (μg)", "97", "0", "5", "1", "8", "0", "8509", "0", "83", "457" ], [ "Lutein+zeaxanthin (μg)", "1355", "0", "220", "8", "0", "0", "0", "0", "0", "30" ], [ "Saturated fatty acids (g)", "0.67", "0.18", "0.26", "0.03", "0.07", "0.79", "0.02", "0.46", "0.04", "0.14" ], [ "Monounsaturated fatty acids (g)", "1.25", "0.21", "0.2", "0.00", "0.08", "1.28", "0.00", "0.99", "0.01", "0.03" ], [ "Polyunsaturated fatty acids (g)", "2.16", "0.18", "0.63", "0.04", "0.05", "3.20", "0.01", "1.37", "0.08", "0.07" ] ], "title": "", "original_id": "f613a13c80d7b38191513c4bbbb12399" }, { "_id": "4aa86768302fc49154d12e1675ce4a86", "header": [ "Rank", "Date", "Level at Trent Bridge\nm", "Level at Trent Bridge\nft", "Peak Flow\nm3/s", "Peak Flow\ncfs" ], "rows": [ [ "1.0", "February 1795", "24.55", "80.5", "1,416", "50,000" ], [ "2.0", "October 1875", "24.38", "80.0", "1,274", "45,000" ], [ "3.0", "March 1947", "24.3", "79.7", "1,107", "39,100" ], [ "4.0", "November 1852", "24.26", "79.6", "1,082", "38,200" ], [ "5.0", "November 2000", "23.8", "78.1", "1,019", "36,000" ], [ null, "Normal / Avg flow", "20.7", "68.0", "84", "3,000" ] ], "title": "", "original_id": "05d552ca0b57ae7642215bd020e5a998" }, { "_id": "21803e35e4d5238a003dba6a2e432b1b", "header": [ "date", "total usaaf", "tot officers", "tot enlisted", "overseas", "officers o / s", "enlisted o / s" ], "rows": [ [ "31 july 1939", "24724", "2636", "22088", "3991", "272", "3719" ], [ "31 december 1939", "43118", "3006", "40112", "7007", "351", "6656" ], [ "31 december 1940", "101227", "6437", "94790", "16070", "612", "15458" ], [ "31 december 1941", "354161", "24521", "329640", "25884", "2479", "23405" ], [ "31 december 1942", "1597049", "127267", "1469782", "242021", "26792", "215229" ], [ "31 december 1943", "2373882", "274347", "2099535", "735666", "81072", "654594" ], [ "31 march 1944 (peak size)", "2411294", "306889", "2104405", "906335", "104864", "801471" ], [ "31 december 1944", "2359456", "375973", "1983483", "1164136", "153545", "1010591" ], [ "30 april 1945 (peak overseas)", "2329534", "388278", "1941256", "1224006", "163886", "1060120" ] ], "title": "", "original_id": "f59574b7c105caabd689074d79b03f51" }, { "_id": "77293ee7b061d3c25fd426cfdae0493b", "header": [ "school year", "95 - 96", "99 - 00", "00 - 01", "01 - 02", "02 - 03", "03 - 04", "04 - 05", "05 - 06", "06 - 07" ], "rows": [ [ "school year", "95 - 96", "99 - 00", "00 - 01", "01 - 02", "02 - 03", "03 - 04", "04 - 05", "05 - 06", "06 - 07" ], [ "latvian", "203607", "239163", "242475", "242183", "237425", "230212", "214855", "205189", "194230" ], [ "russian", "132540", "120925", "116009", "108454", "101486", "95841", "84559", "77471", "70683" ], [ "others", "1513", "1344", "1344", "1352", "1397", "1305", "1253", "1287", "1198" ], [ "total", "337660", "361432", "359818", "351989", "340308", "327358", "300667", "283947", "266111" ], [ "% learning in latvian", "60.3", "66.2", "67.4", "68.8", "69.8", "70.3", "71.5", "72.3", "73.0" ] ], "title": "", "original_id": "cb3925b6aac9fe33756c8d068e84fe1c" }, { "_id": "44ee2ac030046b877aa73d3ffc3c73a4", "header": [ "county", "starky", "starky %", "hancock", "hancock %", "mccain", "mccain %", "total" ], "rows": [ [ "apache", "9588", "40.95%", "905", "3.86%", "12923", "55.19%", "23416" ], [ "cochise", "9555", "21.80%", "1394", "3.18%", "32879", "75.02%", "43828" ], [ "coconino", "13520", "26.58%", "1504", "2.96%", "35849", "70.47%", "50873" ], [ "gila", "4291", "20.96%", "632", "3.09%", "15551", "75.95%", "20474" ], [ "graham", "2000", "19.06%", "322", "3.07%", "8171", "77.87%", "10493" ], [ "greenlee", "746", "25.03%", "68", "2.28%", "2166", "72.68%", "2980" ], [ "la paz", "965", "19.51%", "156", "3.15%", "3826", "77.34%", "4947" ], [ "maricopa", "216124", "18.58%", "29769", "2.56%", "917527", "78.86%", "1163420" ], [ "mohave", "10423", "18.44%", "1686", "2.98%", "44402", "78.57%", "56511" ], [ "navajo", "7434", "23.42%", "1222", "3.85%", "23091", "72.73%", "31747" ], [ "pima", "89483", "25.17%", "7980", "2.24%", "258010", "72.58%", "355473" ], [ "pinal", "13595", "21.45%", "1692", "2.67%", "48094", "75.88%", "63381" ], [ "santa cruz", "3583", "31.60%", "252", "2.22%", "7502", "66.17%", "11337" ], [ "yavapai", "14852", "17.41%", "3160", "3.70%", "67312", "78.89%", "85324" ], [ "yuma", "8348", "22.28%", "1056", "2.82%", "28069", "74.90%", "37473" ] ], "title": "", "original_id": "e50db28add493534433a98cb3ccfcdbf" }, { "_id": "e73d5c7b83844c3d752ef1aed7174d89", "header": [ "chambering", "p1 diameter (mm)", "a external (cm 2 )", "p max ( bar )", "f bolt ( kgf )", "f bolt" ], "rows": [ [ "5.45x39 mm", "10.0", "0.7854", "3800", "2985", "n ( lbf )" ], [ ".223 remington", "9.58", "0.7208", "4300", "3099", "n (lbf)" ], [ "7.62x39 mm", "11.35", "1.0118", "3550", "3592", "n (lbf)" ], [ ".308 winchester", "11.96", "1.1234", "4150", "4662", "n (lbf)" ], [ ".300 winchester magnum", "13.03", "1.3335", "4300", "5734", "n (lbf)" ], [ ".300 wsm", "14.12", "1.5659", "4450", "6968", "n (lbf)" ], [ ".300 remington ultra magnum", "13.97", "1.5328", "4480", "6876", "n (lbf)" ], [ ".338 lapua magnum", "14.91", "1.746", "4200", "7333", "n (lbf)" ], [ ".300 lapua magnum", "14.91", "1.746", "4700", "8339", "n (lbf)" ], [ ".50 bmg", "20.42", "3.2749", "3700", "12117", "n (lbf)" ] ], "title": "", "original_id": "3b35d95ee257a5d59d6b3eb9d15c73ae" }, { "_id": "98ea8a624030bcbe12bc6aac7aab597d", "header": [ "pilot", "organization", "total flights", "usaf space flights", "fai space flights", "max mach", "max speed (mph)", "max altitude (miles)" ], "rows": [ [ "michael j adams", "us air force", "7", "1", "0", "5.59", "3822", "50.3" ], [ "neil armstrong", "nasa", "7", "0", "0", "5.74", "3989", "39.2" ], [ "scott crossfield", "north american aviation", "14", "0", "0", "2.97", "1959", "15.3" ], [ "william h dana", "nasa", "16", "2", "0", "5.53", "3897", "58.1" ], [ "joseph h engle", "us air force", "16", "3", "0", "5.71", "3887", "53.1" ], [ "william j pete knight", "us air force", "16", "1", "0", "6.7", "4519", "53.1" ], [ "john b mckay", "nasa", "29", "1", "0", "5.65", "3863", "55.9" ], [ "forrest s petersen", "us navy", "5", "0", "0", "5.3", "3600", "19.2" ], [ "robert a rushworth", "us air force", "34", "1", "0", "6.06", "4017", "53.9" ], [ "milton o thompson", "nasa", "14", "0", "0", "5.48", "3723", "40.5" ], [ "joseph a walker", "nasa", "25", "3", "2", "5.92", "4104", "67.0" ] ], "title": "", "original_id": "909198221c6530a86885112b88cf997d" }, { "_id": "994ac1d127c56f09c033f7630167dab1", "header": [ "period", "live births per year", "deaths per year", "natural change per year", "cbr", "cdr", "nc", "tfr", "imr", "life expectancy total", "life expectancy males", "life expectancy females" ], "rows": [ [ "1950 - 1955", "2 572 000", "900 000", "1 672 000", "44.1", "15.5", "28.6", "6.15", "135", "50.9", "49.2", "52.6" ], [ "1955 - 1960", "2 918 000", "947 000", "1 971 000", "43.2", "14.0", "29.1", "6.15", "122", "53.3", "51.5", "55.2" ], [ "1960 - 1965", "3 303 000", "986 000", "2 317 000", "42.2", "12.6", "29.6", "6.15", "109", "55.7", "53.8", "57.6" ], [ "1965 - 1970", "3 330 000", "998 000", "2 332 000", "37.0", "11.1", "25.9", "5.38", "100", "57.6", "55.7", "59.6" ], [ "1970 - 1975", "3 441 000", "1 014 000", "2 427 000", "33.7", "9.9", "23.8", "4.72", "91", "59.5", "57.3", "61.8" ], [ "1975 - 1980", "3 741 000", "1 043 000", "2 698 000", "32.5", "9.0", "23.5", "4.31", "79", "61.5", "59.2", "63.9" ], [ "1980 - 1985", "3 974 000", "1 064 000", "2 910 000", "30.8", "8.2", "22.6", "3.8", "63", "63.4", "60.4", "66.8" ], [ "1985 - 1990", "3 757 000", "1 055 000", "2 702 000", "26.3", "7.4", "18.9", "3.1", "52", "65.3", "61.9", "69.1" ], [ "1990 - 1995", "3 519 000", "1 058 000", "2 461 000", "22.6", "6.8", "15.8", "2.6", "43", "67.3", "63.6", "71.2" ], [ "1995 - 2000", "3 624 000", "1 086 000", "2 538 000", "21.5", "6.5", "15.1", "2.45", "34", "69.3", "65.5", "73.3" ], [ "2000 - 2005", "3 572 000", "1 147 000", "2 425 000", "19.8", "6.4", "13.4", "2.25", "27", "70.9", "67.2", "74.8" ] ], "title": "", "original_id": "941de41a89c72f457a53e9f5ffd87bc9" }, { "_id": "c08e9c6eae01811037ae6b19fae3c0f7", "header": [ "Township", "FIPS", "Population\ncenter", "Population", "Population\ndensity\n(/mi²)", "Population\ndensity\n(/km²)", "Land area\n(mi²)", "Land area\n(km²)", "Water area\n(mi²)", "Water area\n(km²)", "Geographic coordinates" ], "rows": [ [ "Bayliss", "90159", null, "708", "24.6", "9.5", "28.81", "74.62", "0.0979", "0.2536", "35°24′10″N 93°14′06″W / 35.40278°N 93.23500°W" ], [ "Burnett", "90558", null, "452", "20.9", "8.1", "21.65", "56.07", "0.1051", "0.2722", "35°19′10″N 92°52′33″W / 35.31944°N 92.87583°W" ], [ "Center", "90735", null, "515", "36.8", "14.2", "13.99", "36.23", "0.0339", "0.0878", "35°24′20″N 92°57′16″W / 35.40556°N 92.95444°W" ], [ "Clark", "90813", "London", "2969", "115.3", "44.6", "25.73", "66.64", "6.0444", "15.6549", "35°19′45″N 93°14′46″W / 35.32917°N 93.24611°W" ], [ "Convenience", "90921", null, "933", "50.4", "19.4", "18.53", "47.99", "0.0942", "0.244", "35°20′00″N 92°56′41″W / 35.33333°N 92.94472°W" ], [ "Dover", "91134", "Dover", "5277", "119.1", "46.0", "44.29", "114.7", "0.3637", "0.942", "35°23′30″N 93°07′01″W / 35.39167°N 93.11694°W" ], [ "Freeman", "91377", null, "98", "0.8", "0.3", "119.78", "310.2", "0.0", "0.0", "35°39′10″N 93°04′06″W / 35.65278°N 93.06833°W" ], [ "Galla", "91407", "Pottsville", "3523", "88.7", "34.3", "39.71", "102.8", "1.841", "4.7682", "35°13′15″N 93°02′46″W / 35.22083°N 93.04611°W" ], [ "Griffin", "91536", null, "901", "26.5", "10.2", "33.96", "87.96", "0.1106", "0.2865", "35°25′30″N 92°52′36″W / 35.42500°N 92.87667°W" ], [ "Gum Log", "91560", null, "1420", "71.6", "27.6", "19.84", "51.39", "0.0142", "0.0368", "35°16′30″N 92°59′51″W / 35.27500°N 92.99750°W" ], [ "Illinois", "91812", "Russellville", "25841", "540.9", "208.9", "47.77", "123.7", "6.6022", "17.0996", "35°17′00″N 93°07′46″W / 35.28333°N 93.12944°W" ], [ "Jackson", "91875", "Hector", "1191", "11.5", "4.4", "103.72", "268.6", "0.0505", "0.1308", "35°29′20″N 92°57′01″W / 35.48889°N 92.95028°W" ], [ "Liberty", "92181", null, "805", "14.2", "5.5", "56.64", "146.7", "0.0028", "0.0073", "35°29′40″N 93°03′16″W / 35.49444°N 93.05444°W" ], [ "Martin", "92415", null, "1482", "23.7", "9.2", "62.46", "161.8", "0.3931", "1.0181", "35°28′25″N 93°10′06″W / 35.47361°N 93.16833°W" ], [ "Moreland", "92553", null, "700", "52.2", "20.2", "13.4", "34.71", "0.0683", "0.1769", "35°21′30″N 92°59′46″W / 35.35833°N 92.99611°W" ], [ "Phoenix", "92871", null, "334", "26.7", "10.3", "12.51", "32.4", "0.0", "0.0", "35°24′30″N 93°00′31″W / 35.40833°N 93.00861°W" ], [ "Smyrna", "93420", null, "173", "2.4", "0.9", "70.69", "183.1", "0.0218", "0.0565", "35°38′10″N 92°53′46″W / 35.63611°N 92.89611°W" ], [ "Valley", "93765", null, "2776", "125.7", "48.5", "22.09", "57.21", "0.0144", "0.0373", "35°20′05″N 93°02′46″W / 35.33472°N 93.04611°W" ], [ "Wilson", "94089", "Atkins", "4371", "77.6", "30.0", "56.32", "145.9", "3.0305", "7.849", "35°13′30″N 92°55′01″W / 35.22500°N 92.91694°W" ] ], "title": "", "original_id": "42588bff012a6959cc80a02fbdb8ea8b" }, { "_id": "7788d29b42260c6febf4c29ba8df9b68", "header": [ "institution", "location", "established", "gained university status", "vice - chancellor", "total number of students", "research funding (000)" ], "rows": [ [ "birkbeck , university of london", "london", "1823", "1920", "professor david latchman", "19020", "9985" ], [ "university of east anglia", "norwich", "1963", "1963", "professor edward acton", "19585", "16482" ], [ "university of essex", "colchester", "1964", "1964", "professor anthony forster", "11690", "9967" ], [ "goldsmiths , university of london", "london", "1891", "1904", "dr pat loughrey", "7615", "8539" ], [ "institute of education , university of london", "london", "1902", "1932", "professor chris husbands", "7215", "7734" ], [ "university of lancaster", "lancaster", "1964", "1964", "professor mark smith", "12695", "18640" ], [ "university of leicester", "leicester", "1921", "1957", "professor robert burgess", "16160", "22225" ], [ "loughborough university", "loughborough", "1909", "1966", "professor robert allison", "17825", "22398" ], [ "royal holloway , university of london", "egham", "1849", "1900", "professor paul layzell (principal)", "7620", "13699" ], [ "soas , university of london", "london", "1916", "1916", "professor paul webley", "4525", "7238" ] ], "title": "", "original_id": "86d237da79f5e78933cafbcf861599b6" }, { "_id": "e67c5ef31a4f0e61c85d3e96608cbbd4", "header": [ "rank", "metropolitan area", "country", "gdp (ppp) (2008) billions of us", "metropolitan population (2006) millions", "gdp (ppp) us per capita" ], "rows": [ [ "1", "mexico city", "mexico", "390", "21.2", "20300" ], [ "2", "são paulo", "brazil", "388", "18.61", "20800" ], [ "3", "buenos aires", "argentina", "362", "13.52", "28000" ], [ "4", "rio de janeiro", "brazil", "201", "11.62", "17300" ], [ "5", "bogotá", "colombia", "180", "8.55", "21050" ], [ "6", "santiago", "chile", "120", "5.7", "21050" ], [ "7", "brasilia", "brazil", "110", "3.48", "31600" ], [ "8", "lima", "peru", "109", "8.35", "13100" ], [ "9", "medellín", "colombia", "102", "3.58", "28500" ], [ "10", "guadalajara", "mexico", "81", "3.95", "20500" ] ], "title": "", "original_id": "13d88bef442eaf8c1a03ae3aebbbe620" }, { "_id": "f032c9372c209f7c63485568619c8781", "header": [ "sunshine (hrs / year)", "rain (mm / year)", "snow (days / year)", "storms (days / year)", "fog (days / year)" ], "rows": [ [ "1973", "770", "14", "22", "40" ], [ "1650", "657", "17", "18", "54" ], [ "1 630", "642", "15", "19", "13" ], [ "2 668", "767", "1", "31", "1" ], [ "1 633", "610", "30", "29", "65" ], [ "1 492", "1 109", "9", "11", "74" ] ], "title": "", "original_id": "ee98550f2f9e19f521b3c953c7c476a2" }, { "_id": "4d284692b879c143b75429912916814b", "header": [ "Rank", "Region", "GDP (€, billions)", "GDP (% of national total)", "GDP per capita (€)", "GDP per capita (PPS)", "GDP per capita (PPS, EU28=100)" ], "rows": [ [ "0", "a", "0", "0", "0", "0", "0" ], [ "1", "Attica", "85.285", "47.3", "22,700", "27,300", "91" ], [ "2", "Central Macedonia", "24.953", "13.8", "13,300", "16,000", "53" ], [ "3", "Thessaly", "9.437", "5.2", "13,000", "15,700", "52" ], [ "4", "Crete", "8.962", "5.0", "14,200", "17,000", "57" ], [ "5", "Central Greece", "8.552", "4.7", "15,400", "18,500", "62" ], [ "6", "Western Greece", "8.164", "4.5", "12,300", "14,900", "49" ], [ "7", "Peloponnese", "8.144", "4.5", "14,100", "17,000", "56" ], [ "8", "Eastern Macedonia and Thrace", "6.939", "3.9", "11,500", "13,900", "46" ], [ "9", "South Aegean", "6.114", "3.4", "18,000", "21,700", "72" ], [ "10", "Western Macedonia", "4.010", "2.2", "14,800", "17,900", "59" ], [ "11", "Epirus", "4.001", "2.2", "12,000", "14,400", "48" ], [ "12", "Ionian Islands", "3.159", "1.8", "15,400", "18,600", "62" ], [ "13", "North Aegean", "2.498", "1.4", "12,000", "14,500", "48" ], [ "-", "-", "-", "-", "-", "-", "-" ], [ "–", "Greece", "180.218", "100", "16,800", "20,200", "67" ], [ "-", "-", "-", "-", "-", "-", "-" ], [ "–", "European Union", "15,383.066", "8535.8", "30,000", "30,000", "100" ], [ "100", "z", "1000000000000000", "1000", "100", "1000000000", "1000" ] ], "title": "", "original_id": "466d38cce925e5567977bc108dffbcc4" }, { "_id": "49338491cc80bc31c70537f052dd779b", "header": [ "drug", "mean", "pleasure", "psychological dependence", "physical dependence" ], "rows": [ [ "heroin", "3.0", "3.0", "3.0", "3.0" ], [ "cocaine", "2.37", "3.0", "2.8", "1.3" ], [ "alcohol", "1.93", "2.3", "1.9", "1.6" ], [ "barbiturates", "2.01", "2.0", "2.2", "1.8" ], [ "benzodiazepines", "1.83", "1.7", "2.1", "1.8" ], [ "amphetamine", "1.67", "2.0", "1.9", "1.1" ], [ "cannabis", "1.51", "1.9", "1.7", "0.8" ], [ "ecstasy", "1.13", "1.5", "1.2", "0.7" ], [ "lsd", "0.9", "1.3", "1.1", "0.3" ] ], "title": "", "original_id": "6423fac749dc4e40ed398068f69b433d" }, { "_id": "6013b9d705b701d6ac84b242c5f7a914", "header": [ "fuel gas", "upper index kcal / nm 3", "lower index kcal / nm 3", "upper index mj / nm 3", "lower index mj / nm 3" ], "rows": [ [ "hydrogen", "11528", "9715", "48.23", "40.65" ], [ "methane", "12735", "11452", "53.28", "47.91" ], [ "ethane", "16298", "14931", "68.19", "62.47" ], [ "ethylene", "15253", "14344", "63.82", "60.01" ], [ "natural gas", "12837", "11597", "53.71", "48.52" ], [ "propane", "19376", "17817", "81.07", "74.54" ], [ "propylene", "18413", "17180", "77.04", "71.88" ], [ "n - butane", "22066", "20336", "92.32", "85.08" ], [ "iso - butane", "21980", "20247", "91.96", "84.71" ], [ "butylene - 1", "21142", "19728", "88.46", "82.54" ], [ "lpg", "20755", "19106", "86.84", "79.94" ], [ "acetylene", "14655", "14141", "61.32", "59.16" ] ], "title": "", "original_id": "491f762a5e6a62788dbefb887cacdde6" }, { "_id": "346cf7a36dd406e89de1398099a64e16", "header": [ "School Name", "Low grade", "High grade", "Students (K-12)", "FTE Teachers", "Student/teacher ratio" ], "rows": [ [ "Bethany Lutheran School", "PK", "8", "28.0", "3.6", "7.78" ], [ "Bethlehem Lutheran School", "PK", "8", "182.0", "10.0", "18.2" ], [ "Christ Lutheran School", "K", "8", "12.0", "2.0", "6.0" ], [ "Community Baptist Christian School", "PK", "12", "120.0", "9.8", "12.24" ], [ "Good Shepherd Early Childhood", "PK", "K", "20.0", "1.0", "20.0" ], [ "Grace Christian School", "PK", "12", "117.0", "13.0", "9.0" ], [ "Holy Cross Lutheran School", "PK", "8", "135.0", "7.9", "17.09" ], [ "Immanuel Lutheran School", "PK", "8", "82.0", "5.6", "14.64" ], [ "Michigan Lutheran Seminary", "9", "12", "313.0", "31.0", "10.1" ], [ "Nouvel Catholic Central High School", "9", "12", "505.0", "37.0", "13.65" ], [ "Peace Lutheran School", "PK", "8", "229.0", null, null ], [ "Sheridan Road Christian School", "K", "12", "42.0", "5.9", "7.12" ], [ "St Helen Elementary School", "K", "8", "182.0", "10.9", "16.7" ], [ "St John's Evangelical Lutheran School", "K", "8", "32.0", "3.0", "10.67" ], [ "St Pauls Lutheran School", "PK", "8", "155.0", "9.6", "16.15" ], [ "St Stephen Elementary School", "PK", "8", "364.0", "23.1", "15.76" ], [ "St Thomas Aquinas Elementary School", "K", "8", "403.0", "25.0", "16.12" ], [ "Tri-City Seventh-Day Adventist School", "1", "8", "18.0", "2.1", "8.57" ], [ "Valley Lutheran High School", "9", "12", "344.0", "21.0", "16.38" ], [ "Notes", null, null, null, null, null ] ], "title": "", "original_id": "a99c268eb398a0062284bc4d59ab2d89" }, { "_id": "355473703ad8f153f802ae01c12c87d5", "header": [ "Province", "DC", "LV*", "PSI", "PCI" ], "rows": [ [ "Verona", "44.3", "10.8", "14.2", "11.5" ], [ "Vicenza", "49.1", "11.4", "10.1", "8.6" ], [ "Padua", "46.1", "6.4", "10.7", "16.3" ], [ "Treviso", "44.5", "7.8", "14.1", "12.1" ], [ "Belluno", "39.3", "7.0", "23.8", "13.1" ], [ "Venice", "31.7", "4.9", "15.9", "24.2" ], [ "Rovigo", "35.2", "3.3", "15.5", "29.0" ], [ "Veneto", "42.3", "7.8", "13.7", "15.5" ] ], "title": "", "original_id": "f006cbc7a735f7755e32dde42be5b50b" }, { "_id": "93cba3453de56e6f01a7ea0967c244c5", "header": [ "height (m)", "no of times visited", "no of hc climbs", "first time as hc climb", "most recent" ], "rows": [ [ "2744", "2", "2", "2008", "2011" ], [ "1850 / 1860", "29", "25", "1979", "2013" ], [ "2240", "2", "2", "1997", "2009" ], [ "1655", "2", "1", "2013", "2013" ], [ "1709", "48", "14", "1980", "2012" ], [ "1755", "3", "3", "2007", "2012" ], [ "1780", "5", "5", "1998", "2011" ], [ "2715", "4", "2", "1993", "2008" ], [ "1730", "1", "1", "2001", "2001" ], [ "2067", "16", "8", "1989", "2012" ], [ "2556 / 2645", "56", "19", "1979", "2011" ], [ "1924", "12", "4", "1981", "2013" ], [ "1501", "1", "1", "2012", "2012" ], [ "2465", "5", "1", "2009", "2009" ], [ "2413", "1", "1", "1986", "1986" ], [ "1560", "4", "4", "1994", "2008" ], [ "2770", "5", "2", "1992", "2007" ], [ "1900", "1", "1", "1993", "1993" ], [ "2360", "32", "6", "1986", "2011" ], [ "1691", "11", "6", "1981", "2006" ], [ "1980", "4", "4", "1984", "2002" ], [ "1573", "2", "2", "1996", "2007" ], [ "1160", "1", "1", "1984", "1984" ], [ "2351", "1", "1", "2008", "2008" ], [ "1715", "8", "8", "1985", "2011" ], [ "1993", "25", "17", "1980", "2013" ], [ "2083", "5", "1", "1999", "1999" ], [ "2001", "5", "4", "2005", "2013" ], [ "1669", "9", "4", "1981", "2005" ], [ "1630", "2", "1", "1980", "1980" ], [ "1415", "13", "2", "1983", "1986" ], [ "1540", "6", "2", "1987", "2006" ], [ "1474", "22", "1", "1982", "1982" ], [ "1770", "6", "1", "1986", "1986" ], [ "2115", "82", "23", "1980", "2012" ], [ "2275", "1", "1", "1994", "1994" ], [ "1909", "15", "5", "1987", "2013" ] ], "title": "", "original_id": "1632f38bd3383a3944a46d77fb466963" }, { "_id": "f8b582ee8ec287a82d6811e4034a302f", "header": [ "squad no", "name", "position", "league apps", "league goals", "fa cup apps", "fa cup goals", "league cup apps", "league cup goals", "flt apps", "flt goals", "total apps", "total goals" ], "rows": [ [ "2", "andy holdsworth", "df", "43 (1)", "3", "5", "0", "0", "0", "1", "0", "49 (1)", "3" ], [ "3", "joe skarz", "df", "22 (5)", "0", "2 (1)", "0", "1", "0", "1", "0", "26 (6)", "0" ], [ "4", "michael collins", "mf", "35 (6)", "2", "3 (2)", "1", "1", "0", "1", "1", "40 (8)", "4" ], [ "5", "david mirfin", "df", "23 (6)", "1", "3 (1)", "0", "1", "0", "0", "0", "27 (7)", "1" ], [ "6", "nathan clarke", "df", "44", "2", "4", "0", "1", "0", "1", "0", "50", "2" ], [ "7", "chris brandon", "mf", "25 (3)", "2", "2", "1", "1", "0", "1", "0", "29 (3)", "3" ], [ "8", "jon worthington", "mf", "19 (6)", "0", "1", "0", "1", "0", "0", "0", "21 (6)", "0" ], [ "9", "danny cadamarteri", "fw", "10 (2)", "3", "1 (1)", "0", "0", "0", "0", "0", "11 (3)", "3" ], [ "10", "robbie williams", "df", "24 (1)", "2", "3", "0", "0", "0", "0", "0", "27 (1)", "2" ], [ "11", "danny schofield", "mf", "19 (6)", "2", "4 (1)", "0", "1", "0", "1", "0", "25 (7)", "2" ], [ "12", "tom clarke", "df", "2 (1)", "0", "0", "0", "0", "0", "0 (1)", "0", "2 (2)", "0" ], [ "13", "frank sinclair", "df", "28 (1)", "0", "5", "0", "1", "0", "0", "0", "34 (1)", "0" ], [ "14", "phil jevons", "fw", "17 (4)", "7", "3 (1)", "2", "0", "0", "0", "0", "20 (5)", "9" ], [ "14", "richard keogh", "df", "9", "1", "0", "0", "0", "0", "1", "0", "10", "1" ], [ "15", "malvin kamara", "mf", "33 (10)", "3", "3 (2)", "2", "1", "0", "1", "0", "38 (12)", "5" ], [ "16", "ronnie wallwork", "mf", "16", "3", "2", "0", "0", "0", "0", "0", "18", "3" ], [ "17", "matty young", "mf", "4 (4)", "0", "0", "0", "0", "0", "0 (1)", "0", "4 (5)", "0" ], [ "18", "luke beckett", "fw", "25 (11)", "8", "3 (2)", "4", "1", "0", "1", "0", "30 (13)", "12" ], [ "19", "aaron hardy", "df", "5 (1)", "0", "0", "0", "0 (1)", "0", "1", "0", "6 (2)", "0" ], [ "20", "danny racchi", "df", "0 (3)", "0", "0", "0", "0", "0", "0", "0", "0 (3)", "0" ], [ "21", "lucas akins", "fw", "0 (3)", "0", "0", "0", "0", "0", "0 (1)", "0", "0 (4)", "0" ], [ "22", "james berrett", "mf", "10 (5)", "1", "2", "0", "0", "0", "0", "0", "12 (5)", "1" ], [ "23", "andy booth", "fw", "28 (10)", "9", "2 (1)", "0", "0 (1)", "0", "0", "0", "30 (12)", "9" ], [ "27", "matt glennon", "gk", "45", "0", "5", "0", "1", "0", "1", "0", "52", "0" ], [ "28", "alex smithies", "gk", "1 (1)", "0", "0", "0", "0", "0", "0", "0", "1 (1)", "0" ], [ "29", "robert page", "df", "18", "1", "2", "0", "0", "0", "0", "0", "20", "1" ], [ "31", "shane killock", "df", "1", "0", "0", "0", "0", "0", "0", "0", "1", "0" ], [ "32", "daniel broadbent", "fw", "0 (5)", "0", "0", "0", "0", "0", "0", "0", "0 (5)", "0" ] ], "title": "", "original_id": "8bbcb834cd1f78b5fdea62a28c9746d5" }, { "_id": "619e17e815e00993801849fe0207ccda", "header": [ "-", "Soviet Union", "Poland and Danzig", "Finland", "Estonia", "Latvia", "Lithuania" ], "rows": [ [ "1934", "223.0", "78.1", "42.3", "8.2", "21.1", "15.1" ], [ "1935", "201.7", "75.5", "41.4", "13.0", "31.1", "2.0" ], [ "1936", "93.2", "74.0", "46.1", "13.8", "33.2", "9.1" ], [ "1937", "63.1", "80.7", "70.1", "23.7", "45.7", "17.2" ], [ "1938", "47.4", "109.4", "88.6", "24.0", "43.5", "27.6" ], [ "1939", "52.8", "140.8", "88.9", "24.3", "43.6", "27.8" ], [ "*German Imports in millions of Reichsmarks", "*German Imports in millions of Reichsmarks", "*German Imports in millions of Reichsmarks", "*German Imports in millions of Reichsmarks", "*German Imports in millions of Reichsmarks", "*German Imports in millions of Reichsmarks", "*German Imports in millions of Reichsmarks" ] ], "title": "", "original_id": "e1c02ab4252451db510a47d2d9f7f227" }, { "_id": "d444a2de371afcd6f9f13802dc129915", "header": [ "rank", "building", "address", "height", "storeys", "completed" ], "rows": [ [ "1", "la renaissance apartments", "424 spadina crescent e", "-", "24", "1983" ], [ "2", "hallmark place", "311 6th ave n", "-", "27", "1984" ], [ "3", "saskatoon square", "410 22nd st e", "-", "17", "1979" ], [ "4", "the terrace apartments", "315 5th ave n", "-", "22", "1980" ], [ "5", "radisson hotel", "405 20th st e", "-", "20", "1983" ], [ "6", "the view on fifth (formerly milroy apartments)", "320 5th ave n", "-", "22", "1968" ], [ "7", "the luther", "1223 temperance st", "-", "22", "1978" ], [ "8", "marquis towers", "241 5th ave n", "-", "21", "1966" ], [ "9", "carlton towers", "325 5th ave n", "-", "21", "1968" ], [ "10", "delta bessborough", "601 spadina crescent e", "-", "10", "1932" ], [ "11", "the tower at midtown (formerly cn tower)", "201 1st avenue south", "-", "12", "1970" ], [ "12", "saskatoon towers", "125 5th avenue north", "-", "19", "1972" ], [ "13", "avord towers", "606 spadina crescent east", "-", "14", "1964" ] ], "title": "", "original_id": "7ee09fe1d48c37e52e56c6ac5615fb80" }, { "_id": "5fa1431c33770d601142fa4890f9a6d8", "header": [ "contestant", "starting weight (kg)", "final weight (kg)", "weight lost (kg)", "percentage lost", "position (out of eliminated contestants)" ], "rows": [ [ "rick", "172.6", "97.2", "75.4", "43.68%", "1st" ], [ "david", "165.6", "99.2", "66.4", "40.10%", "2nd" ], [ "teneale", "97.4", "58.8", "38.6", "39.63%", "3rd" ], [ "phil", "146.9", "93.0", "53.9", "36.69%", "4th" ], [ "jarna", "118.8", "75.5", "43.3", "36.45%", "5th" ], [ "elise", "104.6", "66.7", "37.9", "36.23%", "6th" ], [ "jenni", "130.6", "84.3", "46.3", "35.45%", "7th" ], [ "phoebe", "116.0", "76.9", "39.1", "33.71%", "8th" ], [ "caitlin", "179.4", "124.8", "54.6", "30.43%", "9th" ], [ "geoff", "161.6", "117.8", "43.8", "27.10%", "10th" ], [ "daina", "105.2", "77.8", "27.4", "26.05%", "11th" ], [ "chris", "128.9", "104.2", "24.7", "19.16%", "12th" ], [ "allan", "155.8", "131.5", "24.3", "15.60%", "13th" ] ], "title": "", "original_id": "c804d4f121627a594222775cc3091419" }, { "_id": "04de564ecdf2b472c1e19f75bfd2ed13", "header": [ "rank", "company", "headquarters", "industry", "sales (billion )", "profits (billion )", "assets (billion )", "market value (billion )" ], "rows": [ [ "1", "exxonmobil", "usa", "oil and gas", "433.5", "41.1", "331.1", "407.4" ], [ "2", "jpmorgan chase", "usa", "banking", "110.8", "19.0", "2265.8", "170.1" ], [ "3", "general electric", "usa", "conglomerate", "147.3", "14.2", "717.2", "213.7" ], [ "4", "royal dutch shell", "netherlands", "oil and gas", "470.2", "30.9", "340.5", "227.6" ], [ "5", "industrial and commercial bank of china", "china", "banking", "82.6", "25.1", "2039.1", "237.4" ], [ "6", "hsbc", "uk", "banking", "102.0", "16.2", "2550.0", "164.3" ], [ "7", "petrochina", "china", "oil and gas", "310.1", "20.6", "304.7", "294.7" ], [ "8", "berkshire hathaway", "usa", "conglomerate", "143.7", "10.3", "392.6", "202.2" ], [ "9", "wells fargo", "usa", "banking", "87.6", "15.9", "1313.9", "178.7" ], [ "10", "petrobras", "brazil", "oil and gas", "145.9", "20.1", "319.4", "180.0" ], [ "11", "bp", "uk", "oil and gas", "375.5", "25.7", "292.5", "147.4" ], [ "12", "chevron", "usa", "oil and gas", "236.3", "26.9", "209.5", "218.0" ], [ "13", "china construction bank", "china", "banking", "68.7", "20.5", "1637.8", "201.9" ], [ "14", "citigroup", "usa", "banking", "102.6", "11.1", "1873.9", "107.5" ], [ "15", "gazprom", "russia", "oil and gas", "117.6", "31.7", "302.6", "159.8" ], [ "16", "walmart", "usa", "retailing", "447.0", "15.7", "193.4", "208.4" ], [ "17", "volkswagen group", "germany", "automotive", "221.9", "21.5", "328.7", "79.5" ], [ "18", "total", "france", "oil and gas", "216.2", "15.9", "213.0", "132.4" ], [ "19", "agricultural bank of china", "china", "banking", "62.4", "14.4", "1563.9", "154.8" ], [ "20", "bnp paribas", "france", "banking", "119.0", "7.9", "2539.1", "61.5" ] ], "title": "", "original_id": "d0a1f61b05fa1d4c1cada744578f10e0" }, { "_id": "854523aaee26f738c9a4f41f12912ed2", "header": [ "Club", "Season", "Division", "League", "League", "FA Cup", "FA Cup", "Total", "Total" ], "rows": [ [ "Club", "Season", "Division", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals" ], [ "Sheffield United", "1945–46", "-", "0", "0", "1", "0", "1", "0" ], [ "Bournemouth & Boscombe Athletic", "1946–47", "Third Division South", "8", "3", "0", "0", "8", "3" ], [ "Lincoln City", "1946–47", "Third Division North", "25", "15", "5", "2", "30", "17" ], [ "Lincoln City", "1947–48", "Third Division North", "41", "32", "1", "0", "42", "32" ], [ "Lincoln City", "1948–49", "Second Division", "19", "8", "0", "0", "19", "8" ], [ "Lincoln City", "Total", "Total", "85", "55", "6", "2", "91", "57" ], [ "Oldham Athletic", "1948–49", "Third Division North", "7", "3", "0", "0", "7", "3" ], [ "Oldham Athletic", "1949–50", "Third Division North", "7", "0", "0", "0", "7", "0" ], [ "Oldham Athletic", "Total", "Total", "14", "3", "0", "0", "14", "3" ], [ "Career Total", "Career Total", "Career Total", "107", "61", "7", "2", "114", "63" ] ], "title": "", "original_id": "3df36d0c0c2a1cb5306ad1457893f64a" }, { "_id": "e01c2b0e800538d2d6850f1a4c12c943", "header": [ "draw", "artist", "song", "points", "place" ], "rows": [ [ "1", "niamh kavanagh", "in your eyes", "118", "1" ], [ "2", "suzanne bushnell", "long gone", "54", "7" ], [ "3", "patricia roe", "if you changed your mind", "75", "3" ], [ "4", "róisín ní haodha", "mo mhúirnín óg", "34", "8" ], [ "5", "champ", "2nd time around", "79", "2" ], [ "6", "off the record", "hold out", "61", "6" ], [ "7", "dav mcnamara", "stay", "67", "4" ], [ "8", "perfect timing", "why aren't we talking anyway", "62", "5" ] ], "title": "", "original_id": "7a156d05e2c0428c864472f280530e0e" }, { "_id": "f2380a5dc70efc21299c4aa9794b56f8", "header": [ "Province", "DC", "LV", "Ven.", "PSI", "PDS" ], "rows": [ [ "Verona", "34.0", "20.6", "6.6", "11.1", "7.1" ], [ "Vicenza", "34.3", "19.5", "12.3", "7.9", "5.6" ], [ "Padua", "34.5", "14.8", "8.1", "9.3", "10.5" ], [ "Treviso", "32.9", "21.5", "7.8", "9.7", "7.5" ], [ "Belluno", "27.4", "27.8", "-", "14.3", "8.0" ], [ "Venice", "23.8", "13.4", "6.6", "13.0", "16.2" ], [ "Rovigo", "29.5", "8.5", "6.1", "14.1", "18.1" ], [ "Veneto", "31.5", "17.8", "7.7", "10.6", "9.9" ] ], "title": "", "original_id": "9294abdf58d2fa73160b9131f16ec61d" }, { "_id": "2b54fc4848539562474908fb89065d82", "header": [ "Unnamed: 0", "district", "province", "region", "ubigeo", "elevation (m)" ], "rows": [ [ "1", "suykutambo", "espinar", "cusco", "80807", "4801" ], [ "2", "condoroma", "espinar", "cusco", "80802", "4737" ], [ "3", "san antonio", "puno", "puno", "210113", "4700" ], [ "4", "ananea", "san antonio de putina", "puno", "211002", "4660" ], [ "5", "morococha", "yauli", "junín", "120805", "4550" ], [ "6", "san antonio de chuca", "caylloma", "arequipa", "40514", "4525" ], [ "7", "santa ana", "castrovirreyna", "huancavelica", "90411", "4473" ], [ "8", "marcapomacocha", "yauli", "junín", "120804", "4415" ], [ "9", "capazo", "el collao", "puno", "210502", "4400" ], [ "10", "paratia", "lampa", "puno", "210707", "4390" ], [ "11", "cojata", "huancané", "puno", "210602", "4355" ], [ "12", "yanacancha", "pasco", "pasco", "190113", "4350" ], [ "13", "chaupimarca", "pasco", "pasco", "190101", "4338" ], [ "14", "macusani", "carabaya", "puno", "210301", "4315" ], [ "15", "huayllay", "pasco", "pasco", "190104", "4310" ], [ "16", "caylloma", "caylloma", "arequipa", "40505", "4310" ], [ "17", "vilavila", "lampa", "puno", "210710", "4300" ], [ "18", "tanta", "yauyos", "lima", "151028", "4278" ], [ "19", "tinyahuarco", "pasco", "pasco", "190111", "4275" ] ], "title": "", "original_id": "ea29c3703787096422647ea08ceb19f9" }, { "_id": "a6baf1305e7eb9b25409e2c8a11485f0", "header": [ "rank", "province", "population", "area", "density" ], "rows": [ [ "1", "san juan", "232333", "3363.8", "69.07" ], [ "2", "la altagracia", "273210", "2998.4", "91.12" ], [ "3", "santiago", "963422", "2806.3", "343.31" ], [ "4", "azua", "214311", "2682.5", "79.89" ], [ "5", "monte plata", "185956", "2601.6", "71.48" ], [ "6", "la vega", "394205", "2292.5", "171.95" ], [ "7", "pedernales", "31587", "2080.5", "15.18" ], [ "8", "independencia", "52589", "2007.4", "26.2" ], [ "9", "monte cristi", "109607", "1885.8", "58.12" ], [ "10", "puerto plata", "321597", "1805.6", "178.11" ], [ "11", "el seibo", "87680", "1788.4", "49.03" ], [ "12", "barahona", "187105", "1660.2", "112.7" ], [ "13", "duarte", "289574", "1649.5", "175.55" ], [ "14", "elías piña", "63029", "1395.5", "45.17" ], [ "15", "hato mayor", "85017", "1319.3", "64.44" ], [ "16", "santo domingo", "2374370", "1302.2", "1823.35" ], [ "17", "baoruco", "97313", "1284.9", "75.74" ], [ "18", "san pedro de macorís", "290458", "1254.3", "231.57" ], [ "19", "san cristóbal", "569930", "1240.6", "459.4" ], [ "20", "maría trinidad sánchez", "140925", "1206.5", "116.8" ], [ "21", "sánchez ramírez", "151392", "1185.8", "127.67" ], [ "22", "santiago rodríguez", "57476", "1147.5", "50.09" ], [ "23", "dajabón", "63955", "1021.3", "62.62" ], [ "24", "monseñor nouel", "165224", "992.0", "166.56" ], [ "25", "samaná", "101494", "862.8", "117.63" ], [ "26", "san josé de ocoa", "59544", "853.4", "69.77" ], [ "27", "espaillat", "231938", "843.0", "275.13" ], [ "28", "valverde", "163030", "823.0", "198.09" ], [ "29", "peravia", "184344", "785.2", "234.77" ], [ "30", "la romana", "245433", "652.1", "376.37" ], [ "31", "hermanas mirabal", "92193", "427.4", "215.71" ], [ "32", "distrito nacional", "965040", "91.6", "10535.37" ] ], "title": "", "original_id": "43c234d2ebb2952c9539118b2183165c" }, { "_id": "132a16f0b8f208ede4ff098eeac2bc85", "header": [ "Country", "Primary", "Middle", "Diploma", "Career-related", "Schools" ], "rows": [ [ "United States", "500", "618", "893", "77", "1,725" ], [ "Canada", "82", "169", "171", "2", "366" ], [ "Australia", "119", "45", "67", "1", "176" ], [ "Ecuador", "9", "9", "253", "0", "253" ], [ "United Kingdom", "14", "13", "125", "13", "132" ], [ "India", "63", "21", "108", "0", "128" ], [ "Mexico", "55", "35", "66", "1", "106" ], [ "China", "37", "27", "83", "1", "101" ], [ "Spain", "11", "14", "93", "0", "95" ], [ "Germany", "23", "11", "67", "2", "71" ], [ "Hong Kong", "32", "9", "29", "1", "56" ], [ "Turkey", "25", "10", "43", "0", "60" ], [ "Argentina", "7", "3", "56", "0", "57" ], [ "Switzerland", "18", "11", "42", "1", "49" ], [ "Indonesia", "32", "14", "29", "0", "48" ], [ "Poland", "6", "8", "40", "0", "45" ], [ "-", "Primary", "Middle", "Diploma", "Career-related", "Schools" ], [ "Total Schools Globally", "1,375", "1,264", "2,997", "118", "4,460" ], [ "Countries & Territories", "104", "97", "140", "18", "151" ] ], "title": "", "original_id": "5111df4c8ab0075f11805502915ebcf7" }, { "_id": "0433a5cfa320e133f0a92411cf5c4845", "header": [ "SR No.", "BR No.", "Date Built", "Date Withdrawn" ], "rows": [ [ "950", "30950", "March 1929", "October 1962" ], [ "951", "30951", "April 1929", "November 1962" ], [ "952", "30952", "May 1929", "November 1962" ], [ "953", "30953", "May 1929", "December 1962" ], [ "954", "30954", "June 1929", "December 1962" ], [ "955", "30955", "July 1929", "December 1962" ], [ "956", "30956", "August 1929", "December 1962" ], [ "957", "30957", "September 1929", "November 1962" ] ], "title": "", "original_id": "7905cb93ae282659886179a302c00327" }, { "_id": "b26705cba62b6fc0be4ea9638029021b", "header": [ "Unnamed: 0", "total freshwater withdrawal", "per capita withdrawal", "domestic use", "industrial use", "agricultural use" ], "rows": [ [ "turkmenistan", "24.65", "5104", "2", "1", "98" ], [ "kazakhstan", "35.0", "2360", "2", "17", "82" ], [ "uzbekistan", "58.34", "2194", "5", "2", "93" ], [ "guyana", "1.64", "2187", "2", "1", "98" ], [ "hungary", "21.03", "2082", "9", "59", "32" ], [ "azerbaijan", "17.25", "2051", "5", "28", "68" ], [ "kyrgyzstan", "10.08", "1916", "3", "3", "94" ], [ "tajikistan", "11.96", "1837", "4", "5", "92" ], [ "usa", "477.0", "1600", "13", "46", "41" ], [ "suriname", "0.67", "1489", "4", "3", "93" ], [ "iraq", "42.7", "1482", "3", "5", "92" ], [ "canada", "44.72", "1386", "20", "69", "12" ], [ "thailand", "82.75", "1288", "2", "2", "95" ], [ "ecuador", "16.98", "1283", "12", "5", "82" ] ], "title": "", "original_id": "3d4ce757ccae9604c0351525427960e7" }, { "_id": "d4f32ec4dbbe875f09613dcb039fbd3e", "header": [ "SR No.", "BR No.", "Date Built", "Date Withdrawn" ], "rows": [ [ "530", "30530", "January 1938", "December 1964" ], [ "531", "30531", "June 1938", "July 1964" ], [ "532", "30532", "June 1938", "January 1964" ], [ "533", "30533", "July 1938", "March 1963" ], [ "534", "30534", "August 1938", "December 1962" ], [ "535", "30535", "September 1938", "April 1965" ], [ "536", "30536", "October 1938", "January 1964" ], [ "537", "30537", "October 1938", "December 1962" ], [ "538", "30538", "November 1938", "July 1963" ], [ "539", "30539", "December 1938", "January 1963" ], [ "540", "30540", "December 1938", "November 1962" ], [ "541", "30541", "January 1939", "November 1964" ], [ "542", "30542", "February 1939", "December 1964" ], [ "543", "30543", "March 1939", "December 1964" ], [ "544", "30544", "April 1939", "January 1964" ], [ "545", "30545", "June 1939", "May 1965" ], [ "546", "30546", "June 1939", "May 1964" ], [ "547", "30547", "July 1939", "January 1964" ], [ "548", "30548", "August 1939", "March 1965" ], [ "549", "30549", "September 1939", "July 1963" ] ], "title": "", "original_id": "b68a92a9b123ed32ddae96e5ab1e3428" }, { "_id": "dbe9516049a0bbd02f0887e4449a262e", "header": [ "region", "enrolled men", "enrolled women", "enrolled total", "men of voting age", "women of voting age", "voting age population", "e / vap ratio men", "e / vap ratio women", "e / vap ratio total" ], "rows": [ [ "arica and parinacota", "86777", "83744", "170521", "61482", "69090", "130572", "141.1%", "121.2%", "130.6%" ], [ "tarapacá", "110862", "105991", "216853", "123726", "112390", "236116", "89.6%", "94.3%", "91.8%" ], [ "antofagasta", "207865", "204518", "412383", "220600", "199989", "420590", "94.2%", "102.3%", "98.0%" ], [ "atacama", "110406", "108717", "219123", "103866", "99277", "203143", "106.3%", "109.5%", "107.9%" ], [ "coquimbo", "257793", "270799", "528592", "264626", "275644", "540270", "97.4%", "98.2%", "97.8%" ], [ "valparaíso", "703110", "752801", "1455911", "655608", "693352", "1348960", "107.2%", "108.6%", "107.9%" ], [ "santiago", "2508422", "2743434", "5251856", "2503209", "2700807", "5204016", "100.2%", "101.6%", "100.9%" ], [ "o'higgins", "341873", "348904", "690777", "333154", "329673", "662826", "102.6%", "105.8%", "104.2%" ], [ "maule", "393346", "407300", "800646", "371827", "382371", "754199", "105.8%", "106.5%", "106.2%" ], [ "biobío", "789249", "837039", "1626288", "740687", "780951", "1521638", "106.6%", "107.2%", "106.9%" ], [ "araucanía", "396403", "409163", "805566", "349552", "364606", "714158", "113.4%", "112.2%", "112.8%" ], [ "los ríos", "158554", "162596", "321150", "138550", "142148", "280698", "114.4%", "114.4%", "114.4%" ], [ "los lagos", "327881", "333800", "661681", "316363", "306929", "623292", "103.6%", "108.8%", "106.2%" ], [ "aisén", "47425", "42583", "90008", "40412", "35537", "75950", "117.4%", "119.8%", "118.5%" ], [ "magallanes", "81474", "71255", "152729", "63257", "56295", "119552", "128.8%", "126.6%", "127.8%" ] ], "title": "", "original_id": "a8f73d171ce1a708942eea5752a1eb05" }, { "_id": "3e613a61878bd55cbd32ba3a9d921cfd", "header": [ "name", "faith", "type", "intake", "dcsf number", "ofsted number" ], "rows": [ [ "boxmoor", "-", "primary", "30", "2041", "117107" ], [ "chaulden", "-", "infants", "50", "2193", "117202" ], [ "chaulden", "-", "junior", "60", "2185", "117198" ], [ "gade valley", "-", "jmi", "30", "2274", "117249" ], [ "galley hill", "-", "primary", "45", "3990", "135224" ], [ "heath lane", "-", "nursery", "80", "1009", "117070" ], [ "micklem", "-", "primary", "30", "2243", "117231" ], [ "pixies hill", "-", "primary", "30", "2293", "117256" ], [ "st cuthbert mayne", "rc", "junior", "60", "3386", "117468" ], [ "st rose 's", "rc", "infants", "60", "3409", "117484" ], [ "south hill", "-", "primary", "30", "2047", "117110" ] ], "title": "", "original_id": "566c9200cea18c995a6c5cfb3ef59f71" }, { "_id": "fdb401c840777ab5319938dc83ffabf7", "header": [ "place", "code", "area (km 2 )", "population", "most spoken language" ], "rows": [ [ "addo elephant national park", "20602", "1.08", "90", "xhosa" ], [ "addo", "20601", "3.21", "1752", "afrikaans" ], [ "barsheba", "20603", "0.61", "517", "xhosa" ], [ "bontrug", "20604", "2.33", "6806", "xhosa" ], [ "enon", "20605", "0.4", "782", "afrikaans" ], [ "kirkwood", "20606", "3.07", "2749", "afrikaans" ], [ "kwazenzele", "20607", "3.62", "3733", "xhosa" ], [ "nomathamsanqa", "20608", "1.53", "9266", "xhosa" ], [ "paterson", "20609", "0.22", "671", "afrikaans" ], [ "remainder of the municipality", "20610", "3491.83", "15218", "xhosa" ] ], "title": "", "original_id": "6e909081b29bd08e4a7c528b6b5e1d84" }, { "_id": "e6027c98b7153eec4722e2ca1dd5ab5b", "header": [ "years covered", "all bills sponsored", "all amendments sponsored", "all bills cosponsored", "all amendments cosponsored", "bills originally cosponsored", "amendments originally cosponsored" ], "rows": [ [ "2007 - 08", "22", "16", "133", "74", "101", "57" ], [ "2005 - 06", "75", "68", "152", "42", "113", "36" ], [ "2003 - 04", "77", "112", "181", "47", "116", "39" ], [ "2001 - 02", "54", "178", "121", "55", "97", "53" ], [ "1999 - 00", "102", "65", "175", "37", "110", "33" ], [ "1997 - 98", "74", "150", "147", "59", "79", "50" ], [ "1995 - 96", "80", "137", "118", "61", "66", "56" ], [ "1993 - 94", "53", "91", "201", "89", "98", "82" ], [ "1991 - 92", "159", "52", "353", "66", "175", "63" ], [ "1989 - 90", "39", "24", "247", "86", "150", "81" ], [ "1987 - 88", "24", "15", "342", "79", "171", "76" ], [ "1985 - 86", "12", "10", "335", "0", "117", "0" ], [ "1983 - 84", "6", "1", "286", "0", "107", "0" ] ], "title": "", "original_id": "7dcf69b8604e3dd7f98f12ad742452c4" }, { "_id": "d9add5665185412c2901c73a4fdce659", "header": [ "Month", "M36", "M36B1", "M36B2" ], "rows": [ [ "April 1944", "25", "0", "0" ], [ "May 1944", "100", "0", "0" ], [ "June 1944", "120", "0", "0" ], [ "July 1944", "155", "0", "0" ], [ "August 1944", "100", "0", "0" ], [ "October 1944", "75", "50", "0" ], [ "November 1944", "290", "93", "0" ], [ "December 1944", "348", "44", "0" ], [ "May 1945", "10", "0", "50" ], [ "Post-war", "190", "0", "674" ], [ "Total", "1,413", "187", "724" ] ], "title": "", "original_id": "50e30b3aec81d556db90cb2055da773b" }, { "_id": "ef18503df7d17b7b9c8ac1f56e0ff474", "header": [ "peak", "country", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "jbel toubkal", "morocco", "4167", "3755", "412" ], [ "m'goun", "morocco", "4071", "1904", "2167" ], [ "koudiet tirbirhine", "morocco", "2456", "1901", "555" ], [ "lalla khedidja", "algeria", "2308", "1720", "588" ], [ "adrar bou nasser", "morocco", "3340", "1642", "1698" ], [ "djebel chãlia", "algeria", "2328", "1612", "716" ], [ "jbel igdet", "morocco", "3615", "1609", "2006" ] ], "title": "", "original_id": "85e54c4224379fa75e8bb916f8014b3c" }, { "_id": "dbfe6e083b20387bdb8ff758f18162bc", "header": [ "Unnamed: 0", "episode", "air date", "rating", "share", "rating / share 1849", "viewers (m)", "timeslot rank", "night rank", "overall rank" ], "rows": [ [ "1", "pilot", "tuesday , march 4 , 2008", "8.2", "12", "4.5 / 11", "13.47", "1", "2", "6" ], [ "2", "golden boy", "thursday , march 6 , 2008", "6.2", "10", "3.5 / 8", "10.12", "2", "4", "15" ], [ "3", "soldier 's heart", "monday , march 10 , 2008", "5.5", "8", "2.5 / 6", "8.78", "3", "6", "20" ], [ "4", "honor", "monday , march 17 , 2008", "4.5", "7", "2.3 / 6", "7.3", "4", "10", "37" ], [ "5", "keep the change", "monday , march 24 , 2008", "3.8", "6", "2.0 / 5", "6.19", "4", "11", "52" ], [ "6", "legacy", "monday , march 31 , 2008", "4.3", "6", "2.1 / 5", "6.63", "4", "10", "43" ], [ "7", "reclassified", "monday , april 7 , 2008", "4.6", "7", "2.2 / 5", "7.44", "4", "n / a", "37" ] ], "title": "", "original_id": "0595618d0746974966d38bb82fc99faf" }, { "_id": "51e0dabf094c698d28e08c7bb2ce393f", "header": [ "draw", "artist", "song", "jury votes", "televotes", "total votes", "result" ], "rows": [ [ "1", "diqesi", "subiré", "5", "4", "9", "out" ], [ "2", "roel", "y ahora dices", "6", "3", "9", "out" ], [ "3", "salva ortega", "lujuria", "7", "7", "14", "second chance >final" ], [ "4", "soraya", "la noche es para mí", "12", "12", "24", "final" ], [ "5", "virginia", "true love", "10", "10", "20", "final" ], [ "6", "calipop", "burbuja", "2", "2", "4", "out" ], [ "7", "ángeles vela", "vístete de primavera", "4", "5", "9", "out" ], [ "8", "jorge gonzález", "si yo vengo a enamorarte", "8", "8", "16", "final" ], [ "9", "electronikboy", "mon petit oiseau", "1", "1", "2", "out" ] ], "title": "", "original_id": "a79cd8ec27af6973720047fe8cd8e217" }, { "_id": "6de538c2086cfcd1de65451d56888048", "header": [ "Season", "Episodes", "Season Premiere", "Season Finale" ], "rows": [ [ "1", "20", "March 4, 2006", "May 13, 2006" ], [ "2", "52", "October 7, 2006", "July 16, 2007" ], [ "3", "44", "October 15, 2007", "June 2, 2008" ], [ "4", "48", "October 13, 2008", "May 11, 2009" ], [ "5", "40", "October 12, 2009", "June 14, 2010" ], [ "6", "20", "September 6, 2010", "December 6, 2010" ], [ "7", "8", "October 29, 2013", "December 17, 2013" ] ], "title": "", "original_id": "42761f0622ad3513894ab3472e8982bf" }, { "_id": "e938b6bbc8e4035eaeb1fc53ed1fe0d0", "header": [ "party", "administrative panel", "agricultural panel", "cultural and educational panel", "industrial and commercial panel", "labour panel", "national university of ireland", "university of dublin", "nominated by the taoiseach", "total" ], "rows": [ [ "fianna fáil", "2", "4", "2", "3", "5", "0", "0", "9", "25" ], [ "fine gael", "3", "4", "3", "3", "2", "1", "0", "0", "16" ], [ "labour party", "1", "1", "0", "1", "2", "0", "0", "0", "5" ], [ "clann na talmhan", "0", "1", "0", "0", "0", "0", "0", "0", "1" ], [ "independent", "1", "0", "0", "1", "1", "2", "3", "1", "9" ], [ "total", "7", "11", "5", "9", "11", "3", "3", "11", "60" ] ], "title": "", "original_id": "4c01f2bd62606606466e3bb1cb304423" }, { "_id": "2a21701bc5a848960dbe85e34af4492d", "header": [ "peak", "country", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "mount stanley", "democratic republic of the congo / uganda", "5109", "3951", "1158" ], [ "mount karisimbi", "rwanda / democratic republic of the congo", "4507", "3312", "1195" ], [ "kinyeti", "south sudan", "3187", "2120", "1067" ], [ "emogadong", "south sudan", "2623", "1730", "893" ], [ "kabobo", "democratic republic of the congo", "2725", "1604", "1121" ], [ "mont mohi", "democratic republic of the congo", "3480", "1592", "1888" ], [ "wuhevi", "democratic republic of the congo", "3095", "1570", "1525" ], [ "mount muhabura", "rwanda / uganda", "4127", "1530", "2597" ] ], "title": "", "original_id": "c8a0829ce6f11dd2af255ba6d1e54552" }, { "_id": "df4d1d05e6bd35298b23c288ff0c4f2f", "header": [ "cost", "2400 kwh / kwp y", "2200 kwh / kwp y", "2000 kwh / kwp y", "1800 kwh / kwp y", "1600 kwh / kwp y", "1400 kwh / kwp y", "1200 kwh / kwp y", "1000 kwh / kwp y", "800 kwh / kwp y" ], "rows": [ [ "200 / kwp", "0.8", "0.9", "1.0", "1.1", "1.3", "1.4", "1.7", "2.0", "2.5" ], [ "600 / kwp", "2.5", "2.7", "3.0", "3.3", "3.8", "4.3", "5.0", "6.0", "7.5" ], [ "1000 / kwp", "4.2", "4.5", "5.0", "5.6", "6.3", "7.1", "8.3", "10.0", "12.5" ], [ "1400 / kwp", "5.8", "6.4", "7.0", "7.8", "8.8", "10.0", "11.7", "14.0", "17.5" ], [ "1800 / kwp", "7.5", "8.2", "9.0", "10.0", "11.3", "12.9", "15.0", "18.0", "22.5" ], [ "2200 / kwp", "9.2", "10.0", "11.0", "12.2", "13.8", "15.7", "18.3", "22.0", "27.5" ], [ "2600 / kwp", "10.8", "11.8", "13.0", "14.4", "16.3", "18.6", "21.7", "26.0", "32.5" ], [ "3000 / kwp", "12.5", "13.6", "15.0", "16.7", "18.8", "21.4", "25.0", "30.0", "37.5" ], [ "3400 / kwp", "14.2", "15.5", "17.0", "18.9", "21.3", "24.3", "28.3", "34.0", "42.5" ], [ "3800 / kwp", "15.8", "17.3", "19.0", "21.1", "23.8", "27.1", "31.7", "38.0", "47.5" ], [ "4200 / kwp", "17.5", "19.1", "21.0", "23.3", "26.3", "30.0", "35.0", "42.0", "52.5" ], [ "4600 / kwp", "19.2", "20.9", "23.0", "25.6", "28.8", "32.9", "38.3", "46.0", "57.5" ] ], "title": "", "original_id": "73a06f4dbbb1534fa4a19027c6802804" }, { "_id": "12d2a27f8f2c820ca6626be6b70ab5e9", "header": [ "rank", "country", "2009", "2010", "2011" ], "rows": [ [ "1.0", "china", "8038703", "8651831", "9174280" ], [ "2.0", "italy", "8242500", "7787800", "7115500" ], [ "3.0", "united states", "6629198", "6777731", "6756449" ], [ "4.0", "france", "6101525", "5794433", "6588904" ], [ "5.0", "spain", "5535333", "6107617", "5809315" ], [ "6.0", "turkey", "4264720", "4255000", "4296351" ], [ "7.0", "chile", "2600000", "2903000", "3149380" ], [ "8.0", "argentina", "2181567", "2616613", "2750000" ], [ "9.0", "iran", "2305000", "2225000", "2240000" ], [ "10.0", "australia", "1797012", "1684345", "1715717" ], [ null, "world", "58521410", "58292101", "58500118" ] ], "title": "", "original_id": "78701cee63f205291b864544107432ef" }, { "_id": "de319d05bfe79146ba016a50a6111ed1", "header": [ "member countries", "population", "area (km square)", "gdp (billion us)", "gdp per capita (us)" ], "rows": [ [ "belgium", "9052707", "30528", "58.316", "46878" ], [ "france", "44788852", "674843", "312.966", "40690" ], [ "west germany", "54292038", "248717", "400.554", "41168" ], [ "italy", "49476000", "301336", "265.192", "30116" ], [ "luxembourg", "310291", "2586", "2.938", "113533" ], [ "netherlands", "11186847", "41526", "83.351", "50355" ], [ "ec6 (1958)", "169106736", "1299536", "1123.317", "6643" ] ], "title": "", "original_id": "8869ae21589a1ab50a40faf5d85d8eaf" }, { "_id": "86e838cab7ad80f58d8a11ffdd12231b", "header": [ "draw", "language", "song", "english translation", "place", "points" ], "rows": [ [ "1", "english", "wait until the weekend comes", "-", "6", "91" ], [ "2", "finnish", "eläköön elämä", "long live life", "9", "58" ], [ "3", "greek", "to katalava arga (το κατάλαβα αργά)", "i realised it too late", "16", "15" ], [ "4", "danish", "sku' du spørg' fra no'en", "what business is it of yours", "11", "41" ], [ "5", "spanish", "la fiesta terminó", "the party 's over", "14", "36" ], [ "6", "french", "femme dans ses rêves aussi", "woman in her dreams too", "10", "56" ], [ "7", "turkish", "didai didai dai", "-", "14", "36" ], [ "8", "dutch", "laat me nu gaan", "let me go now", "19", "7" ], [ "9", "portuguese", "penso em ti , eu sei", "thinking of you , i know", "18", "9" ], [ "10", "german", "für alle", "for everyone", "2", "105" ], [ "11", "hebrew", "olé , olé (עולה , עולה)", "going up and up", "5", "93" ], [ "12", "italian", "magic oh magic", "-", "7", "78" ], [ "13", "norwegian", "la det swinge", "let it swing", "1", "123" ], [ "14", "english", "love is", "-", "4", "100" ], [ "15", "german", "piano , piano", "slowly , slowly", "12", "39" ], [ "16", "swedish", "bra vibrationer", "good vibrations", "3", "103" ], [ "17", "german", "kinder dieser welt", "children of this world", "8", "60" ], [ "18", "french", "children , kinder , enfants", "children", "13", "37" ], [ "19", "greek", "miazoume (μοιάζουμε)", "we are alike", "16", "15" ] ], "title": "", "original_id": "1882bbbc5b4f7879c02b463929d39f67" }, { "_id": "3a9954cb3c847ed889eb655db9e0ccbc", "header": [ "Rank", "Death toll", "Magnitude", "Location", "Depth (km)", "Date" ], "rows": [ [ "1", "60,000", "7.5", "Pakistan Baluchistan, Pakistan", "25.0", "May 30" ], [ "2", "3,276", "7.0", "Taiwan Taichung City, Taiwan", "15.0", "April 20" ], [ "3", "2,746", "6.5", "Taiwan Miaoli County, Taiwan", "30.0", "July 16" ], [ "4", "690", "6.4", "Iran Mazandaran Province, Iran", "15.0", "April 11" ], [ "5", "540", "6.0", "Turkey Agri Province, Turkey", "35.0", "May 1" ], [ "6", "100", "6.0", "China Sichuan Province, China", "35.0", "December 18" ], [ "7", "60", "6.0", "Iran Mazandaran Province, Iran", "35.0", "March 5" ], [ "8", "51", "6.8", "Greece southern Aegean Sea, Greece", "80.0", "February 25" ] ], "title": "", "original_id": "dd778956ba0b5266e7a32a45bf8ab123" }, { "_id": "0dac20fe5f692925af23de60b0a85b80", "header": [ "rank (2012)", "rank (2010)", "employer", "industry", "2012 employees (total)", "2010 employees (total)", "2007 employees (total)", "head office" ], "rows": [ [ "1", "1", "alberta health services", "healthcare", "99400", "92200", "see note", "edmonton" ], [ "2", "2", "canada safeway limited", "wholesale and retail trade", "30000", "30000", "34318", "calgary" ], [ "3", "6", "agrium inc", "agri - business", "14800", "11153", "n / a", "calgary" ], [ "4", "7", "university of alberta", "education", "14500", "10800", "11000", "edmonton" ], [ "5", "4", "canadian pacific railway", "transportation", "14169", "14970", "15232", "calgary" ], [ "6", "5", "suncor energy", "petroleum resource industry", "13026", "12978", "5800", "calgary" ], [ "7", "9", "shaw communications", "communications", "12500", "10000", "8985", "calgary" ], [ "8", "8", "flint energy services ltd", "energy", "11211", "10280", "6169", "calgary" ], [ "9", "11", "stantec inc", "professional services", "11100", "9300", "n / a", "edmonton" ], [ "10", "12", "calgary board of education", "public education", "9106", "9278", "10972", "calgary" ] ], "title": "", "original_id": "251b26a4fad061d606ee5854eae48f42" }, { "_id": "7633b65a5e25fc45e2f9264f08c96990", "header": [ "team", "wins", "losses", "ties", "win pct" ], "rows": [ [ "arizona cardinals", "2", "1", "0", "0.667" ], [ "atlanta falcons", "3", "1", "1", "0.7" ], [ "baltimore ravens", "13", "9", "0", "0.591" ], [ "buffalo bills", "5", "2", "0", "0.714" ], [ "carolina panthers", "3", "1", "0", "0.75" ], [ "chicago bears", "3", "1", "0", "0.75" ], [ "cincinnati bengals", "21", "9", "0", "0.7" ], [ "cleveland browns", "19", "5", "0", "0.792" ], [ "dallas cowboys", "1", "2", "0", "0.333" ], [ "denver broncos", "1", "3", "0", "0.25" ], [ "detroit lions", "4", "1", "0", "0.8" ], [ "green bay packers", "2", "2", "0", "0.5" ], [ "houston texans", "1", "1", "0", "0.5" ], [ "indianapolis colts", "4", "1", "0", "0.8" ], [ "jacksonville jaguars", "8", "10", "0", "0.444" ], [ "kansas city chiefs", "5", "3", "0", "0.625" ], [ "miami dolphins", "5", "2", "0", "0.714" ], [ "minnesota vikings", "2", "2", "0", "0.5" ], [ "new england patriots", "4", "3", "0", "0.571" ], [ "new orleans saints", "2", "1", "0", "0.667" ], [ "new york giants", "2", "1", "0", "0.667" ], [ "new york jets", "4", "1", "0", "0.8" ], [ "oakland raiders", "5", "2", "0", "0.714" ], [ "philadelphia eagles", "2", "2", "0", "0.5" ], [ "st louis rams", "1", "2", "0", "0.333" ], [ "san diego chargers", "7", "2", "0", "0.778" ], [ "san francisco 49ers", "1", "3", "0", "0.25" ], [ "seattle seahawks", "2", "4", "0", "0.333" ], [ "tampa bay buccaneers", "3", "1", "0", "0.75" ], [ "tennessee titans", "11", "12", "0", "0.478" ], [ "washington redskins", "3", "0", "0", "1.0" ], [ "totals :", "149", "90", "1", "0.623" ] ], "title": "", "original_id": "4b4ff8f17963fa7ba3edd5cae2c32abb" }, { "_id": "b5a1abdd82e581122fe1f9dca66ec875", "header": [ "event", "date", "dp / da", "np / nnp", "cope", "acdp", "others" ], "rows": [ [ "1994 election", "27 april 1994", "3", "23", "-", "1", "1" ], [ "1999 election", "2 june 1999", "5", "17", "-", "1", "1" ], [ "2003 floor - crossing", "4 april 2003", "7", "10", "-", "2", "1" ], [ "2004 election", "14 april 2004", "12", "5", "-", "2", "1" ], [ "2005 floor - crossing", "15 september 2005", "13", "-", "-", "2", "2" ], [ "2007 floor - crossing", "15 september 2007", "11", "-", "-", "2", "1" ], [ "2009 election", "22 april 2009", "22", "-", "3", "1", "0" ] ], "title": "", "original_id": "c04b6beeac5ae498a58265f212f78fbb" }, { "_id": "587710d0e896ea5870bd307fd6cdcd31", "header": [ "year", "theme", "artist", "finish", "issue price", "total mintage" ], "rows": [ [ "2002", "golden tulip", "anthony testa", "proof (selectively gold plated)", "24.95", "19986" ], [ "2003", "golden daffodil", "christie paquet", "proof (selectively gold plated)", "34.95", "36293" ], [ "2004", "golden easter lily", "christie paquet", "proof (selectively gold plated)", "34.95", "23486" ], [ "2005", "golden rose", "christie paquet", "proof (selectively gold plated)", "34.95", "23000" ], [ "2006", "golden daisy", "christie paquet", "proof (selectively gold plated)", "34.95", "23000" ], [ "2007", "golden forget - me - not", "christie paquet", "proof (selectively gold plated)", "38.95", "20000" ] ], "title": "", "original_id": "5eb7d24afce65f474b46fe270f680c2e" }, { "_id": "977ac6ed4e8f11fd3afae71c9787c1e2", "header": [ "date of sterilization", "age 10 - 19", "age 20 - 29", "age 30 - 39", "age 40 - 49", "age 50 - 59", "age unknown", "total" ], "rows": [ [ "jan 1929 - jun 1935", "87", "87", "42", "4", "2", "1", "223" ], [ "jul 1935 - jun 1940", "380", "205", "112", "11", "1", "0", "709" ], [ "jul 1940 - jun 1950", "727", "593", "249", "36", "0", "1", "1606" ], [ "jul 1950 - jun 1960", "936", "1201", "745", "93", "8", "0", "2983" ], [ "jul 1960 - dec 1968", "686", "717", "260", "23", "1", "0", "1687" ], [ "jan 1969 - dec 1974", "174", "118", "26", "2", "0", "0", "320" ] ], "title": "", "original_id": "ca00171fdb93e37efc302c26a7d0ec28" }, { "_id": "73ddb356678fa535ff2ef1da3930db6b", "header": [ "code", "type", "name", "area (km 2 )", "population", "regional county municipality", "region" ], "rows": [ [ "95005", "vl", "tadoussac", "74.59", "832", "la haute - côte - nord", "9" ], [ "95010", "m", "sacré - cur", "341.74", "2093", "la haute - côte - nord", "9" ], [ "95018", "m", "les bergeronnes", "291.89", "660", "la haute - côte - nord", "9" ], [ "95025", "m", "les escoumins", "267.33", "2031", "la haute - côte - nord", "9" ], [ "95032", "m", "longue - rive", "295.35", "1317", "la haute - côte - nord", "9" ], [ "95040", "m", "portneuf - sur - mer", "241.23", "885", "la haute - côte - nord", "9" ], [ "95045", "v", "forestville", "241.73", "3637", "la haute - côte - nord", "9" ], [ "95050", "m", "colombier", "313.2", "868", "la haute - côte - nord", "9" ], [ "96005", "vl", "baie - trinité", "536.33", "569", "manicouagan", "9" ], [ "96010", "vl", "godbout", "204.34", "318", "manicouagan", "9" ], [ "96015", "m", "franquelin", "529.84", "341", "manicouagan", "9" ], [ "96020", "v", "baie - comeau", "371.69", "22613", "manicouagan", "9" ], [ "96025", "vl", "pointe - lebel", "91.16", "1943", "manicouagan", "9" ], [ "96030", "vl", "pointe - aux - outardes", "71.56", "1389", "manicouagan", "9" ], [ "96035", "vl", "chute - aux - outardes", "8.31", "1882", "manicouagan", "9" ], [ "96040", "p", "ragueneau", "215.92", "1529", "manicouagan", "9" ], [ "97007", "v", "sept - îles", "1969.42", "25276", "sept - rivières", "9" ], [ "97022", "v", "port - cartier", "1073.7", "6865", "sept - rivières", "9" ], [ "97035", "v", "fermont", "497.45", "2487", "caniapiscau", "9" ], [ "97040", "v", "schefferville", "39.02", "249", "caniapiscau", "9" ], [ "98005", "m", "blanc - sablon", "254.49", "1293", "le golfe - du - saint - laurent", "9" ], [ "98010", "m", "bonne - espérance", "721.28", "839", "le golfe - du - saint - laurent", "9" ], [ "98012", "m", "saint - augustin", "1435.82", "853", "le golfe - du - saint - laurent", "9" ], [ "98014", "m", "gros - mécatina", "961.46", "538", "le golfe - du - saint - laurent", "9" ], [ "98015", "m", "côte - nord - du - golfe - du - saint - laurent", "2783.59", "1155", "le golfe - du - saint - laurent", "9" ], [ "98020", "m", "l'île - d'anticosti", "7923.16", "263", "minganie", "9" ], [ "98025", "ct", "natashquan", "193.2", "374", "minganie", "9" ], [ "98030", "m", "aguanish", "594.4", "312", "minganie", "9" ], [ "98035", "m", "baie - johan - beetz", "425.31", "85", "minganie", "9" ], [ "98040", "m", "havre - saint - pierre", "3779.89", "3240", "minganie", "9" ], [ "98045", "m", "longue - pointe - de - mingan", "417.6", "501", "minganie", "9" ], [ "98050", "m", "rivière - saint - jean", "652.54", "284", "minganie", "9" ], [ "98055", "m", "rivière - au - tonnerre", "1331.17", "365", "minganie", "9" ] ], "title": "", "original_id": "092c7277b67f6da76a00a049f8ede3b9" }, { "_id": "fc048e1cd7a7f48d16a64e9bb9eb042f", "header": [ "Rank", "Magnitude", "Death toll", "Location", "Depth (km)", "MMI", "Date" ], "rows": [ [ "1", "8.3", "0", "Russia Russia", "608.9", "V", "May 24" ], [ "2", "8.0", "13", "Solomon Islands Solomon Islands", "29", "VIII", "February 7" ], [ "3", "7.7", "35", "Iran Iran", "82", "VII", "April 16" ], [ "3", "7.7", "825", "Pakistan Pakistan", "20.0", "IX", "September 24" ], [ "3", "7.7", "0", "Antarctica Coronation Island, Antarctica", "10", "VII", "November 17" ], [ "6", "7.5", "0", "United States United States", "9.9", "VI", "January 5" ], [ "7", "7.4", "0", "Tonga Tonga", "171.4", "V", "May 23" ], [ "8", "7.3", "0", "Papua New Guinea Papua New Guinea", "386.3", "IV", "July 7" ], [ "8", "7.3", "0", "South Georgia and the South Sandwich Islands South Georgia and the South Sandwich Islands", "31.3", "VI", "July 15" ], [ "10", "7.2", "0", "Russia Russia", "123.3", "VII", "April 19" ], [ "11", "7.1", "0", "Solomon Islands Solomon Islands", "10.1", "VI", "February 6" ], [ "11", "7.1", "0", "Solomon Islands Santa Cruz Islands", "21", "VII", "February 8" ], [ "11", "7.1", "3", "Peru Peru", "40", "VIII", "September 25" ], [ "11", "7.1", "222", "Philippines Philippines", "20.0", "IX", "October 15" ], [ "11", "7.1", "0", "Japan Japan", "26.1", "III", "October 25" ], [ "16", "7.0", "0", "Solomon Islands Solomon Islands", "10.1", "VII", "February 6" ], [ "16", "7.0", "0", "Indonesia Indonesia", "66", "VI", "April 6" ], [ "16", "7.0", "0", "United States United States", "33.5", "VI", "August 30" ], [ "16", "7.0", "0", "Falkland Islands Falkland Islands", "10", "I", "November 25" ] ], "title": "", "original_id": "3e5bae52d54ea5a02750c0f0bb794736" }, { "_id": "cadada2b3d6f45b1f75b542ab5bca024", "header": [ "Year", "Award", "Category", "Nominated Work", "Result", "Notes" ], "rows": [ [ "2017", "Global Music Awards", "Jazz Music Album", "Bein' Green", "Silver Medal", "-" ], [ "2017", "Global Music Awards", "Album", "Bein' Green", "Silver Medal", "-" ], [ "2017", "Hollywood Music in Media Awards", "Jazz", "Sunny Morning", "Nominated", "edition #8 (2017)" ], [ "2017", "Radio Music Awards", "Jazz", "Sunny Morning", "Won", "-" ], [ "2017", "Radio Music Awards", "Jazz", "Flying Away", "Won", "-" ], [ "2018", "16th Independent Music Awards", "Jazz", "Funky Party", "Won", "Vox Populi Award" ], [ "2018", "Indie Music Channel Awards", "Jazz Song", "Flying Away", "Won", "-" ], [ "2018", "Indie Music Channel Awards", "Jazz Recording", "Tears For Niro", "Won", "-" ], [ "2018", "Indie Music Channel Awards", "Jazz Instrumentalist", "Funky Party", "Won", "-" ], [ "2018", "Indie Music Channel Awards", "Jazz Producer", "Cabriolet", "Won", "-" ], [ "2018", "Indie Music Channel Awards", "Jazz Video", "Sunny Morning", "Won", "Natalia Vlaskina co-winner" ], [ "2018", "Indie Music Channel Awards", "Best New Male Artist of the Year", "-", "Won", "-" ], [ "2018", "Indie Music Channel Awards", "Recording of the Year", "Tears For Niro", "-", "-" ], [ "2018", "Hollywood Music in Media Awards", "Jazz", "Funky Party", "Nominated", "edition #9 (2018)" ], [ "2018", "Annual TheMothFM Jazz Awards (GMFM -DB Radio Group)", "Best Overall Artist 2018", "-", "Winner", "-" ], [ "2018", "UK Songwriting Contest 2018", "Jazz/Blues", "Flying Away", "Finalist", "-" ], [ "2018", "UK Songwriting Contest 2018", "Jazz/Blues", "Funky Party", "Finalist", "-" ], [ "2018", "UK Songwriting Contest 2018", "Jazz/Blues", "Tears For Niro", "Finalist", "-" ], [ "2018", "UK Songwriting Contest 2018", "Jazz/Blues", "With You All The Clouds Go Away", "Finalist", "-" ], [ "2019", "17th Independent Music Awards 2019", "Instrumental", "Lullaby of Christmas", "nominee", "Winner TBA in June 2019" ] ], "title": "", "original_id": "b19bad70a2dd3e356e8c6d038fa2bfd3" }, { "_id": "35d97569c1d80746eff0b638b32b9623", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "1981", "Maghreb Championships", "Algiers, Algeria", "2nd", "20,000 m walk", "1:34:07.4" ], [ "1981", "Arab Championships", "Tunis, Tunisia", "2nd", "20 km walk", "1:41:40" ], [ "1983", "Maghreb Championships", "Casablanca, Morocco", "2nd", "20,000 m walk", "1:32:38.1" ], [ "1983", "World Championships", "Helsinki, Finland", "35th", "20 km walk", "1:29:53" ], [ "1984", "Olympic Games", "Los Angeles, United States", "26th", "20 km walk", "1:31:24" ], [ "1984", "African Championships", "Rabat, Morocco", "1st", "20 km walk", "1:30:02" ], [ "1985", "World Race Walking Cup", "St John's, Isle of Man", "37th", "20 km walk", "1:32:51" ], [ "1985", "African Championships", "Cairo, Egypt", "1st", "20 km walk", "1:33:28" ], [ "1985", "Pan Arab Games", "Casablanca, Morocco", "1st", "20 km walk", "1:32:31" ], [ "1986", "Maghreb Championships", "Tunis, Tunisia", "1st", "20 km walk", "1:36:19" ], [ "1987", "World Race Walking Cup", "New York City, United States", "40th", "20 km walk", "1:26:17" ], [ "1987", "Arab Championships", "Algiers, Algeria", "1st", "20 km walk", "1:30:39" ], [ "1987", "World Championships", "Rome, Italy", "35th", "20 km walk", "1:34:26" ], [ "1988", "African Championships", "Annaba, Algeria", "2nd", "20 km walk", "1:34:07" ], [ "1988", "Olympic Games", "Seoul, South Korea", "32nd", "20 km walk", "1:26:33" ], [ "1989", "World Race Walking Cup", "Barcelona, Spain", "34th", "20 km walk", "1:26:04" ], [ "1989", "African Championships", "Lagos, Nigeria", "2nd", "20 km walk", "1:36:49" ], [ "1989", "Arab Championships", "Cairo, Egypt", "2nd", "20 km walk", "1:51:52" ], [ "1990", "African Championships", "Cairo, Egypt", "2nd", "20 km walk", "1:31:00" ], [ "1991", "World Race Walking Cup", "San Jose, United States", "62nd", "20 km walk", "1:29:51" ], [ "1991", "Mediterranean Games", "Athens, Greece", "7th", "20 km walk", "1:33:27" ], [ "1991", "All-Africa Games", "Cairo, Egypt", "2nd", "20 km walk", "1:35:21" ], [ "1992", "Pan Arab Games", "Latakia, Syria", "1st", "20 km walk", "1:32:31" ], [ "1993", "World Championships", "Stuttgart, Germany", "34th", "20 km walk", "1:35:48" ] ], "title": "", "original_id": "ddd1519eb6a5c5ff75883d73e61f6704" }, { "_id": "ccd8044ce52b715704b7c4848dbe3b82", "header": [ "year", "competition", "venue", "position", "event", "notes" ], "rows": [ [ "2006", "nacac u23 championships", "santo domingo , dominican republic", "3rd", "4100 m relay", "39.98" ], [ "2007", "nacac championships", "san salvador , el salvador", "1st", "100 m", "10.32" ], [ "2007", "nacac championships", "san salvador , el salvador", "3rd", "4100 m relay", "39.92" ], [ "2007", "pan american games", "rio de janeiro , brazil", "4th (h)", "4100 m relay", "39.02" ], [ "2007", "world championships", "osaka , japan", "31st (h)", "100 m", "10.44" ], [ "2008", "central american and caribbean championships", "cali , colombia", "1st", "4100 m relay", "38.54" ], [ "2008", "olympic games", "beijing , china", "2nd", "100 m", "9.89" ], [ "2008", "olympic games", "beijing , china", "2nd", "4100 m relay", "38.06" ], [ "2009", "world championships", "berlin , germany", "5th", "100 m", "9.93" ], [ "2009", "world championships", "berlin , germany", "2nd", "4100 m relay", "37.62" ], [ "2011", "world championships", "daegu , south korea", "10th (sf)", "100 m", "10.2" ], [ "2011", "world championships", "daegu , south korea", "6th", "4100 m relay", "39.01" ], [ "2012", "olympic games", "london , united kingdom", "7th", "100 m", "9.98" ], [ "2012", "olympic games", "london , united kingdom", "3rd", "4100 m relay", "38.12" ] ], "title": "", "original_id": "2188238068289d7a4408ca02a059bc48" }, { "_id": "133c8e77ae9610616c74eeacc93b7bc9", "header": [ "year", "men 's singles", "women 's singles", "men 's doubles", "women 's doubles", "mixed doubles" ], "rows": [ [ "1975", "victor yusim", "no competition", "victor yusim michael schneidman", "no competition", "no competition" ], [ "1976", "michael schneidman", "tineke hof", "victor yusim michael schneidman", "tineke hof devora geffen", "no competition" ], [ "1977", "victor yusim", "eva unglick", "victor yusim michael schneidman", "eva unglick chaya grunstein", "no competition" ], [ "1978", "victor yusim", "chaya grunstein", "victor yusim michael schneidman", "chaya grunstein carole silman", "michael rappaport carole silman" ], [ "1979", "victor yusim", "eva unglick", "victor yusim michael schneidman", "eva unglick chaya grunstein", "nissim duk eva unglick" ], [ "1980", "yitzhak serrouya", "elka kalb", "nissim duk yitzhak serrouya", "elka kalb irit ben shushan", "michael rappaport eva unglick" ], [ "1981", "johann ratheyser", "adelhid losek", "johann rathyser gerard hofegger", "eva unglick irit ben shushan", "johann ratheyser adelheid losek" ], [ "1982", "andrew downes", "lisa salmon", "david spurling stuart spurling", "lisa salmon j downes", "david spurling h blake" ], [ "1983 1989", "no competition", "no competition", "no competition", "no competition", "no competition" ], [ "1990", "stephane renault", "christelle mol", "ricardo fernandes marco vasconcelos", "christelle mol virginie delvingt", "stephane renault elodie mansuy" ], [ "1991 1997", "no competition", "no competition", "no competition", "no competition", "no competition" ], [ "1998", "aivaras kvedarauskas", "svetlana zilberman", "aivaras kvedarauskas nir yusim", "svetlana zilberman diana koleva", "leon pugatch svetlana zilberrman" ], [ "1999 2005", "no competition", "no competition", "no competition", "no competition", "no competition" ], [ "2006", "petr koukal", "maja tvrdy", "luka petric mateuz srekl", "no competition", "luka petric maja tvrdy" ], [ "2007", "sho sasaki", "tracey hallam", "jochen cassel thomas tesche", "no competition", "valeriy atrashenkov elena prus" ] ], "title": "", "original_id": "95f0dcfec48507cc665cc640daf4fe9d" }, { "_id": "b367d3a279cb4b10b3e9286983c41637", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Great Britain", "Representing Great Britain", "Representing Great Britain", "Representing Great Britain", "Representing Great Britain", "Representing Great Britain" ], [ "2009", "World Youth Championships", "Brixen, Italy", "1st", "100 m", "11.39" ], [ "2009", "World Youth Championships", "Brixen, Italy", "1st", "200 m", "23.08" ], [ "2010", "World Junior Championships", "Moncton, New Brunswick, Canada", "1st", "100m", "11.40 (wind: -0.7 m/s)" ], [ "2010", "World Junior Championships", "Moncton, New Brunswick, Canada", "2nd", "200m", "23.19 (wind: -0.5 m/s)" ], [ "2010", "World Junior Championships", "Moncton, New Brunswick, Canada", "—", "4 × 100 m relay", "DNF" ], [ "2011", "European Indoor Championships", "Paris, France", "4th", "60 m", "7.21" ], [ "2011", "European Junior Championships", "Tallinn, Estonia", "1st", "100 m", "11.18" ], [ "2011", "European Junior Championships", "Tallinn, Estonia", "1st", "200 m", "22.94" ], [ "2011", "European Junior Championships", "Tallinn, Estonia", "3rd", "4 × 100 m", "45.00" ], [ "2012", "World Indoor Championships", "Istanbul, Turkey", "16th (sf)", "60 m", "7.32" ], [ "2013", "European U23 Championships", "Tampere, Finland", "2nd", "100 m", "11.42 (wind: -0.7 m/s)" ], [ "2013", "European U23 Championships", "Tampere, Finland", "1st", "200 m", "22.92 (wind: -0.5 m/s)" ], [ "2013", "European U23 Championships", "Tampere, Finland", "2nd", "4 × 100 m", "43.83" ], [ "2013", "World Championships", "Moscow, Russia", "semi-final", "200 m", "23.21" ], [ "2014", "Commonwealth Games", "Glasgow, Scotland", "2nd", "200 m", "22.50" ], [ "2014", "Commonwealth Games", "Glasgow, Scotland", "3rd", "4 × 100 m relay", "43.10" ], [ "2014", "European Championships", "Zurich, Switzerland", "2nd", "200 m", "22.46" ], [ "2014", "European Championships", "Zurich, Switzerland", "1st", "4 × 100 m relay", "42.25 NR" ], [ "2015", "World Championships", "Beijing, China", "4th", "4 × 100 m relay", "42.10" ], [ "2016", "Olympic Games", "Rio de Janeiro, Brazil", "22nd (sf)", "200 m", "22.99" ], [ "2018", "European Championships", "Berlin, Germany", "13th (sf)", "200 m", "23.28" ] ], "title": "", "original_id": "676e45fc03dc0b9f312ff42d35bda0d1" }, { "_id": "9249b9477ff85ae55d2e4a8f25140e72", "header": [ "year", "points", "rebounds", "assists", "steals", "blocks" ], "rows": [ [ "1995", "albert white (13)", "kevin garnett (10)", "stephon marbury (5)", "3 tied (2)", "kevin garnett (9)" ], [ "1996", "jermaine o'neal (21)", "jermaine o'neal (10)", "ed cota (4)", "winfred walton (3)", "jermaine o'neal (7)" ], [ "1997", "larry hughes (20)", "ron artest (9)", "baron davis (5)", "ron artest (5)", "shane battier (2)" ], [ "1998", "al harrington (26)", "al harrington (9)", "ronald curry (4)", "2 tied (4)", "2 tied (2)" ], [ "1999", "casey jacobsen (31)", "travis watson (9)", "jay williams (7)", "3 tied (2)", "jason parker (2)" ], [ "2000", "zach randolph (24)", "2 tied (8)", "chris duhon (6)", "darius miles (3)", "darius miles (2)" ], [ "2004", "josh smith (27)", "al jefferson (7)", "sebastian telfair (7)", "3 tied (3)", "josh smith (2)" ], [ "2005", "tyler hansbrough (31)", "tyler hansbrough (10)", "greg paulus (10)", "monta ellis (4)", "tyler hansbrough (3)" ], [ "2006", "wayne ellington (31)", "2 tied (7)", "2 tied (6)", "wayne ellington (3)", "gerald henderson (3)" ], [ "2007", "oj mayo (20)", "michael beasley (9)", "jonny flynn (10)", "derrick rose (4)", "2 tied (2)" ], [ "2008", "demar derozan (17)", "tyreke evans (8)", "jrue holiday (5)", "4 tied (3)", "drew gordon (4)" ], [ "2009", "xavier henry (22)", "john henson (9)", "john wall (11)", "john wall (5)", "2 tied (2)" ], [ "2010", "harrison barnes (27)", "jared sullinger (8)", "2 tied (5)", "3 tied (2)", "terrence jones (3)" ], [ "2011", "austin rivers (20)", "anthony davis (10)", "tony wroten (5)", "tony wroten (2)", "michael kidd - gilchrist (5)" ], [ "2012", "shabazz muhammad (35)", "kyle anderson (10)", "kyle anderson (4)", "nerlens noel (4)", "nerlens noel (4)" ] ], "title": "", "original_id": "a9c6bb106c8d9b69f6a9d3ca47f411ba" }, { "_id": "406589d6fcb3b35aa7dbda1fd76778d1", "header": [ "Year", "Award", "Category", "Nominee/Work", "Result", "Ref" ], "rows": [ [ "2014", "BCCMA", "Roots Canadiana of the Year", "The Washboard Union", "Nominated", "-" ], [ "2015", "BCCMA", "Album of the Year", "In My Bones", "Nominated", "-" ], [ "2015", "BCCMA", "Group Duo of the Year", "The Washboard Union", "Nominated", "-" ], [ "2015", "BCCMA", "Roots Canadiana of the Year", "The Washboard Union", "Won", "-" ], [ "2015", "BCCMA", "Songwriter of the Year", "The Washboard Union", "Nominated", "-" ], [ "2015", "BCCMA", "Single of the Year", "\"Some Day\"", "Nominated", "-" ], [ "2015", "BCCMA", "Video of the Year", "\"Some Day\"", "Nominated", "-" ], [ "2016", "CCMA Awards", "Roots Artist of the Year", "The Washboard Union", "Won", "-" ], [ "2016", "CCMA Awards", "Rising Star", "The Washboard Union", "Won", "-" ], [ "2016", "CCMA Awards", "Group or Duo of the Year", "The Washboard Union", "Nominated", "-" ], [ "2016", "CCMA Awards", "CMT Video of the Year", "\"Maybe It’s the Moonshine\"", "Nominated", "-" ], [ "2016", "BCCMA", "Group Duo of the Year", "The Washboard Union", "Won", "-" ], [ "2016", "BCCMA", "Roots Canadiana of the Year", "The Washboard Union", "Won", "-" ], [ "2016", "BCCMA", "Entertainer of the Year", "The Washboard Union", "Nominated", "-" ], [ "2016", "BCCMA", "Fans Choice Award", "The Washboard Union", "Nominated", "-" ], [ "2016", "BCCMA", "Songwriter of the Year", "\"Maybe It’s the Moonshine\"", "Won", "-" ], [ "2016", "BCCMA", "Single of the Year", "\"Maybe It’s the Moonshine\"", "Nominated", "-" ], [ "2016", "BCCMA", "Video of the Year", "\"Maybe It’s the Moonshine\"", "Nominated", "-" ], [ "2017", "Canadian Radio Music Awards", "Best New Group or Solo Artist: Country", "\"Maybe It’s the Moonshine\"", "Nominated", "-" ], [ "2017", "BCCMA", "SOCAN Songwriter of the Year", "\"Head Over Heels\"", "Won", "-" ], [ "2017", "BCCMA", "Single of the Year", "\"Head Over Heels\"", "Won", "-" ], [ "2017", "BCCMA", "Fan Choice", "The Washboard Union", "Won", "-" ], [ "2017", "BCCMA", "Website of the Year", "The Washboard Union", "Won", "-" ], [ "2017", "BCCMA", "Gaylord Wood Traditional Country Award/Roots Country Award", "The Washboard Union", "Won", "-" ], [ "2017", "Western Canadian Music Awards", "Country Artist of the Year", "The Washboard Union", "Won", "-" ], [ "2017", "CCMA", "Group Duo of the Year", "The Washboard Union", "Nominated", "-" ], [ "2017", "CCMA", "Roots Artist or Group of the Year", "The Washboard Union", "Won", "-" ], [ "2018", "CCMA", "Album of the Year", "What We're Made Of", "Nominated", "-" ], [ "2018", "CCMA", "Group or Duo of the Year", "The Washboard Union", "Won", "-" ], [ "2018", "CCMA", "Roots Artist or Group of the Year", "The Washboard Union", "Won", "-" ] ], "title": "", "original_id": "2aa86e06de9f21b3e8dcf82b4372dcdc" }, { "_id": "9bffe02a4a8c8f6127d297bc1b332e58", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Morocco", "Representing Morocco", "Representing Morocco", "Representing Morocco", "Representing Morocco", "Representing Morocco" ], [ "2003", "World Youth Championships", "Sherbrooke, Canada", "21st (h)", "800 m", "2:12.66" ], [ "2004", "World Junior Championships", "Grosseto, Italy", "9th", "800 m", "2:09.26" ], [ "2005", "World Cross Country Championships", "Saint-Galmier, France", "31st", "Junior race (6.153 km)", "22:42" ], [ "2005", "World Youth Championships", "Marrakech, Morocco", "4th", "800 m", "2:08.61" ], [ "2005", "Francophonie Games", "Niamey, Niger", "4th", "800 m", "2:09.64" ], [ "2005", "Francophonie Games", "Niamey, Niger", "3rd", "4 × 400 m relay", "3:42.48" ], [ "2006", "World Junior Championships", "Beijing, China", "12th (sf)", "800 m", "2:07.07" ], [ "2007", "World Cross Country Championships", "Mombasa, Kenya", "46th", "Junior race (6 km)", "24:01" ], [ "2007", "African Junior Championships", "Ouagadougou, Burkina Faso", "2nd", "800 m", "2:06.13" ], [ "2007", "African Junior Championships", "Ouagadougou, Burkina Faso", "3rd", "1500 m", "4:20.91" ], [ "2007", "Pan Arab Games", "Cairo, Egypt", "3rd", "800 m", "2:09.50" ], [ "2008", "African Championships", "Addis Ababa, Ethiopia", "4th", "800 m", "2:04.74" ], [ "2009", "Mediterranean Games", "Pescara, Italy", "2nd", "800 m", "2:00.91" ], [ "2009", "World Championships", "Berlin, Germany", "23rd (sf)", "800 m", "DNF" ], [ "2009", "Francophonie Games", "Beirut, Lebanon", "2nd", "800 metres", "2:02.76" ], [ "2009", "Francophonie Games", "Beirut, Lebanon", "3rd", "4 × 400 m relay", "3:37.72" ], [ "2010", "World Indoor Championships", "Doha, Qatar", "8th (h)", "800 m", "2:03.81" ], [ "2010", "African Championships", "Nairobi, Kenya", "8th", "800 m", "DNF" ], [ "2011", "World Championships", "Daegu, South Korea", "24th (sf)", "800 m", "DNF" ], [ "2012", "Olympic Games", "London, Great Britain", "11th (sf)", "800 m", "11th" ], [ "2013", "World Championships", "Moscow, Russia", "11th (sf)", "800 m", "11th" ] ], "title": "", "original_id": "01b8f8e3ea00672844eb858c29324c9e" }, { "_id": "373abce0a559ca0de9af8f5bad68fb92", "header": [ "year", "delegate", "hometown", "pageant", "result", "other awards" ], "rows": [ [ "1971", "nelia sancho", "no information available", "queen of the pacific", "winner", "none" ], [ "1971", "milagros gutierrez", "no information available", "miss charming international", "second runner - up", "none" ], [ "1972", "maria isabel seva", "no information available", "miss charming international", "did not place", "none" ], [ "1989", "maria rita apostol", "no information available", "miss flower queen", "did not place", "none" ], [ "1992", "sharmaine rama gutierrez", "manila , metro manila", "elite model look", "did not place", "none" ], [ "1993", "anna maria gonzalez", "no information available", "elite model look", "did not place", "none" ], [ "1995", "rollen richelle caralde", "no information available", "elite model look", "did not place", "none" ], [ "1996", "ailleen marfori damiles", "las piñas , metro manila", "international folklore beauty pageant", "top 5 finalist", "miss photogenic" ], [ "1997", "joanne zapanta santos", "san fernando , pampanga", "miss tourism international", "winner", "none" ], [ "2000", "rachel muyot soriano", "no information available", "miss tourism world", "second runner - up", "best in long gown" ], [ "2001", "maricar manalaysay balagtas", "bulacan", "miss globe international", "winner", "best national costume" ], [ "2001", "michelle cueva reyes", "caloocan city , metro manila", "miss tourism international", "winner", "best national costume" ], [ "2001", "zorayda ruth blanco andam", "baguio city", "miss tourism world", "finalist", "miss tourism world asia" ], [ "2001", "joanna maria mijares peñaloza", "mandaluyong city , metro manila", "miss internet www", "did not place", "face of the net" ], [ "2002", "kristine reyes alzar", "lipa , batangas", "miss tourism international", "winner", "best national costume" ], [ "2002", "karen loren medrano agustin", "manila , metro manila", "miss globe international", "fifth runner - up", "best in swimsuit" ], [ "2002", "michelle cueva reyes", "caloocan city , metro manila", "miss tourism world", "winner", "best national costume" ], [ "2002", "margaret - ann awitan bayot", "antipolo , rizal", "miss internet www", "second runner - up", "none" ], [ "2003", "noella mae evangelista", "iligan city", "queen of tourism international", "winner", "best national costume" ], [ "2004", "karen loren medrano agustin", "manila , metro manila", "world coffee queen", "second runner - up", "none" ], [ "2004", "margaret ann awitan bayot", "antipolo , rizal", "miss maja mundial", "first runner - up / virreina", "none" ], [ "2005", "jhezarie games javier", "manila , metro manila", "miss asean", "winner", "none" ], [ "2006", "carlene ang aguilar", "quezon city , metro manila", "miss internet www", "winner", "none" ], [ "2009", "april love antolo jordan", "manila , metro manila", "beauty of the world", "winner", "none" ], [ "2010", "mariella castillo", "mabini , batangas", "miss global teen", "top 12 semi - finalist", "teen queen of asia and oceania" ], [ "2011", "czarina catherine gatbonton", "malolos , bulacan", "miss humanity international", "second runner - up", "none" ] ], "title": "", "original_id": "5921991ef07b397dfd587a30c770faea" }, { "_id": "944d22d21ab3c3a652329d280eade25e", "header": [ "year", "mens singles", "womens singles", "mens doubles", "womens doubles", "mixed doubles" ], "rows": [ [ "1985", "jeliazko valkov", "diana koleva", "ilko orechov nanko ertchopov", "diana koleva zlatka valkanova", "jeliazko valkov dobrinka peneva" ], [ "1986", "jeliazko valkov", "diana koleva", "jeliazko valkov dinko dukov", "diana koleva petia borisova", "ilko okreshkov elena velinova" ], [ "1987", "stanimir boitchinov", "diana koleva", "jeliazko valkov dinko dukov", "diana koleva diana filipova", "jeliazko valkov gabriela spasova" ], [ "1988", "jeliazko valkov", "diana koleva", "jeliazko valkov dinko dukov", "diana koleva emilia dimitrova", "jeliazko valkov irina dimitrova" ], [ "1989", "stanimir boitchinov", "diana koleva", "jeliazko valkov dinko dukov", "diana koleva emilia dimitrova", "jeliazko valkov diana filipova" ], [ "1990", "stoyan ivantchev", "diana koleva", "slantcezar tzankov anatoliy skripko", "diana koleva emilia dimitrova", "anatoliy skripko diana filipova" ], [ "1991", "stoyan ivantchev", "victoria hristova", "stoyan ivantchev anatoliy skripko", "diana koleva emilia dimitrova", "jeliazko valkov emilia dimitrova" ], [ "1992", "jassen borissov", "diana koleva", "jeliazko valkov sibin atanasov", "diana koleva diana filipova", "slantchezar tzankov diana filipova" ], [ "1993", "todor velkov", "dimitrinka dimitrova", "boris kesov anatoliy skripko", "victoria hristova nelly nedjalkova", "svetoslav stoyanov emilia dimitrova" ], [ "1994", "mihail popov", "victoria hristova", "svetoslav stoyanov mihail popov", "raina tzvetkova emilia dimitrova", "svetoslav stoyanov raina tzvetkova" ], [ "1995", "todor velkov", "neli nedialkova", "svetoslav stoyanov mihail popov", "raina tzvetkoa victoria hristova", "svetoslav stoyanov raina tzvetkova" ], [ "1996", "mihail popov", "victoria hristova", "svetoslav stoyanov mihail popov", "victoria hristova neli nedialkova", "svetoslav stoyanov raina tzvetkova" ], [ "1997", "boris kessov", "raina tzvetkova", "svetoslav stoyanov mihail popov", "victoria hristova dobrinka smilianova", "svetoslav stoyanov raina tzvetkova" ], [ "1998", "mihail popov", "victoria hristova", "svetoslav stoyanov mihail popov", "victoria hristova raina tzvetkova", "svetoslav stoyanov raina tzvetkova" ], [ "1999", "boris kessov", "neli boteva", "boris kessov tzvetozar kolev", "raina tzvetkova petya nedelcheva", "konstantin dobrev petya nedelcheva" ], [ "2000", "luben panov", "petya nedelcheva", "konstantin dobrev luben panov", "petya nedelcheva neli boteva", "konstantin dobrev petya nedelcheva" ], [ "2001", "konstantin dobrev", "petya nedelcheva", "konstantin dobrev luben panov", "petya nedelcheva maya ivanova", "konstantin dobrev petya nedelcheva" ], [ "2002", "boris kessov", "petya nedelcheva", "konstantin dobrev georgi petrov", "petya nedelcheva nely boteva", "boris kessov nely boteva" ], [ "2003", "georgi petrov", "nely boteva", "julian hristov boris kessov", "petya nedelcheva diana koleva", "julian hristov diana dimova" ], [ "2004", "yulian hristov", "petya nedelcheva", "stilian makarski bladimir metodiev", "petya nedelcheva nely boteva", "vladimir metodiev petya nedelcheva" ], [ "2005", "kostantin dobrev", "petya nedelcheva", "konstantin dobrev georgi petrov", "petya nedelcheva maya lvanova", "vladimir metodiev petya nedelcheva" ], [ "2006", "georgi petrov", "petya nedelcheva", "georgi petrov blagovest kisiov", "petya nedelcheva diana dimova", "vladimir metodiev petya nedelcheva" ], [ "2007", "georgi petrov", "petya nedelcheva", "vladimir metodiev stilian makarski", "petya nedelcheva diana dimova", "vladimir metodiev diana dimova" ], [ "2008", "stilian makarski", "petya nedelcheva", "vladimir metodiev krasimir yankov", "petya nedelcheva diana dimova", "stilian makarski diana dimova" ], [ "2009", "krasimir yankov", "petya nedelcheva", "vladimir metodiev krasimir yankov", "petya nedelcheva dimitria popstoykova", "stilian makarski diana dimova" ], [ "2010", "stilian makarski", "petya nedelcheva", "stilian makarski peyo boichinov", "petya nedelcheva diana dimova", "stilian makarski diana dimova" ], [ "2011", "peyo boichinov", "petya nedelcheva", "stilian makarski peyo boichinov", "petya nedelcheva diana dimova", "stilian makarski diana dimova" ] ], "title": "", "original_id": "d494234ecc77e5ad04517a99c500b01b" }, { "_id": "bff2ff8050d1f4caafca1ce737e43b60", "header": [ "year", "competition", "date", "location", "score", "result" ], "rows": [ [ "2000", "euro / africa zone group iv , round robin", "19 jan", "kampala (uga)", "3 - 0", "win" ], [ "2000", "euro / africa zone group iv , round robin", "20 jan", "kampala (uga)", "1 - 2", "loss" ], [ "2000", "euro / africa zone group iv , round robin", "22 jan", "kampala (uga)", "3 - 0", "win" ], [ "2000", "euro / africa zone group iv , round robin", "23 jan", "kampala (uga)", "2 - 1", "win" ], [ "2001", "euro / africa zone group iv , round robin", "16 may", "nicosia (cyp)", "3 - 0", "win" ], [ "2001", "euro / africa zone group iv , round robin", "17 may", "nicosia (cyp)", "2 - 1", "win" ], [ "2001", "euro / africa zone group iv , round robin", "18 may", "nicosia (cyp)", "3 - 0", "win" ], [ "2001", "euro / africa zone group iv , round robin", "19 may", "nicosia (cyp)", "3 - 0", "win" ], [ "2001", "euro / africa zone group iv , round robin", "20 may", "nicosia (cyp)", "3 - 0", "win" ], [ "2002", "euro / africa zone group iii , round robin", "8 may", "gdynia (pol)", "0 - 3", "loss" ], [ "2002", "euro / africa zone group iii , round robin", "9 may", "gdynia (pol)", "1 - 2", "loss" ], [ "2002", "euro / africa zone group iii , round robin", "10 may", "gdynia (pol)", "2 - 1", "win" ], [ "2002", "euro / africa zone group iii , relegation playoff", "12 may", "gdynia (pol)", "3 - 0", "win" ], [ "2003", "euro / africa zone group iii , round robin", "11 jun", "jūrmala (lat)", "3 - 0", "win" ], [ "2003", "euro / africa zone group iii , round robin", "12 jun", "jūrmala (lat)", "3 - 0", "win" ], [ "2003", "euro / africa zone group iii , round robin", "13 jun", "jūrmala (lat)", "1 - 2", "loss" ], [ "2003", "euro / africa zone group iii , promotion playoff", "14 jun", "jūrmala (lat)", "1 - 2", "loss" ], [ "2003", "euro / africa zone group iii , 3rd to 4th playoff", "15 jun", "jūrmala (lat)", "3 - 0", "win" ], [ "2004", "euro / africa zone group iii , round robin", "4 feb", "kaunas (ltu)", "1 - 2", "loss" ], [ "2004", "euro / africa zone group iii , round robin", "5 feb", "kaunas (ltu)", "2 - 1", "win" ], [ "2004", "euro / africa zone group iii , 5th to 7th playoff", "7 feb", "kaunas (ltu)", "2 - 1", "win" ], [ "2004", "euro / africa zone group iii , 5th to 6th playoff", "8 feb", "kaunas (ltu)", "1 - 2", "loss" ], [ "2005", "euro / africa zone group iii , round robin", "13 jul", "dublin (irl)", "2 - 1", "win" ], [ "2005", "euro / africa zone group iii , round robin", "14 jul", "dublin (irl)", "3 - 0", "win" ], [ "2005", "euro / africa zone group iii , round robin", "15 jul", "dublin (irl)", "3 - 0", "win" ], [ "2005", "euro / africa zone group iii , 1st to 4th playoff", "16 jul", "dublin (irl)", "2 - 1", "win" ], [ "2005", "euro / africa zone group iii , 1st to 2nd playoff", "17 jul", "dublin (irl)", "2 - 1", "win" ], [ "2006", "euro / africa zone group ii , 1st round", "7 - 9 apr", "plovdiv (bul)", "2 - 3", "loss" ], [ "2006", "euro / africa zone group ii , relegation playoff", "21 - 23 jul", "cairo (egy)", "3 - 2", "win" ], [ "2007", "euro / africa zone group ii , 1st round", "6 - 8 apr", "nicosia (cyp)", "2 - 3", "loss" ], [ "2007", "euro / africa zone group ii , relegation playoff", "20 - 22 jul", "nicosia (cyp)", "4 - 1", "win" ], [ "2008", "euro / africa zone group ii , 1st round", "11 - 13 apr", "nicosia (cyp)", "3 - 2", "win" ], [ "2008", "euro / africa zone group ii , quarterfinal", "20 - 22 jul", "porto (por)", "2 - 3", "loss" ], [ "2009", "euro / africa zone group ii , 1st round", "6 - 8 apr", "nicosia (cyp)", "3 - 2", "win" ], [ "2009", "euro / africa zone group ii , quarterfinal", "10 - 12 jul", "nicosia (cyp)", "3 - 2", "win" ], [ "2009", "euro / africa zone group ii , semifinal", "18 - 20 sep", "salo (fin)", "2 - 3", "loss" ] ], "title": "", "original_id": "5f02d6b560d63b1cf6b30cd39d7a208c" }, { "_id": "79187319a1c87ba843721165104f34ea", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Mexico", "Representing Mexico", "Representing Mexico", "Representing Mexico", "Representing Mexico", "Representing Mexico" ], [ "1978", "Central American and Caribbean Junior Championships (U-17)", "Xalapa, México", "3rd", "1000 m", "2:38.8 A" ], [ "1978", "Central American and Caribbean Junior Championships (U-17)", "Xalapa, México", "1st", "3000 m", "9:04.4 A" ], [ "1980", "Central American and Caribbean Junior Championships (U-20)", "Nassau, Bahamas", "4th", "1500 m", "3:53.7" ], [ "1980", "Central American and Caribbean Junior Championships (U-20)", "Nassau, Bahamas", "2nd", "5000 m", "14:27.4" ], [ "1980", "Central American and Caribbean Junior Championships (U-20)", "Nassau, Bahamas", "1st", "3000 m steeplechase", "9:27.8" ], [ "1984", "Olympic Games", "Los Angeles, United States", "36th", "Marathon", "2:20:33" ], [ "1988", "Ibero-American Championships", "Ciudad de México, México", "1st", "10,000m", "29:51.09 A" ], [ "1988", "Olympic Games", "Seoul, South Korea", "11th", "Marathon", "2:13:58" ] ], "title": "", "original_id": "691ee4d04b744fd879670b1a0075aaf7" }, { "_id": "83a792594d447f7ee35fbd0aa72accbf", "header": [ "year", "winners", "grand finalist", "scores", "venue", "crowd", "margin", "season result" ], "rows": [ [ "1977", "hawthorn", "carlton", "14.11 (95) - 11.5 (71)", "waverley park", "27407", "24", "preliminary finalist" ], [ "1978", "fitzroy", "north melbourne", "13.18 (96) - 2.8 (20)", "waverley park", "26420", "76", "9th" ], [ "1979", "collingwood", "hawthorn", "12.8 (80) - 7.10 (52)", "waverley park", "37753", "28", "grand finalist" ], [ "1980", "north melbourne", "collingwood", "8.9 (57) - 7.12 (54)", "waverley park", "50478", "3", "elimination finalist" ], [ "1981", "essendon", "carlton", "9.11 (65) - 6.5 (41)", "waverley park", "42269", "24", "elimination finalist" ], [ "1982", "sydney swans", "north melbourne", "13.12 (90) - 8.10 (58)", "waverley park", "20028", "32", "7th" ], [ "1983", "carlton", "richmond", "14.16 (100) - 10.6 (66)", "waverley park", "32927", "34", "elimination finalist" ], [ "1984", "essendon", "sydney swans", "13.11 (89) - 5.8 (38)", "waverley park", "30824", "51", "premier" ], [ "1985", "hawthorn", "essendon", "11.11 (77) - 10.8 (68)", "waverley park", "24812", "9", "grand finalist" ], [ "1986", "hawthorn", "carlton", "9.12 (66) - 5.6 (36)", "waverley park", "19627", "30", "premier" ] ], "title": "", "original_id": "71857abad22fe712e19123f175c8fa76" }, { "_id": "d2ca426823c7e75b2680d430033556eb", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Sweden", "Representing Sweden", "Representing Sweden", "Representing Sweden", "Representing Sweden", "Representing Sweden" ], [ "2008", "World Junior Championships", "Bydgoszcz, Poland", "11th (sf)", "400m", "54.12" ], [ "2009", "European Junior Championships", "Novi Sad, Serbia", "3rd", "400 m", "54.01" ], [ "2010", "European Championships", "Barcelona, Spain", "7th", "4 × 100 m relay", "43.75" ], [ "2011", "European U23 Championships", "Ostrava, Czech Republic", "2nd", "200 m", "23.24" ], [ "2011", "World Championships", "Daegu, South Korea", "24th (h)", "200 m", "23.31" ], [ "2011", "World Championships", "Daegu, South Korea", "18th (sf)", "400 m", "52.35" ], [ "2012", "World Indoor Championships", "Istanbul, Turkey", "6th (sf)", "400 m", "52.29" ], [ "2012", "European Championships", "Helsinki, Finland", "1st", "400 m", "51.13 (NR)" ], [ "2013", "World Championships", "Moscow, Russia", "31st (h)", "200 m", "23.33" ], [ "2013", "World Championships", "Moscow, Russia", "24th (h)", "400 m", "52.39" ], [ "2018", "European Championships", "Berlin, Germany", "9th (h)", "4 × 400 m relay", "3:32.61" ] ], "title": "", "original_id": "4d999e44a25d4d802cbb0ea178c847fe" }, { "_id": "212adb2f4a88b85a43c34cd49f27e51c", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing China", "Representing China", "Representing China", "Representing China", "Representing China", "Representing China" ], [ "2013", "Asian Championships", "Pune, India", "4th", "Triple jump", "13.57 m" ], [ "2014", "Asian Indoor Championships", "Hangzhou, China", "3rd", "Triple jump", "13.43 m" ], [ "2014", "Asian Junior Championships", "Taipei City, Taiwan", "1st", "Long jump", "6.27 m" ], [ "2014", "Asian Junior Championships", "Taipei City, Taiwan", "2nd", "Triple jump", "13.62 m" ], [ "2014", "World Junior Championships", "Eugene, United States", "25th (q)", "Long jump", "5.72 m" ], [ "2014", "World Junior Championships", "Eugene, United States", "3rd", "Triple jump", "14.03 m" ], [ "2015", "World Championships", "Beijing, China", "21st (q)", "Triple jump", "13.52 m" ], [ "2016", "Asian Indoor Championships", "Hangzhou, China", "5th", "Triple jump", "13.14 m" ], [ "2016", "Olympic Games", "Rio de Janeiro, Brazil", "34th (q)", "Triple jump", "13.30 m" ] ], "title": "", "original_id": "9c67f976517e940f4c621cc43685f9f1" }, { "_id": "d9951099561edda303e2d1934a6b12b4", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing India", "Representing India", "Representing India", "Representing India", "Representing India", "Representing India" ], [ "2008", "Asian Junior Championships", "Jakarta, Indonesia", "2nd", "800 m", "2:08.63" ], [ "2008", "World Junior Championships", "Bydgoszcz, Poland", "8th (sf)", "800m", "2:06.51" ], [ "2008", "World Junior Championships", "Bydgoszcz, Poland", "14th (h)", "4 × 400 m relay", "3:44.13" ], [ "2009", "Asian Championships", "Guangzhou, China", "6th", "800 m", "2:07.36" ], [ "2010", "Commonwealth Games", "Delhi, India", "6th", "800 m", "2:01.25" ], [ "2010", "Asian Games", "Guangzhou, China", "3rd", "800 m", "2:01.36" ], [ "2011", "Asian Championships", "Kobe, Japan", "3rd", "800 m", "2:02.55" ], [ "2011", "Asian Championships", "Kobe, Japan", "2nd", "4 × 400 m relay", "3:44.17" ], [ "2011", "World Championships", "Daegu, South Korea", "15th (sf)", "800 m", "2:00.95" ], [ "2012", "Olympic Games", "London, United Kingdom", "10th (sf)", "800 m", "1:59.61" ], [ "2013", "Asian Championships", "Pune, India", "3rd", "800 m", "2:04.48" ], [ "2013", "Asian Championships", "Pune, India", "1st", "4 × 400 m relay", "3:32.26" ], [ "2013", "World Championships", "Moscow, Russia", "15th (h)", "4 × 400 m relay", "3:38.81" ], [ "2014", "Commonwealth Games", "Glasgow, United Kingdom", "11th (sf)", "800 m", "2:03.35" ], [ "2014", "Asian Games", "Incheon, South Korea", "2nd", "800 m", "1:59.19" ], [ "2014", "Asian Games", "Incheon, South Korea", "1st", "4 × 400 m relay", "3:28.68 GR" ], [ "2015", "Asian Championships", "Wuhan, China", "1st", "800 m", "2:01.53" ], [ "2015", "Asian Championships", "Wuhan, China", "2nd", "4 × 400 m relay", "3:33.81" ], [ "2015", "World Championships", "Beijing, China", "19th (h)", "800 metres", "2:00.95" ], [ "2015", "World Championships", "Beijing, China", "14th (h)", "4 × 400 m relay", "3:29.08" ], [ "2016", "Olympic Games", "Rio de Janeiro, Brazil", "29th (h)", "800 m", "2:00.58" ] ], "title": "", "original_id": "9949f443a53a970598e8d3e4d400361b" }, { "_id": "1121a93e2885f375290aac973a109084", "header": [ "Song", "Year", "Artist", "Album", "Role", "Notes" ], "rows": [ [ "\"Leavin' Eyes\"", "1984", "Glen Campbell", "Letter to Home", "Writer, producer", "-" ], [ "\"Cruisin'\"", "1986", "Alabama", "The Touch", "Writer", "-" ], [ "\"No More Tears\"", "1994", "David Ball", "David Ball", "Writer", "-" ], [ "\"Love Lessons\"", "1995", "Tracy Byrd", "Love Lessons", "Writer", "US Country #9" ], [ "\"Wine into Water\"", "1998", "T. Graham Brown", "Wine into Water", "Writer", "US Country #44" ], [ "\"Don't Think I Won't\"", "1998", "Mark Wills", "Wish You Were Here", "Writer", "-" ], [ "\"She Rides Wild Horses\"", "1999", "Kenny Rogers", "She Rides Wild Horses", "Writer", "-" ], [ "\"He Rocks\"", "2000", "Wynonna Judd", "New Day Dawning", "Writer", "-" ], [ "\"Monkey in the Middle\"", "2003", "Rodney Atkins", "Honesty", "Writer, producer", "-" ], [ "\"Honesty (Write Me a List)\"", "2003", "Rodney Atkins", "Honesty", "Producer, vocals", "US Country #4" ], [ "\"Someone to Share it With\"", "2003", "Rodney Atkins", "Honesty", "Writer, producer", "-" ], [ "\"The Man I Am Today\"", "2003", "Rodney Atkins", "Honesty", "Writer, producer", "-" ], [ "\"My Old Man\"", "2003", "Rodney Atkins", "Honesty", "Writer, producer", "US Country #36" ], [ "\"Wasted Whiskey\"", "2006", "Rodney Atkins", "If You're Going Through Hell", "Writer, producer", "-" ], [ "\"Cleaning This Gun (Come On In Boy)\"", "2006", "Rodney Atkins", "If You're Going Through Hell", "Producer, vocals", "US Country #1 US Gold" ], [ "\"Watching You\"", "2006", "Rodney Atkins", "If You're Going Through Hell", "Producer, vocals", "US Country #1 US Platinum" ], [ "\"If You're Going Through Hell (Before the Devil Even Knows)\"", "2006", "Rodney Atkins", "If You're Going Through Hell", "Producer, vocals", "US Country #1 US Platinum" ], [ "\"These Are My People\"", "2006", "Rodney Atkins", "If You're Going Through Hell", "Producer, vocals", "US Country #1 US Gold" ], [ "\"Home Sweet Oklahoma\"", "2008", "Patti Page and Vince Gill", "Best Country Songs", "Writer, producer", "-" ], [ "\"Chasin' Girls\"", "2009", "Rodney Atkins", "It's America", "Writer, producer", "-" ], [ "\"It's America\"", "2009", "Rodney Atkins", "It's America", "Producer, vocals", "US Country #1" ], [ "\"15 Minutes\"", "2009", "Rodney Atkins", "It's America", "Producer, vocals", "US Country #20" ], [ "\"Farmer's Daughter\"", "2010", "Rodney Atkins", "It's America", "Producer, vocals", "US Country #5 US Platinum" ], [ "\"Growing Up Like That\"", "2011", "Rodney Atkins", "Take a Back Road", "Writer, producer", "-" ], [ "\"Take a Back Road\"", "2011", "Rodney Atkins", "Take a Back Road", "Producer", "US Country #1 US Platinum" ], [ "\"He's Mine\"", "2011", "Rodney Atkins", "Take a Back Road", "Producer, vocals", "US Country #23" ], [ "\"Tips\"", "2011", "Rodney Atkins", "Take a Back Road", "Writer, producer", "-" ], [ "\"Lifelines\"", "2011", "Rodney Atkins", "Take a Back Road", "Writer, producer", "-" ], [ "\"Cool with That\"", "2015", "Brett Kissel", "Pick Me Up", "Writer", "-" ], [ "\"Wine Into Water\"", "2015", "T. Graham Brown", "Forever Changed", "Writer", "-" ], [ "\"Wine Into Water\"", "2016", "Loretta Lynn", "Full Circle", "Writer", "-" ], [ "\"Nights in the Sun\"", "2017", "Brett Kissel", "We Were That Song", "Writer", "-" ] ], "title": "", "original_id": "be18c465eb0851ea697b232017a9c7dc" }, { "_id": "292fa6f06d0acc669ad42922fa85e1b8", "header": [ "year", "mens singles", "womens singles", "mens doubles", "womens doubles", "mixed doubles" ], "rows": [ [ "1964", "feliks glapka , poznań", "teresa masłowska , warszawa", "feliks glapka marian grys , poznań", "no competition", "bolesław suterski stanisława suterska , poznań" ], [ "1965", "aleksander koczur , kraków", "teresa masłowska , warszawa", "andrzej domagała krzysztof englander , wrocław", "no competition", "bolesław suterski stanisława suterska , poznań" ], [ "1966", "wiesław świątczak , łódź", "teresa masłowska , warszawa", "andrzej domagała krzysztof englander , wrocław", "no competition", "wiesław świątczak irena józefowicz , łódź" ], [ "1967", "wiesław świątczak , łódź", "barbara rojewska , olsztyn", "andrzej domagała krzysztof englander , wrocław", "no competition", "krzysztof englander bożena basińska , wrocław" ], [ "1968", "krzysztof englander , wrocław", "irena karolczak , wrocław", "jerzy przybylski lech woźny , poznań", "no competition", "krzysztof englander irena karolczak , wrocław" ], [ "1969", "andrzej domagała , wrocław", "teresa masłowska , warszawa", "andrzej domagała krzysztof englander , wrocław", "no competition", "bogusław żołądkowski teresa masłowska , warszawa" ], [ "1970", "wiesław świątczak , łódź", "irena karolczak , wrocław", "jerzy przybylski lech woźny , poznań", "no competition", "jan makarus jolanta proch , szczecin" ], [ "1971", "wiesław świątczak , łódź", "lidia baczyńska , wrocław", "andrzej domagała krzysztof englander , wrocław", "no competition", "wiesław świątczak ewa astasiewicz , łódź" ], [ "1972", "wiesław danielski", "irena karolczak", "wiesław danielski zygmunt skrzypczyński", "lidia baczyńska irena karolczak", "leszek nowakowski hana snochowska" ], [ "1973", "andrzej domagała", "irena karolczak", "wiesław danielski zygmunt skrzypczyński", "no competition", "sławomir wloszczynski irena karolczak" ], [ "1974", "stanisław rosko", "irena karolczak", "ryszard borek stanisław rosko", "irena karolczak hana snochowska", "leszek nowakowski hana snochowska" ], [ "1975", "zygmunt skrzypczyński", "irena karolczak", "andrzej domagała wiesław świątczak", "irena karolczak hana snochowska", "leslaw markowicz irena karolczak" ], [ "1976", "zygmunt skrzypczyński", "elżbieta utecht", "krzysztof englander janusz labisko", "irena karolczak wanda czamańska", "leslaw markowicz irena karolczak" ], [ "1978", "zygmunt skrzypczyński", "elżbieta utecht", "zygmunt skrzypczyński sławomir włoszyński", "bożena wojtkowska elżbieta utecht", "janusz labisko anna zyśk" ], [ "1979", "brunon rduch", "elżbieta utecht", "zygmunt skrzypczyński sławomir włoszyński", "bożena wojtkowska maria bahryj", "zygmunt skrzypczyński elżbieta utecht" ], [ "1980", "zygmunt skrzypczyński", "bożena wojtkowska", "zygmunt skrzypczyński janusz labisko", "bożena wojtkowska ewa rusznica", "zygmunt skrzypczyński elżbieta utecht" ], [ "1981", "brunon rduch", "bożena wojtkowska", "brunon rduch norbert węgrzyn", "bożena wojtkowska zofia żółtańska", "jerzy dołhan ewa rusznica" ], [ "1982", "stanisław rosko", "bożena wojtkowska", "stanisław rosko kazimierz ciurys", "bożena wojtkowska ewa rusznica", "jerzy dołhan bożena wojtkowska" ], [ "1983", "stanisław rosko", "ewa rusznica", "jerzy dołhan grzegorz olchowik", "bożena wojtkowska bożena siemieniec", "kazimierz ciurys bożena wojtkowska" ], [ "1984", "stanisław rosko", "bożena wojtkowska", "jerzy dołhan grzegorz olchowik", "bożena wojtkowska ewa wilman", "kazimierz ciurys bożena wojtkowska" ], [ "1985", "grzegorz olchowik", "bożena wojtkowska", "jerzy dołhan grzegorz olchowik", "bożena siemieniec zofia żółtańska", "jerzy dołhan ewa wilman" ], [ "1986", "grzegorz olchowik", "bożena siemieniec", "jerzy dołhan grzegorz olchowik", "bożena siemieniec zofia żółtańska", "jerzy dołhan ewa wilman" ], [ "1987", "jerzy dołhan", "bożena haracz", "jerzy dołhan grzegorz olchowik", "bożena haracz bożena siemieniec", "jerzy dołhan bożena haracz" ], [ "1988", "jerzy dołhan", "bożena siemieniec", "jerzy dołhan grzegorz olchowik", "bożena haracz bożena siemieniec", "jerzy dołhan bożena haracz" ], [ "1989", "jacek hankiewicz", "bożena siemieniec", "jerzy dołhan jacek hankiewicz", "bożena haracz bożena siemieniec", "jerzy dołhan bożena haracz" ], [ "1990", "jacek hankiewicz", "beata syta", "jerzy dołhan jacek hankiewicz", "bożena haracz beata syta", "jerzy dołhan bożena haracz" ], [ "1991", "jacek hankiewicz", "katarzyna krasowska", "jerzy dołhan jacek hankiewicz", "bożena haracz bożena siemieniec", "jerzy dołhan bożena haracz" ], [ "1992", "dariusz zięba", "katarzyna krasowska", "jerzy dołhan jacek hankiewicz", "bożena haracz bożena bąk", "jerzy dołhan bożena haracz" ], [ "1993", "jacek hankiewicz", "katarzyna krasowska", "dariusz zięba jacek hankiewicz", "bożena haracz bożena bąk", "jerzy dołhan bożena haracz" ], [ "1994", "dariusz zięba", "katarzyna krasowska", "jerzy dołhan damian pławecki", "monika lipińska sylwia rutkiewicz", "damian pławecki dorota borek" ], [ "1995", "dariusz zięba", "katarzyna krasowska", "jerzy dołhan damian pławecki", "dorota borek katarzyna krasowska", "jerzy dołhan bożena haracz" ], [ "1996", "dariusz zięba", "katarzyna krasowska", "dariusz zięba jacek hankiewicz", "monika bienkowska katarzyna boczek", "robert mateusiak sylwia rutkiewicz" ], [ "1997", "jacek niedźwiedzki", "katarzyna krasowska", "jerzy dołhan damian pławecki", "dorota borek katarzyna krasowska", "damian pławecki dorota borek" ], [ "1998", "jacek niedźwiedzki", "katarzyna krasowska", "michał łogosz damian pławecki", "bożena haracz katarzyna krasowska", "damian pławecki dorota grzejdak" ], [ "1999", "przemysław wacha", "kamila augustyn", "michał łogosz robert mateusiak", "bożena haracz joanna szleszyńska", "robert mateusiak monika bienkowska" ], [ "2000", "jacek niedźwiedzki", "katarzyna krasowska", "michał łogosz robert mateusiak", "bożena haracz katarzyna krasowska", "robert mateusiak barbara kulanty" ], [ "2001", "jacek niedźwiedzki", "kamila augustyn", "michał łogosz robert mateusiak", "barbara kulanty joanna szleszyńska", "robert mateusiak barbara kulanty" ], [ "2002", "przemysław wacha", "kamila augustyn", "michał łogosz robert mateusiak", "kamila augustyn joanna szleszyńska", "robert mateusiak barbara kulanty" ], [ "2003", "jacek niedźwiedzki", "kamila augustyn", "michał łogosz robert mateusiak", "kamila augustyn paulina matusewicz", "robert mateusiak barbara kulanty" ], [ "2004", "przemysław wacha", "kamila augustyn", "michał łogosz robert mateusiak", "kamila augustyn nadieżda kostiuczyk", "robert mateusiak barbara kulanty" ], [ "2005", "przemysław wacha", "kamila augustyn", "michał łogosz robert mateusiak", "kamila augustyn nadieżda kostiuczyk", "robert mateusiak barbara kulanty" ], [ "2006", "przemysław wacha", "angelika węgrzyn", "rafał hawel przemysław wacha", "kamila augustyn nadieżda kostiuczyk", "robert mateusiak nadieżda kostiuczyk" ], [ "2007", "przemysław wacha", "kamila augustyn", "michał łogosz robert mateusiak", "kamila augustyn nadieżda kostiuczyk", "robert mateusiak nadieżda kostiuczyk" ], [ "2008", "przemysław wacha", "kamila augustyn", "michał łogosz robert mateusiak", "kamila augustyn nadieżda kostiuczyk", "robert mateusiak nadieżda kostiuczyk" ], [ "2009", "przemysław wacha", "kamila augustyn", "michał łogosz robert mateusiak", "małgorzata kurdelska agnieszka wojtkowska", "robert mateusiak kamila augustyn" ], [ "2010", "przemysław wacha", "kamila augustyn", "michał łogosz robert mateusiak", "kamila augustyn nadieżda kostiuczyk", "robert mateusiak nadieżda kostiuczyk" ] ], "title": "", "original_id": "31d0f57a11ed01b643d02e560eee8c05" }, { "_id": "3036b2b46efe509a669533933ff823bc", "header": [ "Year", "Association", "Category", "Work", "Result", "Ref." ], "rows": [ [ "1938", "Academy Awards", "Best Actress in a Leading Role", "Stella Dallas", "Nominated", "-" ], [ "1942", "Academy Awards", "Best Actress in a Leading Role", "Ball of Fire", "Nominated", "-" ], [ "1945", "Academy Awards", "Best Actress in a Leading Role", "Double Indemnity", "Nominated", "-" ], [ "1949", "Academy Awards", "Best Actress in a Leading Role", "Sorry, Wrong Number", "Nominated", "-" ], [ "1960", "Hollywood Walk of Fame", "Motion Pictures, 1751 Vine Street", "-", "Won", "-" ], [ "1961", "Emmy Awards", "Outstanding Performance by an Actress in a Series", "The Barbara Stanwyck Show", "Won", "-" ], [ "1966", "Emmy Awards", "Outstanding Continued Performance by an Actress in a Leading Role", "The Big Valley", "Won", "-" ], [ "1966", "Golden Globe Awards", "Best TV Star – Female", "The Big Valley", "Nominated", "-" ], [ "1967", "Emmy Awards", "Outstanding Continued Performance by an Actress in a Leading Role", "The Big Valley", "Nominated", "-" ], [ "1967", "Golden Globe Awards", "Best TV Star – Female", "The Big Valley", "Nominated", "-" ], [ "1967", "Screen Actors Guild", "Life Achievement", "-", "Won", "-" ], [ "1968", "Emmy Awards", "Outstanding Continued Performance by an Actress in a Leading Role", "The Big Valley", "Nominated", "-" ], [ "1968", "Golden Globe Awards", "Best TV Star – Female", "The Big Valley", "Nominated", "-" ], [ "1973", "Hall of Great Western Performers Cowboy Hall of Fame Oklahoma City", "Lifetime Achievement Award Performer", "-", "Won", "-" ], [ "1981", "Film Society of Lincoln Center Gala Tribute", "-", "-", "Won", "-" ], [ "1981", "Los Angeles Film Critics Association", "Career Achievement", "-", "Won", "-" ], [ "1982", "Academy Awards", "Honorary Award", "-", "Won", "-" ], [ "1983", "Emmy Awards", "Outstanding Lead Actress in a Limited Series", "The Thorn Birds", "Won", "-" ], [ "1984", "Golden Globe Awards", "Best Performance by an Actress in a Supporting Role", "The Thorn Birds", "Won", "-" ], [ "1986", "Golden Globe Awards", "Cecil B. DeMille Award", "-", "Won", "-" ], [ "1987", "American Film Institute", "Life Achievement", "-", "Won", "-" ] ], "title": "", "original_id": "28bf1ccc00e7ac7016bde04933ece3e4" }, { "_id": "b2ea14633c7cdfd0fa1e93b2821d4889", "header": [ "year", "men 's singles", "women 's singles", "men 's doubles", "women 's doubles", "mixed doubles" ], "rows": [ [ "1993", "jim laugesen", "mette sørensen", "neil cottrill john quinn", "nadezhda chervyakova marina yakusheva", "john quinn nicola beck" ], [ "1994", "henrik sörensen", "irina serova", "henrik sörensen claus simonsen", "lene sörensen mette sørensen", "jürgen koch irina serova" ], [ "1995", "thomas soegaard", "elena rybkina", "thomas stavngaard janek roos", "michelle rasmussen mette sørensen", "janek roos pernille harder" ], [ "1996", "daniel ericsson", "tanja berg", "johan tholinsson henrik andersson", "ann - lou jørgensen christina sörensen", "jonas rasmussen ann - lou jørgensen" ], [ "1997", "martin hagberg", "anne gibson", "james anderson ian sullivan", "rebeka pantaney gail emms", "ian sulivan gail emms" ], [ "1998", "robert nock", "ella karachkova", "graham hurrell paul jeffrey", "lorraine cole tracey dineen", "anthony clark lorraine cole" ], [ "1999", "robert nock", "katja michalowsky", "svetoslav stojanov michal popov", "liza parker suzanne rayappan", "ola molin johanna persson" ], [ "2000", "gerben bruystens", "christina b sörensen", "thomas hovgaard jesper mikla", "britta andersen lene mork", "mathias boe britta andersen" ], [ "2001", "bobby milroy", "rebecca panteney", "michael popov manuel dubrulle", "nadiezda kostiuczyk kamila augustyn", "kristian roebuck natalie munt" ], [ "2002", "przemysław wacha", "sara persson", "svetoslav stoyanov vincent laigle", "johanna persson elin berglom", "andrey konakh nadiezda kostiuczyk" ], [ "2003", "michael christensen", "petya nedelcheva", "michael popov manuel dubrulle", "petya nedelcheva nely boteva", "mike beres jody patrick" ], [ "2004", "per - henrik croona", "katja michalowsky", "mike beres william milroy", "britta andersen mie schjott kristensen", "jesper thomsen britta andersen" ], [ "2005", "przemysław wacha", "susan hughes", "chris langridge chris tonks", "nadiezda kostiuczyk kamila augustyn", "henri hurskainen johanna persson" ], [ "2006", "jan o jorgensen", "ragna ingolfsdottir", "robert adcock robin middleton", "mie schjott - kristensen christinna pedersen", "liza parker robin middleton" ], [ "2007", "arvind bhat", "rachel van cutsen", "kasper henriksen rasmus bonde", "mie schjott - kristensen christinna pedersen", "rasmus bonde christinna pedersen" ], [ "2008", "chetan anand", "ella diehl", "kasper henriksen christian skovgaard", "helle nielsen marie roepke", "rasmus bonde helle nielsen" ], [ "2009", "petr koukal", "trupti murgunde", "mads conrad - petersen mads pieler kolding", "maria helsbol anne skelbaek", "viki indra okvana gustiani megawati" ], [ "2010", "ajay jayaram", "karina jörgensen", "chris langridge robin middleton", "selena piek iris tabeling", "anders skaarup rasmussen anne skelbaek" ], [ "2011", "przemyslaw wacha", "kristina gavnholt", "adam cwalina michal logosz", "valeria sorokina nina vislova", "alexandr nikolaenko nina vislova" ], [ "2012", "joachim persson", "kirsty gilmour", "chris langridge peter mills", "heather olver kate robertshaw", "chris langridge heather olver" ] ], "title": "", "original_id": "69837e67a1ab18c4f912f97bf9c714bd" }, { "_id": "7b24a7989adac29045dbca13bfd4a8fd", "header": [ "year", "winner", "jockey", "trainer", "owner", "distance (miles)", "time" ], "rows": [ [ "2013", "war dancer", "alan garcia", "kenneth g mcpeek", "magdalena racing", "1 - 1 / 4", "2:03.57" ], [ "2012", "silver max", "robby albarado", "dale l romans", "bacon / wells", "1 - 1 / 4", "2:04.05" ], [ "2011", "air support", "alex solis", "shug mcgaughey", "stuart janney iii", "1 - 1 / 4", "2:00.80" ], [ "2010", "paddy o'prado", "kent j desormeaux", "dale l romans", "winchell thoroughbreds", "1 - 1 / 4", "2:02.58" ], [ "2009", "battle of hastings", "tyler baze", "jeff mullins", "michael house", "1 - 1 / 4", "2:03.29" ], [ "2008", "gio ponti", "garrett gomez", "christophe clement", "castleton lyons", "1 - 1 / 4", "2:02.22" ], [ "2007", "red giant", "horacio karamanos", "todd a pletcher", "peachtree stable", "1 - 1 / 4", "1:59.62" ], [ "2006", "go between", "garrett k gomez", "william i mott", "peter vegso", "1 - 1 / 4", "1:59.74" ], [ "2005", "english channel", "john r velazquez", "todd a pletcher", "james t scatuorchio", "1 - 1 / 4", "2:02.57" ], [ "2004", "kitten 's joy", "edgar s prado", "dale l romans", "ken and sarah ramsey", "1 - 1 / 4", "2:01.22" ], [ "2003", "silver tree", "edgar s prado", "william i mott", "peter vegso", "1 - 1 / 4", "2:01.11" ], [ "2002", "orchard park", "edgar s prado", "william i mott", "peter vegso", "1 - 1 / 4", "2:03.10" ], [ "2001", "potaro", "brent bartram", "jonathan sheppard", "augustin stable", "1 - 1 / 4", "2:02.18" ], [ "2000", "lightning paces", "greg hutton", "john j robb", "tulip hill farm", "1 - 1 / 4", "2:02.18" ], [ "1999", "phi beta doc", "ramon dominguez", "robert w leonard", "dennis foster / r leonard", "1 - 1 / 4", "1:59.97" ], [ "1998", "crowd pleaser", "jean - luc samyn", "jonathan sheppard", "augustin stable", "1 - 1 / 4", "2:00.28" ] ], "title": "", "original_id": "afe452325ae2a67d28cd447dd37686d6" }, { "_id": "48a8180daadb7db17ff59b5a3b04e89d", "header": [ "Year", "Award", "Category", "Nominated work", "Result", "Ref." ], "rows": [ [ "2015", "30th Golden Rooster Awards", "Best Supporting Actor", "Dearest", "Won", "-" ], [ "2016", "33rd Hundred Flowers Awards", "Best Supporting Actor", "Dearest", "Nominated", "-" ], [ "2017", "24th Beijing College Student Film Festival", "Best Actor", "Cock and Bull", "Won", "-" ], [ "2017", "8th China Film Director's Guild Awards", "Best Actor", "Cock and Bull", "Won", "-" ], [ "2017", "31st Golden Rooster Awards", "Best Supporting Actor", "Cock and Bull", "Nominated", "-" ], [ "2017", "23rd Shanghai Television Festival", "Best Actor", "Feather Flies to the Sky", "Won", "-" ], [ "2018", "31st Flying Apsaras Award", "Outstanding Actor", "Feather Flies to the Sky", "Nominated", "-" ], [ "2018", "29th China TV Golden Eagle Award", "Best Actor", "Feather Flies to the Sky", "Won", "-" ], [ "2018", "25th Beijing College Student Film Festival", "Best Actor", "Operation Red Sea", "Nominated", "-" ], [ "2018", "34th Hundred Flowers Awards", "Best Actor", "Operation Red Sea", "Nominated", "-" ] ], "title": "", "original_id": "f7ca4efbf662c36e751424be8b2f4d1f" }, { "_id": "049d567592d768c550adb6e63f2b2e6b", "header": [ "Year", "Association", "Category", "Nominated work", "Result", "Ref." ], "rows": [ [ "2008", "ASCAP Pop Music Awards", "ASCAP Vanguard Award", "Herself", "Won", "-" ], [ "2009", "Grammy Awards", "Song of the Year", "\"Love Song\"", "Nominated", "-" ], [ "2009", "Grammy Awards", "Best Female Pop Vocal Performance", "\"Love Song\"", "Nominated", "-" ], [ "2011", "Grammy Awards", "Best Female Pop Vocal Performance", "\"King of Anything\"", "Nominated", "-" ], [ "2011", "BDSCertified Spin Awards", "700,000 Spins", "\"Love Song\"", "Won", "-" ], [ "2012", "MVPA Awards", "Best Directional Debut", "\"Gonna Get Over You\"", "Nominated", "-" ], [ "2012", "MVPA Awards", "Best Choreography", "\"Gonna Get Over You\"", "Won", "-" ], [ "2014", "World Music Awards", "World's Best Song", "\"Brave\"", "Nominated", "-" ], [ "2014", "MTV Video Music Awards Japan", "Best Choreography", "\"Brave\"", "Nominated", "-" ], [ "2014", "Grammy Awards", "Best Pop Solo Performance", "\"Brave\"", "Nominated", "-" ], [ "2014", "Grammy Awards", "Album of the Year", "The Blessed Unrest", "Nominated", "-" ], [ "2014", "American Music Award", "Favorite Adult Contemporary Artist", "Herself", "Nominated", "-" ], [ "2016", "Tony Award", "Best Original Score", "Waitress", "Nominated", "-" ], [ "2016", "Drama Desk Award", "Outstanding Music", "Waitress", "Nominated", "-" ], [ "2016", "Drama Desk Award", "Outstanding Lyrics", "Waitress", "Nominated", "-" ], [ "2016", "Outer Critics Circle Award", "Outstanding New Score (Broadway or Off-Broadway)", "Waitress", "Nominated", "-" ], [ "2017", "Grammy Awards", "Best Musical Theater Album", "Waitress", "Nominated", "-" ], [ "2017", "Broadway.com Audience Awards", "Favorite Female Replacement", "Waitress", "Won", "-" ], [ "2017", "Hollywood Music in Media Awards", "Original Song - Featured Film", "\"If I Dare\"", "Nominated", "-" ], [ "2017", "Women's Entrepreneurship Day Pioneer Awards", "Music", "Herself", "Won", "-" ], [ "2018", "Tony Award", "Best Original Score", "SpongeBob SquarePants", "Nominated", "-" ], [ "2018", "Emmy Award", "Outstanding Supporting Actress in a Limited Series or Movie", "Jesus Christ Superstar Live in Concert", "Nominated", "-" ], [ "2019", "Grammy Award", "Best Musical Theater Album", "Jesus Christ Superstar Live in Concert", "Nominated", "-" ] ], "title": "", "original_id": "21f6f7538ed226cc54b563131618e08f" }, { "_id": "a307797ce0988da30363904793a8d04c", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Spain", "Representing Spain", "Representing Spain", "Representing Spain", "Representing Spain", "Representing Spain" ], [ "2000", "World Junior Championships", "Santiago, Chile", "5th (heats)", "800m", "1:51.65" ], [ "2002", "European Indoor Championships", "Vienna, Austria", "19th (heats)", "800m", "1:51.95" ], [ "2002", "World Junior Championships", "Kingston, Jamaica", "8th", "800m", "1:56.73" ], [ "2003", "European Indoor Cup", "Leipzig, Germany", "5th", "800m", "1:49.55" ], [ "2003", "European U23 Championships", "Bydgoszcz, Poland", "3rd", "800m", "1:46.83" ], [ "2003", "World Championships", "Paris, France", "4th (heats)", "800 m", "1:47.98" ], [ "2004", "Olympic Games", "Athens, Greece", "4th (heats)", "800 m", "1:47.71" ], [ "2005", "European U23 Championships", "Erfurt, Germany", "2nd", "800m", "1:51.47" ], [ "2006", "European Championships", "Gothenburg, Sweden", "12th (semis)", "800m", "1:49.37" ], [ "2007", "European Indoor Championships", "Birmingham, United Kingdom", "12th (heats)", "800m", "1:54.54" ], [ "2007", "World Championships", "Osaka, Japan", "5th (semis)", "800 m", "1:45.61" ], [ "2007", "IAAF World Athletics Final", "Stuttgart, Germany", "6th", "800m", "1:47.06" ], [ "2008", "World Indoor Championships", "Valencia, Spain", "5th (semis)", "800 m", "1:48.90" ], [ "2008", "Olympic Games", "Beijing, China", "4th (semis)", "800 m", "1:45.91" ], [ "2009", "European Indoor Championships", "Turin, Italy", "5th", "800 m", "1:49.77" ], [ "2009", "World Championships", "Berlin, Germany", "—", "800 m", "DNF" ], [ "2010", "European Championships", "Barcelona, Spain", "3rd", "1500 m", "3:43.54" ], [ "2011", "European Indoor Championships", "Paris, France", "1st", "1500 m", "3:41.03" ], [ "2011", "European Team Championships", "Stockholm, Sweden", "1st", "1500 m", "3:38.63" ] ], "title": "", "original_id": "683bd6790af412784782f32319148ce8" }, { "_id": "5dad570c18304377caf1c09879b9a92c", "header": [ "year", "winner (number of titles)", "runners - up", "top team in regular season (points)", "top scorer (points)", "winning coach" ], "rows": [ [ "1968", "atlanta chiefs (1)", "san diego toros", "san diego toros (186 points)", "janusz kowalik", "phil woosnam" ], [ "1969", "kansas city spurs (1)", "atlanta chiefs", "kansas city spurs (110 points)", "kaizer motaung", "janos bedl" ], [ "1970", "rochester lancers (1)", "washington darts", "washington darts (137 points)", "kirk apostolidis", "sal derosa" ], [ "1971", "dallas tornado (1)", "atlanta chiefs", "rochester lancers (141 points)", "carlos metidieri", "ron newman" ], [ "1972", "new york cosmos (1)", "st louis stars", "new york cosmos (77 points)", "randy horton", "gordon bradley" ], [ "1973", "philadelphia atoms (1)", "dallas tornado", "dallas tornado (111 points)", "kyle rote , jr", "al miller" ], [ "1974", "los angeles aztecs (1)", "miami toros", "los angeles aztecs (110 points)", "paul child", "alex perolli" ], [ "1975", "tampa bay rowdies (1)", "portland timbers", "portland timbers (138 points)", "steve david", "eddie firmani" ], [ "1976", "toronto metros - croatia (1)", "minnesota kicks", "tampa bay rowdies (154 points)", "giorgio chinaglia", "domagoj kapetanović" ], [ "1977", "new york cosmos (2)", "seattle sounders", "fort lauderdale strikers (161 points)", "steve david", "eddie firmani" ], [ "1978", "new york cosmos (3)", "tampa bay rowdies", "new york cosmos (212 points)", "giorgio chinaglia", "eddie firmani" ], [ "1979", "vancouver whitecaps (1)", "tampa bay rowdies", "new york cosmos (216 points)", "oscar fabbiani", "tony waiters" ], [ "1980", "new york cosmos (4)", "fort lauderdale strikers", "new york cosmos (213 points)", "giorgio chinaglia", "hennes weisweiler & yasin özdenak" ], [ "1981", "chicago sting (1)", "new york cosmos", "new york cosmos (200 points)", "giorgio chinaglia", "willy roy" ], [ "1982", "new york cosmos (5)", "seattle sounders", "new york cosmos (203 points)", "giorgio chinaglia", "julio mazzei" ], [ "1983", "tulsa roughnecks (1)", "toronto blizzard", "new york cosmos (194 points)", "roberto cabañas", "terry hennessey" ] ], "title": "", "original_id": "6f65e885bfa8dc52b0cd93679c9acca7" }, { "_id": "6ada3857bbf5aa5d2d8813f4d8db225a", "header": [ "year", "venue", "location", "winning team", "score", "us captain", "international captain" ], "rows": [ [ "2013", "muirfield village", "dublin , ohio", "united states", "18½ - 15½", "fred couples", "nick price" ], [ "2011", "royal melbourne golf club", "melbourne , australia", "united states", "19 - 15", "fred couples", "greg norman" ], [ "2009", "harding park golf club", "san francisco , california", "united states", "19½ - 14½", "fred couples", "greg norman" ], [ "2007", "royal montreal golf club", "montreal , canada", "united states", "19½ - 14½", "jack nicklaus", "gary player" ], [ "2005", "robert trent jones golf club", "gainesville , virginia", "united states", "18½ - 15½", "jack nicklaus", "gary player" ], [ "2003", "fancourt hotel and country club", "george , western cape , south africa", "tied", "17 - 17", "jack nicklaus", "gary player" ], [ "2000", "robert trent jones golf club", "gainesville , virginia", "united states", "21½ - 10½", "ken venturi", "peter thomson" ], [ "1998", "royal melbourne golf club", "melbourne , australia", "international", "20½ - 11½", "jack nicklaus", "peter thomson" ], [ "1996", "robert trent jones golf club", "gainesville , virginia", "united states", "16½ - 15½", "arnold palmer", "peter thomson" ], [ "1994", "robert trent jones golf club", "gainesville , virginia", "united states", "20 - 12", "hale irwin", "david graham" ] ], "title": "", "original_id": "04ee0f17194c6801d956b34508e32420" }, { "_id": "690dbec079ff62d836d1a7d6a0815d91", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing France", "Representing France", "Representing France", "Representing France", "Representing France", "Representing France" ], [ "2011", "World Youth Championships", "Lille, France", "7th", "400 m", "47.27" ], [ "2011", "World Youth Championships", "Lille, France", "3rd", "Medley relay", "1:51.81" ], [ "2013", "European Indoor Championships", "Gothenburg, Sweden", "–", "400 m", "DQ" ], [ "2013", "European Junior Championships", "Rieti, Italy", "3rd", "400 m", "46.21" ], [ "2013", "European Junior Championships", "Rieti, Italy", "4th", "4x400 m relay", "3:05.41" ], [ "2014", "IAAF World Relays", "Nassau, Bahamas", "10th (h)", "4x400 m relay", "3:03.74" ], [ "2014", "European Championships", "Zürich, Switzerland", "3rd", "4x400 m relay", "2:59.89" ], [ "2015", "IAAF World Relays", "Nassau, Bahamas", "10th (h)", "4x400 m relay", "3:03.88" ], [ "2015", "European U23 Championships", "Tallinn, Estonia", "1st", "400 m", "45.50" ], [ "2015", "European U23 Championships", "Tallinn, Estonia", "1st", "4x400 m relay", "3:04.92" ], [ "2015", "World Championships", "Beijing, China", "6th", "4x400 m relay", "3:00.65" ], [ "2016", "European Championships", "Amsterdam, Netherlands", "17th (sf)", "400 m", "46.24" ], [ "2016", "European Championships", "Amsterdam, Netherlands", "12th (h)", "4x400 m relay", "3:04.95" ], [ "2016", "Olympic Games", "Rio de Janeiro, Brazil", "9th (h)", "4x400 m relay", "3:00.82" ], [ "2017", "European Indoor Championships", "Belgrade, Serbia", "7th (h)", "400 m", "47.49" ], [ "2017", "European Indoor Championships", "Belgrade, Serbia", "4th", "4x400 m relay", "3:08.99" ], [ "2017", "IAAF World Relays", "Nassau, Bahamas", "8th", "4x400 m relay", "3:06.33" ], [ "2017", "World Championships", "London, United Kingdom", "8th", "4x400 m relay", "3:01.79" ], [ "2018", "European Championships", "Berlin, Germany", "4th", "4 × 400 m relay", "3:02.08" ], [ "2019", "European Indoor Championships", "Glasgow, United Kingdom", "3rd", "4 × 400 m relay", "3:07.71" ] ], "title": "", "original_id": "62a2796dac6e8c1bb660234c453b25bf" }, { "_id": "6ad1ccb699929673724bc3c95854ce6a", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Norway", "Representing Norway", "Representing Norway", "Representing Norway", "Representing Norway", "Representing Norway" ], [ "1980", "Stockholm Marathon", "Stockholm, Sweden", "1st", "Marathon", "2:38:45" ], [ "1981", "Stockholm Marathon", "Stockholm, Sweden", "1st", "Marathon", "2:41:34" ], [ "1981", "New York City Marathon", "New York, United States", "2nd", "Marathon", "2:30:08" ], [ "1982", "Stockholm Marathon", "Stockholm, Sweden", "1st", "Marathon", "2:34:26" ], [ "1982", "European Championships", "Athens, Greece", "3rd", "Marathon", "2:36:38" ], [ "1982", "New York City Marathon", "New York, United States", "5th", "Marathon", "2:33:36" ], [ "1983", "Houston Marathon", "Houston, United States", "1st", "Marathon", "2:33:27" ], [ "1984", "Houston Marathon", "Houston, United States", "1st", "Marathon", "2:27:51" ], [ "1984", "World Cross Country Championships", "New York, United States", "4th", "-", "-" ], [ "1984", "London Marathon", "London, United Kingdom", "1st", "Marathon", "2:24:26" ], [ "1984", "Olympic Games", "Los Angeles, United States", "4th", "Marathon", "2:27:14" ], [ "1985", "World Cross Country Championships", "Lisbon, Portugal", "3rd", "-", "-" ], [ "1985", "London Marathon", "London, United Kingdom", "1st", "Marathon", "2:21:06" ], [ "1985", "Chicago Marathon", "Chicago, United States", "2nd", "Marathon", "2:23:05" ], [ "1986", "Boston Marathon", "Boston, United States", "1st", "Marathon", "2:24:55" ], [ "1986", "European Championships", "Stuttgart, West Germany", "1st", "10,000 m", "30:23.25" ], [ "1986", "Chicago Marathon", "Chicago, United States", "1st", "Marathon", "2:27:08" ], [ "1987", "World Cross Country Championships", "Warsaw, Poland", "3rd", "-", "-" ], [ "1987", "London Marathon", "London, United Kingdom", "1st", "Marathon", "2:22:48" ], [ "1987", "World Championships", "Rome, Italy", "1st", "10,000 m", "31:05.85" ], [ "1987", "World Road Race Championships", "Monte Carlo, Monaco", "1st", "15 km", "47:17" ], [ "1988", "World Road Race Championships", "Adelaide, Australia", "1st", "15 km", "48:24" ], [ "1988", "World Cross Country Championships", "Auckland, New Zealand", "1st", "-", "-" ], [ "1988", "London Marathon", "London, United Kingdom", "1st", "Marathon", "2:25:41" ], [ "1988", "Olympic Games", "Seoul, South Korea", "—", "10,000 m", "DNF" ], [ "1989", "Boston Marathon", "Boston, United States", "1st", "Marathon", "2:24:33" ], [ "1989", "New York City Marathon", "New York, United States", "1st", "Marathon", "2:25:30" ], [ "1991", "World Championships", "Tokyo, Japan", "7th", "10,000 m", "32:10.75" ] ], "title": "", "original_id": "44c97ca5774b136c1cc34aa547a5c2d3" }, { "_id": "69e5ba3d96729c6f6aa2475087e79563", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "2002", "Central American and Caribbean Junior Championships (U-17)", "Bridgetown, Barbados", "1st", "5 km", "21:24.33 CR" ], [ "2004", "Central American and Caribbean Junior Championships (U-20)", "Coatzacoalcos, México", "1st", "10 km", "43:21.99" ], [ "2004", "World Junior Championships", "Grosseto, Italy", "4th", "10 km", "41:01.64" ], [ "2005", "World Championships", "Helsinki, Finland", "8th", "20 km", "1:20:45" ], [ "2006", "Central American and Caribbean Games", "Cartagena, Colombia", "2nd", "20 km", "1:26:30" ], [ "2007", "World Championships", "Osaka, Japan", "4th", "20 km", "1:23:36" ], [ "2008", "Olympic Games", "Beijing, PR China", "15th", "20 km", "1:21:53" ], [ "2009", "World Championships", "Berlin, Germany", "3rd", "20 km", "1:19:22" ], [ "2010", "Central American and Caribbean Games", "Mayagüez, Puerto Rico", "1st", "20 km", "1:22:32 GR" ], [ "2011", "World Championships", "Daegu, Korea", "15th", "20 km", "1:23:05" ], [ "2011", "Pan American Games", "Guadalajara, Mexico", "6th", "20 km", "1:25:00" ] ], "title": "", "original_id": "c3b5ccefd2f494f20227e5932ecc5f4a" }, { "_id": "5e3f66007865b50f6fe896724495192d", "header": [ "year", "team", "co - drivers", "class", "laps", "pos", "class pos" ], "rows": [ [ "2002", "prodrive", "rickard rydell alain menu", "gts", "167", "dnf", "dnf" ], [ "2003", "veloqx prodrive racing", "peter kox jamie davies", "gts", "336", "10th", "1st" ], [ "2004", "prodrive racing", "peter kox alain menu", "gts", "325", "11th", "4th" ], [ "2005", "aston martin racing", "peter kox pedro lamy", "gt1", "327", "dnf", "dnf" ], [ "2006", "aston martin racing", "darren turner andrea piccini", "gt1", "350", "6th", "2nd" ], [ "2007", "aston martin racing", "johnny herbert peter kox", "gt1", "337", "9th", "4th" ], [ "2008", "charouz racing system aston martin racing", "jan charouz stefan mücke", "lmp1", "354", "9th", "9th" ], [ "2009", "amr eastern europe", "jan charouz stefan mücke", "lmp1", "373", "4th", "4th" ], [ "2010", "young driver amr", "christoffer nygaard peter kox", "gt1", "311", "22nd", "3rd" ] ], "title": "", "original_id": "b9c6c463d0a104019f3bd66c71816c25" }, { "_id": "3b15285b448d014937fe296fbabe0ded", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Algeria", "Representing Algeria", "Representing Algeria", "Representing Algeria", "Representing Algeria", "Representing Algeria" ], [ "2001", "World Youth Championships", "Debrecen, Hungary", "26th", "10,000 m walk", "48:40.35" ], [ "2004", "World Race Walking Cup", "Naumburg, Germany", "–", "20 km walk", "DQ" ], [ "2006", "African Championships", "Bambous, Mauritius", "6th", "20 km walk", "1:29:34" ], [ "2007", "All-Africa Games", "Algiers, Algeria", "3rd", "20 km walk", "1:25:12" ], [ "2007", "Pan Arab Games", "Cairo, Egypt", "3rd", "20,000 m walk", "1:43:35.8" ], [ "2008", "African Championships", "Addis Ababa, Ethiopia", "1st", "20 km walk", "1:22:55 (CR)" ], [ "2008", "Olympic Games", "Beijing, China", "48th", "20 km walk", "1:32:21" ], [ "2009", "Universiade", "Belgrade, Serbia", "15th", "20 km walk", "1:26:21" ], [ "2010", "African Championships", "Nairobi, Kenya", "5th", "20 km walk", "1:24:53" ], [ "2012", "African Championships", "Addis Ababa, Ethiopia", "3rd", "20 km walk", "?" ], [ "2014", "African Championships", "Marrakech, Morocco", "3rd", "20 km walk", "1:27:48" ], [ "2015", "African Games", "Brazzaville, Republic of the Congo", "–", "20 km walk", "DNF" ], [ "2016", "African Championships", "Durban, South Africa", "7th", "20 km walk", "1:26:17" ], [ "2018", "African Championships", "Asaba, Nigeria", "6th", "20 km walk", "1:28.38" ] ], "title": "", "original_id": "ad90ad414ff991cd2c1aed8154091536" }, { "_id": "026db8824291afdf9f2426205fff107d", "header": [ "Year", "Competition", "Venue", "Position", "Notes", "-" ], "rows": [ [ "Representing Ireland", "Representing Ireland", "Representing Ireland", "Representing Ireland", "Representing Ireland", "-" ], [ "1978", "Irish National Marathon Championship", "Tullamore", "Gold", "2:23:19", "18 June 1978" ], [ "1978", "1978 European Championships in Athletics", "Prague", "29th", "2:21:01", "3 September 1978" ], [ "1980", "Dublin Marathon", "Dublin", "Gold", "2:16:14", "26 October 1980" ], [ "1980", "Irish National Marathon Championship", "Tullamore", "Gold", "2:16:27", "8 July 1980" ], [ "1980", "Moscow Olympics", "Moscow", "38th place", "2:23:53", "1 August 1980" ], [ "1981", "Irish National Marathon Championship", "Cork", "Gold", "2:15:37", "7 June 1981" ], [ "1982", "Irish National Marathon Championship", "Limerick", "Gold", "2:12:56", "6 June 1982" ], [ "1982", "1982 European Championships in Athletics – Men's Marathon", "Athens", "11th place", "2:20:51", "12 September 1982" ], [ "1984", "Irish National Marathon Championship", "Cork", "Gold", "2:14:39", "23 April 1984" ], [ "1984", "Los Angeles Olympics", "Los Angeles", "51st place", "2:24:41", "12 August 1984" ], [ "1985", "Dublin Marathon", "Dublin", "Gold", "2:13:48", "27 October 1985" ], [ "1986", "Dublin Marathon", "Dublin", "Gold", "2:18:10", "26 October 1986" ], [ "1986", "1986 European Athletics Championships – Men's marathon", "Stuttgart", "16th place", "2:17.45", "30 August 1986" ], [ "1987", "1987 Dublin Marathon", "Dublin", "Bronze", "2:14:36", "25 October 1987" ], [ "1988", "Irish National Marathon Championship", "Wexford", "Silver", "2:12:19 PB", "24 April 1988" ], [ "1988", "Seoul Olympics", "Seoul", "24th place", "2:17:16", "2 October 1988" ], [ "1990", "1990 European Championships in Athletics – Men's Marathon", "Split", "23rd place", "2:32.36", "1 September 1990" ], [ "1998", "Irish National Marathon Championship", "Killenaule", "Gold", "(2:22:08)", "19 April 1998" ], [ "1998", "New York City Marathon", "New York City", "34th place", "2:22:46", "1 November 1998" ] ], "title": "", "original_id": "bf5aa174142f7c00d027c71cde38f669" }, { "_id": "348ad5306db94cbc7568a6520211ea8a", "header": [ "Year", "Winners", "Score", "Score.1", "Runners-up", "Venue", "Winning Captain" ], "rows": [ [ "2000", "Meath", "5-14 (29)", "2-10 (16)", "Carlow", "Cusack Park", null ], [ "2001", "Kerry", "4-14 (22)", "3-10 (19)", "Westmeath", "Croke Park", "Michael 'Boxer' Slattery" ], [ "2002", "Laois", "1-20 (23)", "2-14 (20)", "Antrim", "Semple Stadium", "John Lyons" ], [ "2003", "Antrim", "3-18 (27)", "3-12 (21)", "Kerry", "Croke Park", null ], [ "2004", "Down", "5-15 (30)", "3-7 (16)", "Westmeath", "Gaelic Grounds", "Simon Wilson" ], [ "2005", "Offaly", "6-21 (39)", "4-7 (19)", "Carlow", "Semple Stadium", "Barry Teehan" ], [ "2006", "Dublin", "0-16 (16)", "1-6 (9)", "Kerry", "Semple Stadium", "Philip Brennan" ], [ "2007", "Laois", "2-19 (25)", "0-8 (8)", "Wicklow", "Semple Stadium", "Joe FitzPatrick" ], [ "2008", "Westmeath", "2-12 (18)", "0-12 (12)", "Carlow", "Gaelic Grounds", "Brendan Murtagh" ], [ "2009", "Offaly", "1-13 (16)", "0-13 (13)", "Wexford", "Semple Stadium", "Ger Oakley" ], [ "2010", "Wexford", "1-16 (19)", "2-9 (15)", "Clare", "Semple Stadium", "Diarmuid Lyng" ], [ "2011", "Limerick", "4-12 (24)", "2-13 (19)", "Clare", "Cusack Park", "Gavin O'Mahony" ], [ "2012", "Clare", "0-21 (21)", "1-16 (19)", "Limerick", "Gaelic Grounds", "Patrick Donnellan" ], [ "2013", "Dublin", "1-16 (19)", "1-15 (18)", "Limerick", "Semple Stadium", "TBC" ] ], "title": "", "original_id": "17df1b57444c60eb8a376c944f8078d4" }, { "_id": "3025830ca114e0a31ad258cc854d2d57", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Germany", "Representing Germany", "Representing Germany", "Representing Germany", "Representing Germany", "Representing Germany" ], [ "2006", "European Championships", "Gothenburg, Sweden", "10th (h)", "1500 m", "3:42.62" ], [ "2008", "World Indoor Championships", "Valencia, Spain", "10th (h)", "1500 m", "3:41.54" ], [ "2008", "Olympic Games", "Beijing, China", "14th (sf)", "1500 m", "3:37.94" ], [ "2009", "European Indoor Championships", "Turin, Italy", "12th (h)", "1500 m", "3:43.45" ], [ "2009", "World Championships", "Berlin, Germany", "30th (h)", "1500 m", "3:44.00" ], [ "2010", "European Championships", "Barcelona, Spain", "2nd", "1500 m", "3:43.52" ], [ "2011", "European Indoor Championships", "Paris, France", "4th", "1500 m", "3:41.55" ], [ "2012", "European Championships", "Helsinki, Finland", "17th (h)", "1500 m", "3:46.52" ], [ "2012", "Olympic Games", "London, United Kingdom", "11th (sf)", "1500 m", "3:38.23" ], [ "2013", "World Championships", "Moscow, Russia", "22nd (sf)", "1500 m", "3:44.44" ] ], "title": "", "original_id": "292273783eb28ae67577c7ae703155c7" }, { "_id": "f42c5d9a93f7c9676db31fc6d9126a8c", "header": [ "Year", "Image", "Winner", "University", "Sport", "Other nominees", "Ref(s)" ], "rows": [ [ "2002", "Sue Bird playing in a basketball game in 2012", "Sue Bird", "University of Connecticut Huskies", "Basketball", "Natalie Coughlin – California Golden Bears (Swimming) Jennie Finch – Arizona Wildcats (Softball) Stacey Nuveman – UCLA Bruins (Softball) Jackie Stiles – Missouri State Lady Bears (Basketball)", "-" ], [ "2003", "Diana Taurasi competing in a basketball match in 2014", "Diana Taurasi", "University of Connecticut Huskies", "Basketball", "Alana Beard – Duke Blue Devils (Basketball) Natalie Coughlin – California Golden Bears (Swimming) Cat Osterman – Texas Longhorns (Softball)", "-" ], [ "2004", "Diana Taurasi at the White House in 2008", "Diana Taurasi", "University of Connecticut Huskies", "Basketball", "Alana Beard – Duke Blue Devils (Basketball) Tara Kirk – Stanford Cardinal (Swimming) Cat Reddick – North Carolina Tar Heels (Soccer) Jessica van der Linden – Florida State Seminoles (Softball)", "-" ], [ "2005", "Cat Osterman competing in a softball tournament in 2006", "Cat Osterman", "University of Texas Longhorns", "Softball", "Seimone Augustus – LSU Lady Tigers (Basketball) Nicole Corriero – Harvard Crimson (Ice hockey) Kristen Maloney – UCLA Bruins (Gymnastics) Katie Thorlakson – Notre Dame (Soccer)", "-" ], [ "2006", "Cat Osterman competing in a softball tournament in 2006", "Cat Osterman", "University of Texas Longhorns", "Softball", "Seimone Augustus – LSU Lady Tigers (Basketball) Virginia Powell – USC Trojans (Track and field) Christine Sinclair – Portland Pilots (Soccer) Courtney Thompson – Washington Huskies (Volleyball)", "-" ], [ "2007", "Taryne Mowatt attending a Red Carpet event in 2008", "Taryne Mowatt", "University of Arizona Wildcats", "Softball", "Monica Abbott – Tennessee Volunteers (Softball) Kerri Hanks – Notre Dame Fighting Irish (Soccer) Kara Lynn Joyce – Georgia Bulldogs (Swimming)", "-" ], [ "2008", "Candace Parker playing for the Los Angeles Sparks in 2017", "Candace Parker", "University of Tennessee Lady Vols", "Basketball", "Rachel Dawson – North Carolina Tar Heels (Field hockey) Angela Tincher – Virginia Tech Hokies (Softball)", "-" ], [ "2009", "Maya Moore attending a celebratory dinner in 2009", "Maya Moore", "University of Connecticut Huskies", "Basketball", "Kerri Hanks – Notre Dame Fighting Irish (Soccer) Courtney Kupets – Georgia Gymdogs (Gymnastics) Danielle Lawrie – Washington Huskies (Softball) Dana Vollmer – California Golden Bears (Swimming)", "-" ], [ "2010", "Maya Moore playing for the United States National Women's Basketball team in 2010", "Maya Moore", "University of Connecticut Huskies", "Basketball", "Tina Charles – Connecticut Huskies (Basketball) Megan Hodge – Penn State Nittany Lions (Volleyball) Megan Langenfeld – UCLA Bruins (Softball)", "-" ], [ "2011", "Maya Moore holding a gold-plated trophy in 2011", "Maya Moore", "University of Connecticut Huskies", "Basketball", "Blair Brown – Penn State Nittany Lions (Volleyball) Dallas Escobedo – Arizona State Sun Devils (Softball) Melissa Henderson – Notre Dame Fighting Irish (Soccer) Katinka Hosszú – USC Trojans (Swimming)", "-" ], [ "2012", "Brittney Griner holding a trophy amongst a group of people in 2012", "Brittney Griner", "Baylor University Lady Bears", "Basketball", "Alexandra Jupiter – USC Trojans (Volleyball) Caitlin Leverenz – California Golden Bears (Swimming) Teresa Noyola – Stanford Cardinal (Soccer) Jackie Traina – Alabama Crimson Tide (Softball)", "-" ], [ "2013", "Brittney Griner competing in a 2017 basketball game", "Brittney Griner", "Baylor University Lady Bears", "Basketball", "Kara Cannizzaro – North Carolina Tar Heels (Lacrosse) Crystal Dunn – North Carolina Tar Heels (Soccer) Keilani Ricketts – Oklahoma Sooners (Softball)", "-" ], [ "2014", "Breanna Stewart holding a plague in her left hand in 2012", "Breanna Stewart", "University of Connecticut Huskies", "Basketball", "Morgan Brian – Virginia Cavaliers (Soccer) Taylor Cummings – Maryland Terrapins (Lacrosse) Micha Hancock – Penn State Nittany Lions (Volleyball) Hannah Rogers – Florida Gators (Softball)", "-" ], [ "2015", "Missy Franklin competing in an outdoor swimming tournament in 2014", "Missy Franklin", "University of California, Berkeley Golden Bears", "Swimming", "Taylor Cummings – Maryland Terrapins (Lacrosse) Lauren Haeger – Florida Gators (Softball) Micha Hancock – Penn State Nittany Lions (Volleyball) Breanna Stewart – Connecticut Huskies (Basketball)", "-" ], [ "2016", "Breanna Stewart holding a gold-plated trophy in both hands in 2016", "Breanna Stewart", "University of Connecticut Huskies", "Basketball", "Samantha Bricio – USC Trojans (Volleyball) Taylor Cummings – Maryland Terrapins (Lacrosse) Raquel Rodríguez – Penn State Nittany Lions (Soccer) Sierra Romero – Michigan Wolverines (Softball)", "-" ], [ "2017", "–", "Kelly Barnhill", "University of Florida Gators", "Softball", "Inky Ajanaku – Stanford Cardinal (Volleyball) Kadeisha Buchanan – West Virginia Mountaineers (Soccer) Kelsey Plum – Washington Huskies (Basketball) Zoe Stukenberg – Maryland Terrapins (Lacrosse)", "-" ] ], "title": "", "original_id": "028ff73df51114e5b016e37593d548ad" }, { "_id": "e41f2eb7764a4df3bd8598835d60decc", "header": [ "year", "title", "producer", "narrator", "author", "citation" ], "rows": [ [ "2013", "the fault in our stars", "brilliance audio", "kate rudd", "john green", "winner" ], [ "2013", "artemis fowl : the last guardian", "listening library", "nathaniel parker", "eoin colfer", "honor" ], [ "2013", "ghost knight", "listening library", "elliot hill", "cornelia funke", "honor" ], [ "2013", "monstrous beauty", "macmillan audio", "katherine kellgren", "elizabeth fama", "honor" ], [ "2012", "rotters", "listening library", "kirby heyborne", "daniel kraus", "winner" ], [ "2012", "ghetto cowboy", "brilliance audio", "jd jackson", "g neri", "honor" ], [ "2012", "okay for now", "listening library", "lincoln hoppe", "gary d schmidt", "honor" ], [ "2012", "the scorpio races", "scholastic audio books", "steve west fiona hardingham", "maggie stiefvater", "honor" ], [ "2012", "young fredle", "listening library", "wendy carter", "cynthia voigt", "honor" ], [ "2011", "the true meaning of smekday", "listening library", "bahni turpin", "adam rex", "honor" ], [ "2011", "alchemy and meggy swann", "listening library", "katherine kellgren", "karen cushman", "honor" ], [ "2011", "the knife of never letting go", "brilliance audio", "nick podehl", "patrick ness", "honor" ], [ "2011", "revolution", "listening library", "emily janice card", "jennifer donnelly", "honor" ], [ "2011", "will grayson , will grayson", "brilliance audio", "macleod andrews", "john green david levithan", "honor" ], [ "2010", "louise , the adventures of a chicken", "live oak media", "barbara rosenblat", "kate dicamillo", "winner" ], [ "2010", "in the belly of the bloodhound", "listen & live audio", "katherine kellgren", "l a meyer", "honor" ], [ "2010", "peace , locomotion", "brilliance audio", "dion graham", "jacqueline woodson", "honor" ], [ "2010", "we are the ship : the story of negro baseball", "brilliance audio", "dion graham", "kadir nelson", "honor" ], [ "2009", "the absolutely true diary of a part - time indian", "recorded books", "sherman alexie", "sherman alexie", "winner" ], [ "2009", "curse of the blue tattoo", "listen & live audio", "katherine kellgren", "l a meyer", "honor" ], [ "2009", "elijah of buxton", "listening library", "mirron willis", "christopher paul curtis", "honor" ], [ "2009", "i'm dirty", "scholastic media / weston woods studios", "steve buscemi", "kate mcmullan jim mcmullan", "honor" ], [ "2009", "martina the beautiful cockroach : a cuban folktale", "peachtree publishers", "carmen agra deedy", "carmen agra deedy", "honor" ], [ "2009", "nation", "harperaudio", "stephen briggs", "terry pratchett", "honor" ], [ "2008", "jazz", "live oak media", "james d - train williams vaneese thomas", "walter dean myers", "winner" ], [ "2008", "bloody jack", "listen & live audio", "katherine kellgren", "l a meyer", "honor" ], [ "2008", "dooby dooby moo", "scholastic / weston woods", "randy travis", "doreen cronin", "honor" ], [ "2008", "harry potter and the deathly hallows", "listening library", "jim dales", "j k rowling", "honor" ], [ "2008", "skulduggery pleasant", "harpercollins children 's audio", "rupert degas", "derek landy", "honor" ], [ "2008", "treasure island", "listening library", "alfred molina", "robert louis stevenson", "honor" ] ], "title": "", "original_id": "a420bb044e68533fb84926d477b77a1b" }, { "_id": "b5a34eb67e735212bbc8c7698046c56c", "header": [ "Year", "Film", "Director", "Role", "Country", "Notes" ], "rows": [ [ "2009", "Third Person Singular Number", "Mostofa Sarwar Farooki", "Ruba Haque", "Bangladesh", "Meril Prothom Alo Awards in Best Film Actress (Critics') category" ], [ "2010", "Runway", "Tareque Masud", "Selina", "Bangladesh", "Guest appearance" ], [ "2012", "Television", "Mostofa Sarwar Farooki", "Kohinoor", "Bangladesh", "Bangladesh's submission to Academy Awards" ], [ "2016", "Rana Pagla: The Mental", "Shamim Ahamed Roni", "Simi", "Bangladesh", "-" ], [ "2016", "Ostitto", "Anonno Mamun", "Pori", "Bangladesh", "National Film Award for Best Actress" ], [ "2017", "Doob: No Bed of Roses", "Mostofa Sarwar Farooki", "Saberi", "Bangladesh, India", "Meril Prothom Alo Awards in Best Film Actress(Popular) - Bangladesh's submission to 91st Academy Awards" ], [ "2017", "Haldaa", "Tauquir Ahmed", "Hasu", "Bangladesh", "-" ], [ "2018", "Rupkotha", "Golam Muktadir Shaan", "N/A", "Bangladesh", "A Bioscope Original production" ], [ "2019", "Trap", "Tanim Parvez", "N/A", "Bangladesh", "Iflix original short film" ], [ "2019", "Fagun Haway", "Tauquir Ahmed", "Deepti", "Bangladesh", "First Bangladeshi film based on the 1952 Language Movement" ], [ "2019", "Kintu Jodi Emon Hoto?", "Emran Emon", "Bushra", "Bangladesh", "First interactive short film in Bangladesh" ], [ "2019", "Holudboni", "Mukul Roy Chaudhuri & Taher Shipon", "Anu", "India, Bangladesh", "Post Production" ], [ "2019", "Saturday Afternoon", "Mostafa Sarwar Farooki", "N/A", "Bangladesh, Germany, Russia", "Inspired by the terror attack incident of 1st July, 2014 at Holey Artisan Bakery, Gulshan." ], [ "2019", "Mayaboti", "Arun Chowdhury", "Maya", "Bangladesh", "Post production" ], [ "2019", "Sincerely Yours, Dhaka", "Abdullah Al Noor, Golam Kibria Farooki, Krishnendu Chattopadhyay, Mahmudul Islam, Md Rabiul Alam, Mir Mukarram Hossain, Nuhash Humayun, Rahat Rahman, Syed Ahmed Shawki, Syed Saleh Ahmed Sobhan and Tanvir Ahsan", "Juthi", "Bangladesh", "First Bangladeshi Anthology film consisting of 11 vignettes by 11 Bangladeshi filmmakers" ], [ "2019", "Boba Rohosshya", "Abhishek Bagchi", "N/A", "India", "Pre production" ] ], "title": "", "original_id": "0de7c3849d42dbb530462d3c2d393334" }, { "_id": "b8f5b5f46d80a55df9d995e241ac5cfc", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Russia", "Representing Russia", "Representing Russia", "Representing Russia", "Representing Russia", "Representing Russia" ], [ "1996", "World Junior Championships", "Sydney, Australia", "18th (h)", "3000m", "9:42.99" ], [ "1996", "World Junior Championships", "Sydney, Australia", "12th", "5000m", "16:32.51" ], [ "1997", "European U23 Championships", "Turku, Finland", "7th", "5000m", "15:58.60" ], [ "1997", "European U23 Championships", "Turku, Finland", "7th", "10,000m", "33:48.43" ], [ "2003", "World Indoor Championships", "Birmingham, England", "6th", "3000 m", "8:50.62" ], [ "2003", "World Championships", "Paris, France", "6th", "10,000 m", "30:26.20" ], [ "2004", "World Indoor Championships", "Budapest, Hungary", "11th", "3000 m", "9:17.15" ], [ "2005", "World Championships", "Helsinki, Finland", "8th", "10,000 m", "30:33.75" ], [ "2005", "World Half Marathon Championships", "Edmonton, Canada", "4th", "Half marathon", "1:10:34" ], [ "2006", "European Championships", "Gothenburg, Sweden", "4th", "10,000 m", "30:35.90" ], [ "2008", "Rome City Marathon", "Rome, Italy", "1st", "Marathon", "2:22:53" ], [ "2008", "Olympic Games", "Beijing, PR China", "—", "Marathon", "DNF" ] ], "title": "", "original_id": "f100d3bd641b61a7b65d98cf81586752" }, { "_id": "fcce7ce2ffbf087318796b69c3b9a627", "header": [ "Year", "Award", "Category", "Work", "Result", "Ref." ], "rows": [ [ "2002", "Online Film & Television Association Awards", "Best Youth Performance", "Road to Perdition", "Nominated", "-" ], [ "2002", "Saturn Awards", "Best Performance by a Younger Actor", "Road to Perdition", "Won", "-" ], [ "2003", "Broadcast Film Critics Association Awards", "Best Young Actor/Actress", "Road to Perdition", "Nominated", "-" ], [ "2003", "Las Vegas Film Critics Society Awards", "Youth in Film", "Road to Perdition", "Nominated", "-" ], [ "2003", "Phoenix Film Critics Society Awards", "Best Performance by a Youth in a Leading or Supporting Role – Male", "Road to Perdition", "Nominated", "-" ], [ "2003", "Young Artist Award", "Best Performance in a Feature Film – Leading Young Actor", "Road to Perdition", "Won", "-" ], [ "2004", "Teen Choice Awards", "Choice Breakout TV Star – Male", "7th Heaven", "Nominated", "-" ], [ "2005", "Teen Choice Awards", "Choice TV Actor: Drama", "7th Heaven", "Nominated", "-" ], [ "2005", "Young Artist Award", "Best Performance in a TV Series (Comedy or Drama) – Leading Young Actor", "7th Heaven", "Nominated", "-" ], [ "2008", "Fright Meter Awards", "Best Supporting Actor", "Solstice", "Nominated", "-" ], [ "2013", "Young Hollywood Awards", "Best Ensemble (shared with Holland Roden, Crystal Reed, Dylan O'Brien and Tyler Posey)", "Teen Wolf", "Won", "-" ], [ "2014", "Teen Choice Awards", "Choice TV: Male Scene Stealer", "Teen Wolf", "Won", "-" ], [ "2017", "Saturn Awards", "Best Guest Performance on a Television Series", "Supergirl", "Nominated", "-" ] ], "title": "", "original_id": "2d9cd413bf7d15b7e92be8a8a9a12efb" }, { "_id": "85063efb458f805b35d5378318dd7898", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Nigeria", "Representing Nigeria", "Representing Nigeria", "Representing Nigeria", "Representing Nigeria", "Representing Nigeria" ], [ "1995", "African Junior Championships", "Bouaké, Ivory Coast", "2nd", "100 m", "10.42" ], [ "1995", "African Junior Championships", "Bouaké, Ivory Coast", "2nd", "200 m", "20.98" ], [ "1996", "African Championships", "Yaoundé, Cameroon", "3rd", "100 m", "10.66" ], [ "1996", "World Junior Championships", "Sydney, Australia", "4th", "200 m", "21.11 (wind: -1.6 m/s)" ], [ "1997", "African Junior Championships", "Ibadan, Nigeria", "1st", "100 m", "10.55" ], [ "1997", "African Junior Championships", "Ibadan, Nigeria", "1st", "200 m", "21.12" ], [ "1998", "African Championships", "Dakar, Senegal", "2nd", "200 m", "20.45" ], [ "1999", "World Championships", "Seville, Spain", "49th (qf)", "200 m", "21.12" ], [ "1999", "All-Africa Games", "Johannesburg, South Africa", "5th", "200 m", "20.75" ], [ "2000", "Olympic Games", "Sydney, Australia", "14th (sf)", "100 m", "10.45" ], [ "2000", "Olympic Games", "Sydney, Australia", "8th (h)", "4 × 100 m relay", "38.97" ], [ "2001", "World Indoor Championships", "Edmonton, Canada", "52nd (h)", "60 m", "7.18" ], [ "2001", "World Championships", "Edmonton, Canada", "10th (h)", "4 × 100 m relay", "39.10" ], [ "2002", "Commonwealth Games", "Manchester, United Kingdom", "6th", "4 × 100 m relay", "39.01" ], [ "2002", "African Championships", "Radès, Tunisia", "1st", "4 × 100 m relay", "39.76" ] ], "title": "", "original_id": "51dbc10938c42844de86defc6426167b" }, { "_id": "2e9dab5b7209a221bcdb5e39772ffe45", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing New Caledonia", "Representing New Caledonia", "Representing New Caledonia", "Representing New Caledonia", "Representing New Caledonia", "Representing New Caledonia" ], [ "1966", "South Pacific Games", "Nouméa, New Caledonia", "1st", "Shot put", "15.82 m" ], [ "1966", "South Pacific Games", "Nouméa, New Caledonia", "2nd", "Discus throw", "44.68 m" ], [ "1969", "South Pacific Games", "Port Moresby, Papua New Guinea", "1st", "Shot put", "17.89 m" ], [ "1969", "South Pacific Games", "Port Moresby, Papua New Guinea", "1st", "Discus throw", "50.22 m" ], [ "1969", "South Pacific Games", "Port Moresby, Papua New Guinea", "3rd", "Hammer throw", "41.84 m" ], [ "1971", "South Pacific Games", "Pirae, French Polynesia", "1st", "Shot put", "18.07 m" ], [ "1971", "South Pacific Games", "Pirae, French Polynesia", "1st", "Discus throw", "49.98 m" ], [ "1971", "South Pacific Games", "Pirae, French Polynesia", "3rd", "Hammer throw", "44.00 m" ], [ "1975", "South Pacific Games", "Tumon, Guam", "1st", "Shot put", "18.07 m" ], [ "1975", "South Pacific Games", "Tumon, Guam", "1st", "Discus throw", "48.30 m" ], [ "1975", "South Pacific Games", "Tumon, Guam", "2nd", "Hammer throw", "43.66 m" ], [ "1983", "South Pacific Games", "Apia, Western Samoa", "1st", "Shot put", "16.97 m" ], [ "1983", "South Pacific Games", "Apia, Western Samoa", "2nd", "Discus throw", "48.70 m" ] ], "title": "", "original_id": "75161f5694422778f9358fe477854946" }, { "_id": "dfa77ca619170d63e349514b73908e41", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "1992", "CARIFTA Games (U20)", "Nassau, Bahamas", "1st", "Discus throw", "37.86 m" ], [ "1992", "CARIFTA Games (U20)", "Nassau, Bahamas", "3rd", "Javelin throw", "36.37 m" ], [ "1999", "Central American and Caribbean Championships", "Bridgetown, Barbados", "2nd", "Javelin throw", "54.24 m" ], [ "2000", "Olympic Games", "Sydney, Australia", "21st (q)", "Javelin throw", "56.36 m" ], [ "2005", "Central American and Caribbean Championships", "Nassau, Bahamas", "2nd", "Javelin throw", "61.10 m" ], [ "2005", "World Championships", "Helsinki, Finland", "14th (q)", "Javelin throw", "58.49 m" ], [ "2006", "Commonwealth Games", "Melbourne, Australia", "3rd", "Javelin throw", "58.27 m" ], [ "2006", "Central American and Caribbean Games", "Cartagena, Colombia", "4th", "Javelin throw", "56.82 m" ], [ "2008", "Olympic Games", "Beijing, China", "34th (q)", "Javelin throw", "55.51 m" ], [ "2011", "Pan American Games", "Guadalajara, Mexico", "7th", "Javelin throw", "51.40 m" ] ], "title": "", "original_id": "7b6040473988da74ffaf42edf90be4a9" }, { "_id": "c3b84eb88426289e4ca4484812ce32b5", "header": [ "Outcome", "No.", "Year", "Championship", "Opponent in the final", "Score" ], "rows": [ [ "Winner", "1.0", "1987", "Grand Prix", "Dennis Taylor", "10–7" ], [ "Winner", "2.0", "1988", "British Open", "Mike Hallett", "13–2" ], [ "Runner-up", "1.0", "1988", "UK Championship", "Doug Mountjoy", "12–16" ], [ "Winner", "3.0", "1989", "Asian Open", "James Wattana", "9–2" ], [ "Winner", "4.0", "1989", "Dubai Classic", "Doug Mountjoy", "9–2" ], [ "Winner", "5.0", "1989", "UK Championship", "Steve Davis", "16–12" ], [ "Runner-up", "2.0", "1989", "International Open", "Steve Davis", "4–9" ], [ "Runner-up", "3.0", "1990", "European Open", "John Parrott", "6–10" ], [ "Winner", "6.0", "1990", "World Snooker Championship", "Jimmy White", "18–12" ], [ "Winner", "7.0", "1990", "Grand Prix (2)", "Nigel Bond", "10–5" ], [ "Winner", "8.0", "1990", "Asian Open (2)", "Dennis Taylor", "9–3" ], [ "Winner", "9.0", "1990", "Dubai Classic (2)", "Steve Davis", "9–1" ], [ "Winner", "10.0", "1990", "UK Championship (2)", "Steve Davis", "16–15" ], [ "Runner-up", "4.0", "1991", "Classic", "Jimmy White", "4–10" ], [ "Winner", "11.0", "1991", "British Open (2)", "Gary Wilkinson", "10–9" ], [ "Winner", "12.0", "1991", "Grand Prix (3)", "Steve Davis", "10–6" ], [ "Winner", "13.0", "1992", "Welsh Open", "Darren Morgan", "9–3" ], [ "Runner-up", "5.0", "1992", "Classic (2)", "Steve Davis", "8–9" ], [ "Winner", "14.0", "1992", "World Snooker Championship (2)", "Jimmy White", "18–14" ], [ "Runner-up", "6.0", "1992", "Dubai Classic", "John Parrott", "8–9" ], [ "Runner-up", "7.0", "1993", "European Open (2)", "Steve Davis", "4–10" ], [ "Winner", "15.0", "1993", "International Open", "Steve Davis", "10–6" ], [ "Winner", "16.0", "1993", "World Snooker Championship (3)", "Jimmy White", "18–5" ], [ "Winner", "17.0", "1993", "Dubai Classic (3)", "Steve Davis", "9–3" ], [ "Runner-up", "8.0", "1993", "UK Championship (2)", "Ronnie O'Sullivan", "6–10" ], [ "Winner", "18.0", "1993", "European Open", "Ronnie O'Sullivan", "9–5" ], [ "Winner", "19.0", "1994", "World Snooker Championship (4)", "Jimmy White", "18–17" ], [ "Winner", "20.0", "1994", "UK Championship (3)", "Ken Doherty", "10–5" ], [ "Winner", "21.0", "1994", "European Open (2)", "John Parrott", "9–3" ], [ "Winner", "22.0", "1995", "World Snooker Championship (5)", "Nigel Bond", "18–9" ], [ "Winner", "23.0", "1995", "Grand Prix (4)", "John Higgins", "9–5" ], [ "Winner", "24.0", "1995", "UK Championship (4)", "Peter Ebdon", "10–3" ], [ "Winner", "25.0", "1996", "World Snooker Championship (6)", "Peter Ebdon", "18–12" ], [ "Winner", "26.0", "1996", "UK Championship (5)", "John Higgins", "10–9" ], [ "Winner", "27.0", "1997", "Welsh Open (2)", "Mark King", "9–2" ], [ "Winner", "28.0", "1997", "International Open (2)", "Tony Drago", "9–1" ], [ "Runner-up", "9.0", "1997", "British Open", "Mark Williams", "2–9" ], [ "Runner-up", "10.0", "1997", "World Snooker Championship", "Ken Doherty", "12–18" ], [ "Runner-up", "11.0", "1997", "UK Championship (3)", "Ronnie O'Sullivan", "6–10" ], [ "Winner", "29.0", "1998", "Thailand Masters (3)", "John Parrott", "9–6" ], [ "Runner-up", "12.0", "1998", "British Open (2)", "John Higgins", "8–9" ], [ "Runner-up", "13.0", "1999", "Welsh Open", "Mark Williams", "8–9" ], [ "Winner", "30.0", "1999", "Scottish Open (3)", "Graeme Dott", "9–1" ], [ "Winner", "31.0", "1999", "World Snooker Championship (7)", "Mark Williams", "18–11" ], [ "Winner", "32.0", "1999", "British Open (3)", "Peter Ebdon", "9–1" ], [ "Runner-up", "14.0", "2000", "Thailand Masters", "Mark Williams", "5–9" ], [ "Runner-up", "15.0", "2001", "Thailand Masters (2)", "Ken Doherty", "3–9" ], [ "Winner", "33.0", "2001", "European Open (3)", "Joe Perry", "9–2" ], [ "Runner-up", "16.0", "2002", "World Snooker Championship (2)", "Peter Ebdon", "17–18" ], [ "Winner", "34.0", "2003", "Welsh Open (3)", "Mark Williams", "9–5" ], [ "Runner-up", "17.0", "2003", "European Open (3)", "Ronnie O'Sullivan", "6–9" ], [ "Winner", "35.0", "2003", "British Open (4)", "Ronnie O'Sullivan", "9–6" ], [ "Runner-up", "18.0", "2003", "UK Championship (4)", "Matthew Stevens", "8–10" ], [ "Runner-up", "19.0", "2005", "Welsh Open (2)", "Ronnie O'Sullivan", "8–9" ], [ "Winner", "36.0", "2005", "Malta Cup (4)", "Graeme Dott", "9–7" ], [ "Runner-up", "20.0", "2005", "China Open", "Ding Junhui", "5–9" ], [ "Runner-up", "21.0", "2006", "UK Championship (5)", "Peter Ebdon", "6–10" ] ], "title": "", "original_id": "0c5e7d0d8e33e31f3e80aab314ef8c61" }, { "_id": "b90d230c45fbd1559b626a6265acc7ad", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Brazil", "Representing Brazil", "Representing Brazil", "Representing Brazil", "Representing Brazil", "Representing Brazil" ], [ "2007", "South American Junior Championships", "São Paulo, Brazil", "1st", "Long jump", "5.79 m" ], [ "2007", "World Youth Championships", "Ostrava, Czech Republic", "21st", "Heptathlon", "4575 pts" ], [ "2008", "World Junior Championships", "Bydgoszcz, Poland", "16th", "Heptathlon", "5233 pts" ], [ "2008", "South American U23 Championships", "Lima, Peru", "1st", "Heptathlon", "5138 pts" ], [ "2009", "South American Junior Championships", "São Paulo, Brazil", "4th", "100 m", "11.95 s" ], [ "2009", "South American Junior Championships", "São Paulo, Brazil", "1st", "4 × 100 m", "45.86 s" ], [ "2009", "South American Junior Championships", "São Paulo, Brazil", "1st", "Heptathlon", "5574 pts" ], [ "2009", "Pan American Junior Championships", "Port of Spain, Trinidad and Tobago", "1st", "Heptathlon", "5574 pts" ], [ "2009", "South American Championships", "Lima, Peru", "1st", "Heptathlon", "5578 pts" ], [ "2010", "South American Games / South American U23 Championships", "Medellín, Colombia", "–", "Heptathlon", "DNF" ], [ "2010", "Ibero-American Championships", "San Fernando, Spain", "4th", "Heptathlon", "5304 pts" ], [ "2011", "South American Championships", "Buenos Aires, Argentina", "1st", "Heptathlon", "5428 pts" ], [ "2012", "South American U23 Championships", "São Paulo, Brazil", "1st", "Heptathlon", "5899 pts" ], [ "2014", "Ibero-American Championships", "São Paulo, Brazil", "1st", "Heptathlon", "5722 pts" ], [ "2015", "Pan American Games", "Toronto, Canada", "3rd", "Heptathlon", "6035 pts" ], [ "2015", "World Championships", "Beijing, China", "26th", "Heptathlon", "5647 pts" ], [ "2016", "Olympic Games", "Rio de Janeiro, Brazil", "23rd", "Heptathlon", "6024 pts" ], [ "2017", "World Championships", "London, United Kingdom", "29th", "Heptathlon", "4500 pts" ], [ "2017", "Universiade", "Taipei, Taiwan", "5th", "Heptathlon", "5337 pts" ] ], "title": "", "original_id": "d462f4647ce89a206cfe3e7ecba1b28c" }, { "_id": "39079dab85112235252894687745c901", "header": [ "year", "senior pga championship", "the tradition", "senior players championship", "us senior open", "senior british open" ], "rows": [ [ "2013", "kōki idoki", "david frost", "kenny perry (1 / 2)", "kenny perry (2 / 2)", "mark wiebe" ], [ "2012", "roger chapman (1 / 2)", "tom lehman (3 / 3)", "joe daley", "roger chapman (2 / 2)", "fred couples (2 / 2)" ], [ "2011", "tom watson (6 / 6)", "tom lehman (2 / 3)", "fred couples (1 / 2)", "olin browne", "russ cochran" ], [ "2010", "tom lehman (1 / 3)", "fred funk (3 / 3)", "mark o'meara", "bernhard langer (2 / 2)", "bernhard langer (1 / 2)" ], [ "2009", "michael allen", "mike reid (2 / 2)", "jay haas (3 / 3)", "fred funk (2 / 3)", "loren roberts (4 / 4)" ], [ "2008", "jay haas (2 / 3)", "fred funk (1 / 3)", "d a weibring", "eduardo romero (2 / 2)", "bruce vaughan" ], [ "2007", "denis watson", "mark mcnulty", "loren roberts (3 / 4)", "brad bryant", "tom watson (5 / 6)" ], [ "2006", "jay haas (1 / 3)", "eduardo romero (1 / 2)", "bobby wadkins", "allen doyle (4 / 4)", "loren roberts (2 / 4)" ], [ "2005", "mike reid (1 / 2)", "loren roberts (1 / 4)", "peter jacobsen (2 / 2)", "allen doyle (3 / 4)", "tom watson (4 / 6)" ], [ "2004", "hale irwin (7 / 7)", "craig stadler (2 / 2)", "mark james", "peter jacobsen (1 / 2)", "pete oakley" ], [ "2003", "john jacobs", "tom watson (3 / 6)", "craig stadler (1 / 2)", "bruce lietzke", "tom watson (2 / 6)" ], [ "2002", "fuzzy zoeller", "jim thorpe", "stewart ginn", "don pooley", "not a champions tour event" ], [ "2001", "tom watson (1 / 6)", "doug tewell (2 / 2)", "allen doyle (2 / 4)", "bruce fleisher", "not a champions tour event" ], [ "2000", "doug tewell (1 / 2)", "tom kite", "raymond floyd (4 / 4)", "hale irwin (6 / 7)", "not a champions tour event" ], [ "1999", "allen doyle (1 / 4)", "graham marsh (2 / 2)", "hale irwin (5 / 7)", "dave eichelberger", "not a champions tour event" ], [ "1998", "hale irwin (3 / 7)", "gil morgan (2 / 3)", "gil morgan (3 / 3)", "hale irwin (4 / 7)", "not a champions tour event" ], [ "1997", "hale irwin (2 / 7)", "gil morgan (1 / 3)", "larry gilbert", "graham marsh (1 / 2)", "not a champions tour event" ], [ "1996", "hale irwin (1 / 7)", "jack nicklaus (8 / 8)", "raymond floyd (3 / 4)", "dave stockton (3 / 3)", "not a champions tour event" ], [ "1995", "raymond floyd (2 / 4)", "jack nicklaus (7 / 8)", "j c snead", "tom weiskopf", "not a champions tour event" ], [ "1994", "lee trevino (4 / 4)", "raymond floyd (1 / 4)", "dave stockton (2 / 3)", "simon hobday", "not a champions tour event" ], [ "1993", "tom wargo", "tom shaw", "jack nicklaus (6 / 8)", "jim colbert", "not a champions tour event" ], [ "1992", "lee trevino (2 / 4)", "lee trevino (3 / 4)", "dave stockton (1 / 3)", "larry laoretti", "not a champions tour event" ], [ "1991", "jack nicklaus (3 / 8)", "jack nicklaus (5 / 8)", "jim albus", "jack nicklaus (4 / 8)", "not a champions tour event" ], [ "1990", "gary player (6 / 6)", "jack nicklaus (1 / 8)", "jack nicklaus (2 / 8)", "lee trevino (1 / 4)", "not a champions tour event" ], [ "1989", "larry mowry", "don bies", "orville moody (2 / 2)", "orville moody (1 / 2)", "not a champions tour event" ], [ "1988", "gary player (4 / 6)", "founded in 1989", "billy casper (2 / 2)", "gary player (5 / 6)", "not a champions tour event" ], [ "1987", "chi chi rodriguez (2 / 2)", "founded in 1989", "gary player (3 / 6)", "gary player (2 / 6)", "not a champions tour event" ], [ "1986", "gary player (1 / 6)", "founded in 1989", "chi chi rodriguez (1 / 2)", "dale douglass", "founded in 1987" ], [ "1985", "not held", "founded in 1989", "arnold palmer (5 / 5)", "miller barber (5 / 5)", "founded in 1987" ], [ "1984", "dec peter thomson", "founded in 1989", "arnold palmer (4 / 5)", "miller barber (4 / 5)", "founded in 1987" ], [ "1984", "jan arnold palmer (3 / 5)", "founded in 1989", "arnold palmer (4 / 5)", "miller barber (4 / 5)", "founded in 1987" ], [ "1983", "not held", "founded in 1989", "miller barber (3 / 5)", "billy casper (1 / 2)", "founded in 1987" ], [ "1982", "don january", "founded in 1989", "founded in 1983", "miller barber (2 / 5)", "founded in 1987" ], [ "1981", "miller barber (1 / 5)", "founded in 1989", "founded in 1983", "arnold palmer (2 / 5)", "founded in 1987" ], [ "1980", "arnold palmer (1 / 5)", "founded in 1989", "founded in 1983", "roberto devicenzo", "founded in 1987" ] ], "title": "", "original_id": "7b4144d4fe9ab8f84ad391281875782a" }, { "_id": "b833022d4bfd275938e1f187a27dc54e", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing India", "Representing India", "Representing India", "Representing India", "Representing India", "Representing India" ], [ "Outdoor Competition", "Outdoor Competition", "Outdoor Competition", "Outdoor Competition", "Outdoor Competition", "Outdoor Competition" ], [ "2013", "World Youth Championships in Athletics", "Donetsk, Ukraine", "6th", "100 m", "11.71 sec" ], [ "2013", "Asian Athletics Championships", "Pune, India", "-", "200 m", "23.811 sec" ], [ "2014", "Asian Junior Athletics Championships", "Taipei, Taiwan", "-", "200 m", "23.74 sec" ], [ "2014", "Asian Junior Athletics Championships", "Taipei, Taiwan", "-", "4×400 m relay", "3.40.53 min" ], [ "2016", "XXVI G Kosanov Memorial", "Almaty, Kazakhstan", "NR", "100 m", "11.24 sec" ], [ "2016", "Rio Olympics(Heat 5)", "Jakarta, Indonesia", "H5–7th", "100 m", "11.69 sec" ], [ "2017", "Asian Athletics Championships", "Bhubaneswar, India", "-", "100 m", "11.52 sec" ], [ "2017", "Asian Athletics Championships", "Bhubaneswar, India", "-", "4×100 m relay", "44.57 sec" ], [ "2017", "World Championships in Athletics (Heat)", "London, UK", "H5–5th", "100 m", "12.07 sec" ], [ "2018", "Asian Games", "Jakarta, Indonesia", "-", "100 m", "11.32 s" ], [ "2018", "Asian Games", "Jakarta, Indonesia", "SF1–1st PB", "200 m", "23.00 s" ], [ "2018", "Asian Games", "Jakarta, Indonesia", "-", "200 m", "23.20 s" ], [ "2019", "Asian Athletics Championships", "Doha, Qatar", "H4−1st NR", "100 m", "11.28 sec" ], [ "2019", "Asian Athletics Championships", "Doha, Qatar", "SF NR", "100 m", "11.26 sec" ], [ "2019", "Asian Athletics Championships", "Doha, Qatar", "FL−5th", "100 m", "11.44 sec" ], [ "2019", "Asian Athletics Championships", "Doha, Qatar", "-", "200 m", "23.24 sec" ], [ "Indoor Competition", "Indoor Competition", "Indoor Competition", "Indoor Competition", "Indoor Competition", "Indoor Competition" ], [ "2016", "Asian Indoor Athletics Championships", "Doha, Qatar", "H−1st NR", "60 m", "7.28 s" ], [ "2016", "Asian Indoor Athletics Championships", "Doha, Qatar", "-", "60 m", "7.37 s" ], [ "2016", "IAAF World Indoor Championships", "Portland, USA", "H5–5th", "60 m", "7.30 s" ], [ "2016", "IAAF World Indoor Championships", "Portland, USA", "SF3–8th", "60 m", "7.62 s" ] ], "title": "", "original_id": "cf0df05f56fcaf06eb9a85d57a062ff9" }, { "_id": "300d041d806051c8c53d5d251da99d8b", "header": [ "Year", "Title", "Language", "Director", "Cast", "Cast", "Cast" ], "rows": [ [ "Year", "Title", "Language", "Director", "Step-mother", "Son", "Wife" ], [ "1955", "Ardhangi", "Telugu", "P. Pullaiah", "Santha Kumari", "Akkineni Nageswara Rao", "Savitri" ], [ "1956", "Pennin Perumai", "Tamil", "P. Pullaiah", "Santha Kumari", "Gemini Ganesan", "Savitri" ], [ "1963", "Bahurani", "Hindi", "T. Prakash Rao", "Lalita Pawar", "Guru Dutt", "Mala Sinha" ], [ "1969", "Mallammana Pavaada", "Kannada", "Puttanna Kanagal", "Advani Lakshmi Devi", "Rajkumar", "B Sarojadevi" ], [ "1975", "Swayamsiddha", "Bengali", "Sushil Mukherjee", "-", "Ranjit Mallick", "Mithu Mukherjee" ], [ "1981", "Jyothi", "Hindi", "Pramod Chakravorty", "Shashikala", "Jeetendra", "Hema Malini" ], [ "1987", "Enga Chinna Rasa", "Tamil", "K. Bhagyaraj", "C. R. Saraswathy", "K. Bhagyaraj", "Radha" ], [ "1992", "Beta", "Hindi", "Indra Kumar", "Aruna Irani", "Anil Kapoor", "Madhuri Dixit" ], [ "1993", "Abbaigaru", "Telugu", "E. V. V. Satyanarayana", "Jayachitra", "Venkatesh", "Meena" ], [ "1993", "Annayya", "Kannada", "D. Rajendra Babu", "Aruna Irani", "V. Ravichandran", "Madhoo" ], [ "1998", "Santan", "Oriya", "-", "Snigdha Mohanty", "Siddhanta Mahapatra", "Rachana Banerjee" ] ], "title": "", "original_id": "b72cc43e9103fe48e3fff8a01511e6f1" }, { "_id": "20d4a0c9c41a21a7c07b49e221714ae2", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Australia", "Representing Australia", "Representing Australia", "Representing Australia", "Representing Australia", "Representing Australia" ], [ "2010", "Oceania Youth Championships", "Sydney, Australia", "3rd", "100 m", "12.15 s (+0.5 m/s)" ], [ "2010", "Oceania Youth Championships", "Sydney, Australia", "1st", "100 m hurdles", "14.12 s (−1.4 m/s)" ], [ "2010", "Oceania Youth Championships", "Sydney, Australia", "1st", "4 × 100 m relay", "45.75 s" ], [ "2010", "Youth Olympic Games", "Singapore", "2nd", "100 m hurdles", "13.46" ], [ "2012", "World Junior Championships", "Barcelona, Spain", "5th", "100 m hurdles", "13.54" ], [ "2014", "Commonwealth Games", "Glasgow, United Kingdom", "5th", "100 m hurdles", "13.36" ], [ "2015", "Universiade", "Gwangju, South Korea", "3rd", "100 m hurdles", "12.94" ], [ "2015", "World Championships", "Beijing, China", "18th (sf)", "100 m hurdles", "13.01" ], [ "2016", "World Indoor Championships", "Portland, United States", "10th (h)", "60 m hurdles", "8.10" ], [ "2016", "Olympic Games", "Rio de Janeiro, Brazil", "37th (h)", "100 m hurdles", "13.26" ], [ "2017", "World Championships", "London, United Kingdom", "21st (sf)", "100 m hurdles", "13.25" ], [ "2017", "Universiade", "Taipei, Taiwan", "8th", "100 m hurdles", "14.82" ], [ "2018", "World Indoor Championships", "Birmingham, United Kingdom", "22nd (sf)", "60 m hurdles", "8.22" ], [ "2018", "Commonwealth Games", "Gold Coast, Australia", "4th", "100 m hurdles", "13.07" ] ], "title": "", "original_id": "0fb4f4180841f757ff71e13664a49e94" }, { "_id": "2d25376fc3a500d6a9a7f9de805c8369", "header": [ "Title", "Year", "Album", "Composer", "Other artist(s)", "Notes", "Ref." ], "rows": [ [ "\"Bombay City Sukkha Rotti\"", "1994", "Rasigan", "Deva", "K. S. Chithra", "-", "-" ], [ "\"Oru Kaditham\"", "1995", "Deva", "Deva", "S. P. Balasubrahmanyam", "-", "-" ], [ "\"Aiyaiyoo Alamelu\"", "1995", "Deva", "Deva", "Swarnalatha, Manorama", "-", "-" ], [ "\"Kottagiri Kuppamma\"", "1995", "Deva", "Deva", "Swarnalatha, Manorama", "-", "-" ], [ "\"Thottabettaa Rottu Melae\"", "1995", "Vishnu", "Deva", "Shoba Chandrasekhar", "-", "-" ], [ "\"Bombay Party Shilpa Shetty\"", "1996", "Coimbatore Mappillai", "Vidyasagar", "Shahul Hameed", "-", "-" ], [ "\"Thiruppathy Ponaa Mottai\"", "1996", "Maanbumigu Maanavan", "Deva", "-", "-", "-" ], [ "\"Chicken Kari\"", "1996", "Selva", "Sirpy", "Sirpy, Swarnalatha", "-", "-" ], [ "\"Anjaam Number Bussil Yeri\"", "1997", "Kaalamellam Kaathiruppen", "Deva", "-", "-", "-" ], [ "\"Oormilaa Oormilaa\"", "1997", "Once More", "Deva", "Shoba Chandrasekhar", "-", "-" ], [ "\"Oh Baby Baby\"", "1997", "Kadhalukku Mariyadhai", "Ilayaraja", "Bhavatharini", "-", "-" ], [ "\"Tic-Tic-Tic\"", "1998", "Thulli Thirintha Kaalam", "Jayanth", "Unnikrishnan, Sujatha Mohan", "-", "-" ], [ "\"Mowriya Mowriya\"", "1998", "Priyamudan", "Deva", "Anuradha Sriram", "-", "-" ], [ "\"Kaalathuketha Oru Gana\"", "1998", "Velai", "Yuvan Shankar Raja", "Nassar, Premji Amaren", "-", "-" ], [ "\"Nilave Nilave\"", "1998", "Nilaave Vaa", "Vidyasagar", "Anuradha Sriram", "-", "-" ], [ "\"Chandira Mandalathai\"", "1998", "Nilaave Vaa", "Vidyasagar", "Harini, S. P. B. Charan", "-", "-" ], [ "\"Thammadikkira Styla Pathu\"", "1999", "Periyanna", "S. Bharani", "-", "-", "-" ], [ "\"Juddadi Laila\"", "1999", "Periyanna", "S. Bharani", "Swarnalatha", "-", "-" ], [ "\"Roadula Oru\"", "1999", "Periyanna", "S. Bharani", "-", "-", "-" ], [ "\"Thanganirathuku\"", "1999", "Nenjinile", "Deva", "Swarnalatha", "-", "-" ], [ "\"Mississippi Nadhi Kulunga\"", "2000", "Priyamanavale", "S. A. Rajkumar", "Anuradha Sriram", "-", "-" ], [ "\"Ennoda Laila\"", "2001", "Badri", "Ramana Gogula", "-", "-", "-" ], [ "\"Ullathai Killadhae\"", "2002", "Thamizhan", "D. Imman", "Priyanka Chopra", "-", "-" ], [ "\"Coca-Cola (Podango)\"", "2002", "Bagavathi", "Srikanth Deva", "Vadivelu", "-", "-" ], [ "\"Vaadi Vaadi CD\"", "2005", "Sachein", "Devi Sri Prasad", "Vadivelu", "-", "-" ], [ "\"Google Google\"", "2012", "Thuppakki", "Harris Jayaraj", "Andrea Jeremiah", "Vijay Award for Favourite Song Nominated—SIIMA Award for Best Male Playback Singer", "-" ], [ "\"Vanganna Vanakkanganna\"", "2013", "Thalaiva", "G.V. Prakash Kumar", "Santhanam", "-", "-" ], [ "\"Kandangi Kandangi\"", "2014", "Jilla", "D. Imman", "Shreya Ghoshal", "-", "-" ], [ "\"Selfie Pulla\"", "2014", "Kaththi", "Anirudh Ravichander", "Sunidhi Chauhan", "Nominated—Vijay Award for Favourite Song Nominated—Filmfare Award for Best Male Playback Singer – Tamil", "-" ], [ "\"Yaendi Yaendi\"", "2015", "Puli", "Devi Sri Prasad", "Shruti Haasan", "Nominated—Filmfare Award for Best Male Playback Singer – Tamil", "-" ], [ "\"Chella Kutti\"", "2016", "Theri", "G.V. Prakash Kumar", "Neeti Mohan", "-", "-" ], [ "\"Papa Papa\"", "2017", "Bairavaa", "Santhosh Narayanan", "Priyadarshini", "-", "-" ] ], "title": "", "original_id": "49910cb2c99744cb8fa61b9aa25b36ff" }, { "_id": "da66b9933baed80f04df21c0e2c92c1c", "header": [ "Year", "Competition", "Venue", "Position", "Event", "Notes" ], "rows": [ [ "Representing Grenada", "Representing Grenada", "Representing Grenada", "Representing Grenada", "Representing Grenada", "Representing Grenada" ], [ "2007", "CARIFTA Games (U-17)", "Providenciales, Turks and Caicos Islands", "6th", "200 m", "22.10 (+1.2 m/s)" ], [ "2007", "CARIFTA Games (U-17)", "Providenciales, Turks and Caicos Islands", "1st", "400 m", "47.86 PB" ], [ "2007", "World Youth Championships", "Ostrava, Czech Republic", "2nd", "400 m", "46.96 PB" ], [ "2008", "CARIFTA Games (U-17)", "Basseterre, Saint Kitts and Nevis", "1st", "200 m", "21.38 (+2.0 m/s)" ], [ "2008", "CARIFTA Games (U-17)", "Basseterre, Saint Kitts and Nevis", "1st", "400 m", "47.87" ], [ "2008", "World Junior Championships", "Bydgoszcz, Poland", "2nd", "400 m", "45.70 PB" ], [ "2008", "Commonwealth Youth Games", "Pune, India", "1st", "400 m", "46.66 GR" ], [ "2009", "CARIFTA Games (U-20)", "Vieux Fort, Saint Lucia", "DQ (h1)", "200 m", "False start" ], [ "2009", "CARIFTA Games (U-20)", "Vieux Fort, Saint Lucia", "1st", "400 m", "45.45 PB GR" ], [ "2009", "CARIFTA Games (U-20)", "Vieux Fort, Saint Lucia", "DQ (h1)", "4 × 100 m relay", "Out of zone" ], [ "2009", "CARIFTA Games (U-20)", "Vieux Fort, Saint Lucia", "3rd", "4 × 400 m relay", "3:11.93 PB" ], [ "2009", "World Youth Championships", "Brixen, Italy", "1st", "200 m", "21.05 (−0.9 m/s) PB" ], [ "2009", "World Youth Championships", "Brixen, Italy", "1st", "400 m", "45.24 PB CR" ], [ "2009", "Pan American Junior Championships", "Port of Spain, Trinidad and Tobago", "1st", "400 m", "45.43" ], [ "2009", "Pan American Junior Championships", "Port of Spain, Trinidad and Tobago", "5th", "4 × 400 m relay", "3:11.91 PB" ], [ "2010", "CARIFTA Games (U-20)", "George Town, Cayman Islands", "1st", "200 m", "20.76 (+0.8 m/s) SB" ], [ "2010", "CARIFTA Games (U-20)", "George Town, Cayman Islands", "1st", "400 m", "45.02 PB GR" ], [ "2010", "World Junior Championships", "Moncton, Canada", "1st", "400 m", "45.89" ], [ "2011", "CAC Championships", "Mayagüez, Puerto Rico", "5th", "4 × 400 m relay", "3:04.27 NR PB" ], [ "2011", "Pan American Junior Championships", "Miramar, Florida", "1st", "200 m", "20.53 w (+2.2 m/s)" ], [ "2011", "World Championships", "Daegu, South Korea", "1st", "400 m", "44.60 PB" ], [ "2012", "World Indoor Championships", "Istanbul, Turkey", "6th", "400 m", "46.21" ], [ "2012", "Olympic Games", "London, England", "1st", "400 m", "43.94 WL NR PB" ], [ "2013", "World Championships", "Moscow, Russia", "7th", "400 m", "44.99" ], [ "2014", "Commonwealth Games", "Glasgow, Scotland", "1st", "400 m", "44.24 GR" ], [ "2015", "World Championships", "Beijing, China", "3rd", "400 m", "43.78 SB" ], [ "2016", "Olympic Games", "Rio de Janeiro, Brazil", "2nd", "400 m", "43.76 SB" ] ], "title": "", "original_id": "8b247fcb51d1c607ea0ba29eecad1bd2" }, { "_id": "f645cb1a1a9e7d6d6a3efec76350fe0a", "header": [ "state", "1990 - 95", "1996 - 00", "2001 - 05", "2006 - 10" ], "rows": [ [ "bihar", "0.41", "0.3", "0.43", "0.88" ], [ "gujarat", "0.48", "0.57", "0.64", "0.69" ], [ "andhra pradesh", "0.53", "0.73", "0.55", "0.61" ], [ "punjab", "0.32", "0.46", "0.46", "0.6" ], [ "jammu & kashmir", "0.13", "0.32", "0.17", "0.4" ], [ "haryana", "0.33", "0.6", "0.31", "0.37" ], [ "himachal pradesh", "0.26", "0.14", "0.23", "0.35" ], [ "tamil nadu", "0.19", "0.2", "0.24", "0.29" ], [ "madhya pradesh", "0.23", "0.22", "0.31", "0.29" ], [ "karnataka", "0.24", "0.19", "0.2", "0.29" ], [ "rajasthan", "0.27", "0.23", "0.26", "0.27" ], [ "kerala", "0.16", "0.2", "0.22", "0.27" ], [ "maharashtra", "0.45", "0.29", "0.27", "0.26" ], [ "uttar pradesh", "0.11", "0.11", "0.16", "0.21" ], [ "orissa", "0.22", "0.16", "0.15", "0.19" ], [ "assam", "0.21", "0.02", "0.14", "0.17" ], [ "west bengal", "0.11", "0.08", "0.03", "0.01" ] ], "title": "", "original_id": "577472b9c44b101799d923f48cd30454" }, { "_id": "1569be37dd420682d5112410eac724b9", "header": [ "engine type", "scenario", "sfc in lb / (lbf h)", "sfc in g / (kn s)", "specific impulse (s)", "effective exhaust velocity (m / s)" ], "rows": [ [ "nk - 33 rocket engine", "vacuum", "10.9", "309.0", "331", "3240" ], [ "ssme rocket engine", "space shuttle vacuum", "7.95", "225.0", "453", "4423" ], [ "ramjet", "mach 1", "4.5", "127.0", "800", "7877" ], [ "j - 58 turbojet", "sr - 71 at mach 3.2 (wet)", "1.9", "53.8", "1900", "18587" ], [ "rolls - royce / snecma olympus 593", "concorde mach 2 cruise (dry)", "1.195", "33.8", "3012", "29553" ], [ "cf6 - 80c2b1f turbofan", "boeing 747 - 400 cruise", "0.605", "17.1", "5950", "58400" ], [ "general electric cf6 turbofan", "sea level", "0.307", "8.696", "11700", "115000" ] ], "title": "", "original_id": "b60f42005fcd5f0e80b5e791178df802" }, { "_id": "1377b9ce354eee5cc5b61d84c7c0715f", "header": [ "city / municipality", "no of barangays", "area (km square)", "population (2010 census)", "pop density (per km square)" ], "rows": [ [ "angono", "10", "26.22", "102407", "3905.68" ], [ "antipolo", "16", "306.1", "677741", "2214.12" ], [ "baras", "10", "84.93", "32609", "383.95" ], [ "binangonan", "40", "66.34", "249872", "3766.54" ], [ "cainta", "7", "42.99", "311845", "7253.9" ], [ "cardona", "18", "28.56", "47414", "1660.15" ], [ "jalajala", "11", "44.12", "30074", "681.64" ], [ "morong", "8", "37.58", "52194", "1388.88" ], [ "pililla", "9", "69.95", "59527", "850.99" ], [ "rodriguez", "11", "312.7", "280904", "898.32" ], [ "san mateo", "15", "55.09", "205255", "3725.81" ], [ "tanay", "19", "200.0", "98879", "494.3" ], [ "taytay", "5", "38.8", "288956", "7447.32" ] ], "title": "", "original_id": "e98478f17f738dd3bdd2ff3352d71381" }, { "_id": "97b7fff970142fea60ce9f68e3a060ef", "header": [ "language", "quillacollo municipality", "sipe sipe municipality", "tiquipaya municipality", "vinto municipality", "colcapirhua municipality" ], "rows": [ [ "quechua", "52399", "23819", "19308", "18630", "18050" ], [ "aymara", "7101", "1127", "2481", "2259", "2449" ], [ "guaranã­", "101", "24", "43", "38", "38" ], [ "another native", "82", "24", "36", "26", "46" ], [ "spanish", "93131", "23059", "32704", "26355", "38441" ], [ "foreign", "2087", "215", "1100", "403", "1136" ], [ "only native", "5756", "6544", "2972", "3332", "1365" ], [ "native and spanish", "50157", "17704", "17737", "16680", "18139" ] ], "title": "", "original_id": "5a02841251e9fe91955487687283aa3d" }, { "_id": "2ccb26694f9fe11df71f389fa274d9bf", "header": [ "rank", "country (or dependent territory)", "july 1 , 2013 projection", "% of pop", "average relative annual growth (%)", "average absolute annual growth" ], "rows": [ [ "1", "germany", "80640000.0", "15.99", "0.24", "196000" ], [ "2", "united kingdom", "64231000.0", "12.73", "0.73", "465000" ], [ "3", "france", "63820000.0", "12.65", "0.49", "309000" ], [ "4", "italy", "59789000.0", "11.85", "0.35", "206000" ], [ "5", "spain", "46958000.0", "9.31", "- 0.43", "- 205000" ], [ "6", "poland", "38548000.0", "7.64", "0.08", "29000" ], [ "7", "romania", "19858000.0", "3.94", "- 0.77", "- 155000" ], [ "8", "netherlands", "16795000.0", "3.33", "0.33", "55000" ], [ "9", "belgium", "11162000.0", "2.21", "0.66", "73000" ], [ "10", "greece", "10758000.0", "2.13", "- 0.13", "- 14000" ], [ "11", "portugal", "10609000.0", "2.1", "0.19", "20000" ], [ "12", "czech republic", "10519000.0", "2.09", "0.23", "24000" ], [ "13", "hungary", "9894000.0", "1.96", "- 0.25", "- 25000" ], [ "14", "sweden", "9595000.0", "1.9", "0.76", "72000" ], [ "15", "austria", "8477000.0", "1.68", "0.61", "51000" ], [ "16", "bulgaria", "7261000.0", "1.44", "- 0.59", "- 43000" ], [ "17", "denmark", "5612000.0", "1.11", "0.45", "25000" ], [ "18", "finland", "5436000.0", "1.08", "0.44", "24000" ], [ "19", "slovakia", "5413000.0", "1.07", "0.15", "8000" ], [ "20", "ireland", "4662000.0", "0.92", "1.35", "62000" ], [ "21", "croatia", "4258000.0", "0.84", "- 0.35", "- 15000" ], [ "22", "lithuania", "2956000.0", "0.59", "- 1.30", "- 39000" ], [ "23", "slovenia", "2062000.0", "0.41", "0.24", "5000" ], [ "24", "latvia", "2011000.0", "0.4", "- 1.23", "- 25000" ], [ "25", "estonia", "1283000.0", "0.25", "- 0.62", "- 8000" ], [ "26", "cyprus", "888000.0", "0.18", "1.95", "17000" ], [ "27", "luxembourg", "542000.0", "0.11", "1.88", "10000" ], [ "28", "malta", "419000.0", "0.08", "0.48", "2000" ], [ "align = left|total", "504456000", "100.0", "0.22", "1124000", "311" ] ], "title": "", "original_id": "3b25f146ef2692abc071056934ba47e7" }, { "_id": "d019e77d19f07e21e6aff8fd71cbf1f6", "header": [ "CCC", "IEEE Conference on Computational Complexity", "1993", "1996", "1999", "-", "2007", "2011", "2015" ], "rows": [ [ "EC", "ACM Conference on Electronic Commerce", "-", "-", "-", "2003", "2007", "2011", "2015" ], [ "ISCA", "ACM/IEEE International Symposium on Computer Architecture", "1993", "1996", "1999", "2003", "2007", "2011", "2015" ], [ "LCTES", "ACM SIGPLAN/SIGBED Conference on Languages, Compilers, and Tools for Embedded Systems", "-", "-", "1999", "2003", "2007", "-", "-" ], [ "METRICS", "ACM SIGMETRICS International Conference on Measurement and Modeling of Computer Systems", "-", "1996", "1999", "2003", "2007", "-", "2015" ], [ "PLDI", "ACM SIGPLAN Conference on Programming Language Design and Implementation", "-", "1996", "1999", "2003", "2007", "2011", "2015" ], [ "PODC", "ACM Symposium on Principles of Distributed Computing", "-", "1996", "1999", "-", "-", "2011", "-" ], [ "PPoPP", "ACM SIGPLAN Symposium on Principles and Practice of Parallel Programming", "1993", "-", "1999", "2003", "-", "-", "-" ], [ "SPAA", "ACM Symposium on Parallelism in Algorithms and Architectures", "-", "-", "-", "2003", "2007", "2011", "2015" ], [ "SoCG", "ACM Symposium on Computational Geometry", "1993", "1996", "-", "2003", "-", "-", "-" ], [ "STOC", "ACM Symposium on Theory of Computing", "1993", "1996", "1999", "2003", "2007", "2011", "2015" ] ], "title": "", "original_id": "d4f2e8dcb5e636fd8ee662f635c1f588" }, { "_id": "f842a79d03093f086636923f4abd7496", "header": [ "Party", "Votes", "%", "Seats", "+/-" ], "rows": [ [ "Liberal Democratic Party", "24,563,199", "46.9", "271", "17" ], [ "Japan Socialist Party", "11,478,742", "21.9", "118", "+28" ], [ "Japanese Communist Party", "5,496,827", "10.5", "38", "+24" ], [ "Komeitō", "4,436,755", "8.5", "29", "18" ], [ "Democratic Socialist Party", "3,660,953", "7.0", "19", "12" ], [ "Other parties", "143,019", "0.3", "2", "+2" ], [ "Independents", "2,645,582", "5.0", "14", "2" ], [ "Total", "52,425,079", "100", "491", "+5" ], [ "Source: http://www.stat.go.jp/data/chouki/27.htm", "Source: http://www.stat.go.jp/data/chouki/27.htm", "Source: http://www.stat.go.jp/data/chouki/27.htm", "Source: http://www.stat.go.jp/data/chouki/27.htm", "Source: http://www.stat.go.jp/data/chouki/27.htm" ] ], "title": "", "original_id": "6b91092d9b595b1b22ac8c1791a0f2b7" }, { "_id": "089839eb8b3560e19437ddd87dc9a379", "header": [ "season", "series", "races", "poles", "wins", "points", "final placing" ], "rows": [ [ "2003", "formula renault monza winter series", "2", "0", "0", "18", "8th" ], [ "2004", "formula renault monza", "16", "3", "5", "375", "1st" ], [ "2004", "formula junior 1600 spain", "9", "6", "4", "119", "1st" ], [ "2004", "formula renault 1600 belgium", "4", "0", "1", "65", "11th" ], [ "2005", "austrian fomula three championship", "7", "6", "3", "75", "1st" ], [ "2005", "british formula three", "5", "0", "0", "0", "nc" ], [ "2005", "formula renault 2.0 italia", "0", "0", "0", "0", "nc" ], [ "2005", "recaro formel 3 cup", "3", "1", "0", "0", "nc" ], [ "2006", "formula three euroseries", "19", "0", "0", "12", "15th" ], [ "2006", "british formula three", "2", "0", "0", "0", "nc" ], [ "2006", "masters of formula three", "1", "0", "0", "n / a", "13th" ], [ "2007", "formula renault 3.5 series", "14", "0", "0", "0", "nc" ], [ "2007", "formula three euroseries", "2", "0", "0", "0", "nc" ], [ "2008", "gp2 asia series", "8", "0", "0", "0", "23rd" ], [ "2008", "gp2 series", "13", "0", "0", "0", "30th" ], [ "2008 - 09", "gp2 asia series", "11", "0", "0", "0", "33rd" ], [ "2009", "gp2 series", "20", "0", "0", "0", "23rd" ], [ "2009", "formula renault 3.5 series", "6", "0", "0", "7", "23rd" ], [ "2009 - 10", "gp2 asia series", "8", "0", "0", "7", "13th" ], [ "2010", "gp2 series", "20", "0", "0", "12", "16th" ], [ "2011", "gp2 asia series", "4", "0", "0", "9", "8th" ], [ "2011", "gp2 series", "18", "0", "0", "1", "21st" ] ], "title": "", "original_id": "cf78a80569325500f2aa429285c98f5e" }, { "_id": "7a64b7d52163741ec4b5a25a23e525db", "header": [ "hand", "1 credit", "2 credits", "3 credits", "4 credits", "5 credits" ], "rows": [ [ "royal flush", "250", "500", "750", "1000", "4000" ], [ "straight flush", "50", "100", "150", "200", "250" ], [ "four aces w / 2 , 3 , or 4", "400", "800", "1200", "1600", "2000" ], [ "four 2 , 3 , or 4 w / a - 4", "160", "320", "480", "640", "800" ], [ "four aces", "160", "320", "480", "640", "800" ], [ "four 2 , 3 , or 4", "80", "160", "240", "320", "400" ], [ "four 5 - k", "50", "100", "150", "200", "250" ], [ "full house", "10", "20", "30", "40", "50" ], [ "flush", "6", "12", "18", "24", "30" ], [ "straight", "4", "8", "12", "16", "20" ], [ "three of a kind", "3", "6", "9", "12", "15" ], [ "two pair", "1", "2", "3", "4", "5" ], [ "jacks or better", "1", "2", "3", "4", "5" ], [ "theoretical return", "98.9%", "98.9%", "98.9%", "98.9%", "100.1%" ] ], "title": "", "original_id": "4cc489011d65d97a1a1c269bbcdd112d" }, { "_id": "87fbe0bbab0304748ac6c38db09da6d1", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1.0", "Great Britain (GBR)", "6", "3", "2", "11" ], [ "2.0", "South Africa (RSA)", "1", "2", "1", "4" ], [ "3.0", "Canada (CAN)", "1", "1", "0", "2" ], [ "4.0", "Australia (AUS)", "0", "1", "1", "2" ], [ null, "Hong Kong (HKG)", "0", "1", "1", "2" ], [ "6.0", "Israel (ISR)", "0", "0", "2", "2" ], [ "7.0", "South Korea (KOR)", "0", "0", "1", "1" ] ], "title": "", "original_id": "629103144efe26a2da56a953c77fa3f8" }, { "_id": "a8be0e66238975ab8d58104de9a653c4", "header": [ "year", "number of tropical storms", "number of hurricanes", "number of major hurricanes", "deaths", "strongest storm" ], "rows": [ [ "1860", "1", "5", "1", "60 +", "one" ], [ "1861", "2", "6", "0", "22 +", "one and three" ], [ "1862", "3", "3", "0", "3", "two and three" ], [ "1863", "4", "5", "0", "90", "one , two , three & four" ], [ "1864", "2", "3", "0", "none", "one , three & five" ], [ "1865", "4", "3", "0", "326", "four & seven" ], [ "1866", "1", "5", "1", "383", "six" ], [ "1867", "2", "6", "0", "811", "'san narciso'" ], [ "1868", "1", "3", "0", "2", "one , two & four" ] ], "title": "", "original_id": "f72902b09ecc9fc2500e114d8c7519c2" }, { "_id": "8664d46460fe1a7645117258f3f432b1", "header": [ "agent", "melting / boiling point", "effectiveness as blood agent", "persistence , open area", "persistence , enclosed area", "field stability", "storage stability", "toxicity as blood agent" ], "rows": [ [ "hydrogen cyanide", "- 13 / 26 degree", "10", "2", "9", "10", "8", "10" ], [ "cyanogen", "- 28 / - 21 degree", "9", "2", "9", "8", "7", "9" ], [ "cyanogen chloride", "- 6 / 14 degree", "8", "3", "9", "9", "9", "8" ], [ "cyanogen bromide", "52 / 62 degree", "9", "5", "8", "5", "6", "8" ], [ "arsine", "- 117 / - 62 degree", "9", "3", "8", "5", "9", "9" ], [ "vinyl arsine", "124 degree (boiling)", "7", "7", "9", "8", "9", "6" ], [ "phosgene", "- 118 / 8", "10", "6", "9", "5", "8", "6" ] ], "title": "", "original_id": "240b0d45a41eb8f3b90989092af6da7b" }, { "_id": "0457cc52b01f798e0c325a2f412ea5ed", "header": [ "district", "2010 population (000)", "2008 gdp (usd bn) a", "2008 gdp per capita (usd) a", "agri culture b", "mining b", "manufac turing b", "services & cons truction b", "exports (usd mn) 2011", "median mo salary (usd) a e", "vehicles (per 1000) d", "income poverty f", "structural poverty g" ], "rows": [ [ "city of buenos aires", "2890", "118.0", "40828", "0.3", "1.0", "12.9", "85.8", "426", "1618", "528", "7.3", "7.8" ], [ "buenos aires province", "15625", "161.0", "10303", "4.5", "0.1", "21.3", "74.1", "28134", "1364", "266", "16.2", "15.8" ], [ "catamarca", "368", "2.331", "6009", "3.6", "20.8", "12.1", "63.5", "1596", "1241", "162", "24.3", "21.5" ], [ "chaco", "1055", "2.12", "2015", "12.6", "0.0", "7.5", "79.9", "602", "1061", "137", "35.4", "33.0" ], [ "chubut", "509", "7.11", "15422", "6.9", "21.3", "10.0", "61.8", "3148", "2281", "400", "4.6", "15.5" ], [ "córdoba", "3309", "33.239", "10050", "10.6", "0.2", "14.0", "75.2", "10635", "1200", "328", "14.8", "13.0" ], [ "corrientes", "993", "4.053", "4001", "12.6", "0.0", "8.2", "79.2", "230", "1019", "168", "31.5", "28.5" ], [ "entre ríos", "1236", "7.137", "5682", "11.9", "0.3", "11.6", "76.2", "1908", "1063", "280", "13.0", "17.6" ], [ "formosa", "530", "1.555", "2879", "7.6", "1.5", "6.4", "84.5", "40", "1007", "107", "30.7", "33.6" ], [ "jujuy", "673", "2.553", "3755", "5.5", "0.7", "14.6", "79.2", "456", "1123", "153", "30.0", "28.8" ], [ "la pampa", "319", "2.0", "5987", "19.0", "3.7", "5.3", "72.0", "378", "1164", "364", "13.6", "10.3" ], [ "la rioja", "334", "1.419", "4162", "3.9", "0.1", "16.8", "79.2", "281", "1040", "172", "22.0", "20.4" ], [ "mendoza", "1739", "18.8", "10758", "5.4", "6.1", "17.5", "71.0", "1862", "1153", "313", "12.2", "15.4" ], [ "misiones", "1102", "4.044", "3751", "6.7", "0.0", "13.0", "80.3", "536", "971", "153", "32.6", "27.1" ], [ "neuquén", "551", "14.398", "26273", "0.7", "42.8", "2.9", "53.6", "353", "2211", "339", "11.2", "17.0" ], [ "río negro", "639", "4.924", "8247", "4.9", "8.4", "7.3", "79.4", "670", "1309", "285", "20.6", "17.9" ], [ "salta", "1214", "5.165", "4220", "8.1", "7.6", "10.4", "73.9", "1332", "1045", "139", "29.7", "31.6" ], [ "san juan", "681", "3.927", "5642", "8.1", "0.3", "15.9", "75.7", "2470", "1293", "216", "18.4", "17.4" ], [ "san luis", "432", "2.444", "5580", "4.9", "0.5", "42.4", "52.2", "735", "1288", "245", "22.0", "15.6" ], [ "santa cruz", "274", "6.892", "30496", "4.4", "47.1", "2.3", "46.2", "1857", "2646", "432", "3.6", "10.4" ], [ "santa fe", "3195", "37.5", "10670", "10.1", "0.0", "17.4", "72.5", "17804", "1265", "299", "18.2", "14.8" ], [ "santiago del estero", "874", "2.598", "3003", "11.5", "0.1", "6.2", "82.2", "1082", "945", "103", "31.0", "31.3" ], [ "tierra del fuego", "127", "2.606", "20682", "4.7", "18.5", "18.6", "58.2", "443", "2267", "478", "6.4", "14.1" ], [ "tucumán", "1448", "5.807", "3937", "6.0", "0.1", "12.6", "81.3", "1031", "973", "146", "27.7", "23.9" ] ], "title": "", "original_id": "9fd3d8839e4a861d3caeef557dc78e70" }, { "_id": "5ed6ef1952663d04885a78728558a2bc", "header": [ "name", "martyred", "place", "beatified", "canonised" ], "rows": [ [ "laurent - marie - joseph imbert / st imbert", "1839", "korea", "1925", "1984" ], [ "jacques - honorã chastan / st chastan", "1839", "korea", "1925", "1984" ], [ "philip minh van doan / st philip minh", "1853", "annam", "1900", "1988" ], [ "peter quy cong doan / st peter quy", "1859", "annam", "1909", "1988" ], [ "paul loc le van / st paul loc", "1859", "annam", "1909", "1988" ], [ "john hoan trinh doan / st john hoan", "1861", "annam", "1909", "1988" ], [ "joseph luu van nguyen / st joseph luu", "1861", "annam", "1909", "1988" ] ], "title": "", "original_id": "50ba63ef02d5f99c08b8a106602b0d30" }, { "_id": "960c36828e3d2981365aa04319998868", "header": [ "jurisdiction", "for prohibition", "percent for", "against prohibition", "percent against" ], "rows": [ [ "alberta and saskatchewan", "6238", "68.8", "2824", "31.2" ], [ "british columbia", "5731", "54.6", "4756", "45.4" ], [ "manitoba", "12419", "80.6", "2978", "19.4" ], [ "new brunswick", "26919", "72.2", "9575", "27.7" ], [ "nova scotia", "34368", "87.2", "5370", "12.8" ], [ "ontario", "154498", "57.3", "115284", "42.7" ], [ "prince edward island", "9461", "89.2", "1146", "10.8" ], [ "quebec", "28436", "18.8", "122760", "81.2" ] ], "title": "", "original_id": "d0a81a29b19bb9b01e0e01329ad80112" }, { "_id": "f4fdb28faa55b1fd24b4c61a2a2f3042", "header": [ "Year", "Number", "Name", "Year.1", "Number.1", "Name.1", "Year.2", "Number.2", "Name.2" ], "rows": [ [ "1884–1885", "7", "Lukin Homphrey Irving (first)", "1886–1887", "18", "Duncan MacPherson", "1888", "4", "William Mahlon Davis" ], [ "1889–1890", "6", "Septimus Julius Augustus Denison", "1891", "10", "Victor Brereton Rivers", "1892", "86", "Reuben Wells Leonard" ], [ "1893–1894", "37", "E.H. Drury", "1895–1896", "15", "Francis Joseph Dixon", "1897", "48", "A.K. Kirkpatrick" ], [ "1898", "57", "H.S. Greenwood", "1899", "14", "John Bray Cochrane", "1900", "41", "Robert Cartwright" ], [ "1901", "154", "F.M. Gaudet", "1902", "47", "Ernest Frederick Wurtele", "1903", "21", "A.E. Doucet" ], [ "1904", "82", "Wallace Bruce Matthews Carruthers", "1905", "188", "W.A.H. Kerr", "1906", "186", "V.A.S. Williams" ], [ "1907", "139", "C.R.F. Coutlee", "1908", "232", "John Houlison", "1909", "91", "J.D. Gibson" ], [ "1910", "63", "George Hooper", "1911", "255", "H.A. Panet", "1912", "246", "Major-General Sir Henry Edward Burstall" ], [ "1913", "268", "Henry Robert Visart de Bury et de Bocarmé", "1914; 1919", "299", "Col. Harry J. Lamb DSO, VD", "1920", "293", "C.J. Armstrong" ], [ "1920–1922", "392", "W.B. Kingsmill", "1923", "377", "A.C. Caldwell", "1924", "140", "G.S. Cartwright" ], [ "1925", "499", "Edouard de B. Panet", "1926", "631", "A.B. Gillies", "1927", "623", "S.B. Coristine" ], [ "1928", "555", "R.R. Carr-Harris", "1929", "667", "E.G. Hanson", "1929–1930", "SUO", "G.D. de S. Wotherspoon" ], [ "1930–1931", "1119", "J.H. Price", "1932", "472", "A.R. Chipman", "1933–1934", "805", "Colin W. G. Gibson" ], [ "1935", "727", "D.A. White", "1936–1937", "877", "G.L. Magann", "1938–1939", "1003", "A.M. Mitchell" ], [ "1940–1941", "803", "J.V. Young", "1942–1943", "1141", "W.H. O'Reilly", "1944", "698", "Everett Bristol" ], [ "1945", "982", "D.W. MacKeen", "1946", "1841", "D.G. Cunningham", "1947", "1230", "S.H. Dobell" ], [ "1948", "1855", "Ian S. Johnston", "1949", "1625", "J.D. Watt", "1950", "1542", "E.W. Crowe" ], [ "1951", "1860", "Nicol Kingsmill", "1952", "1828", "Ted G.E. Beament", "1953", "1620", "R.R. Labatt" ], [ "1954", "1766", "Ken H. Tremain", "1955", "1474", "de L.H.M Panet", "1956", "2034", "Paul Y. Davoud" ], [ "1957", "1954", "W.P. Carr", "1960", "1379", "H.A. Mackenzie", "1961", "2157", "J.H.R. Gagnon" ], [ "1962", "2183", "James E. Pepall", "1963", "2336", "J.H. Moore", "1964", "2351", "Guy Savard" ], [ "1965", "2749", "James B. Cronyn", "1966", "2601", "J. Fergus Maclaren", "1967", "2791", "Jean P.W. Ostiguy" ], [ "1968–1969", "RCNC90", "John F. Frank", "1975–1976", "3661", "Terry Yates", "1976–1977", "5533", "Glenn Allen" ], [ "1977–1978", "3172", "Marshall Soule", "1980–1981", "3251", "Jim Tremain", "1981–1982", "2897", "Herb Pitts" ], [ "1986–1987", "5604", "Ken Smee", "1987–1988", "3010", "Peter McLoughlin", "1992–1993", "H3356", "Robin Cumine" ], [ "1993–1994", "5244", "Tony Downs", "1994–1995", "H7543", "Senator Joseph A. Day", "1995–1996", "5739", "Andre Costin" ], [ "1996–1997", "3550", "Murray Johnston", "1997–1998", "8813", "John D. Gibson", "1998–1999", "G0055", "Valerie Keyes (first female)" ], [ "1999–2000", "8833", "John Leggat", "2000–2001", "5758", "Michael Morres", "2001–2002", "16461", "Ian MacKinnon" ], [ "2002–2003", "6777", "Michel Charron", "2003–2004", "7776", "Chris Lythgo", "2004–2005", "7943", "J. William K. Lye" ], [ "2005–2006", "10080", "Robert Booth", "2007–2008", "6776", "Tim Sparling", "2008–2009", "15988", "Jeff Kearns" ], [ "2010", "16412", "Gord Clarke", "2011", "19307", "David Benoit", "2012", "9889", "Robert Benn" ], [ "2013", "M0058", "Marc Drolet (first UTPNCM)", null, null, null, null, null, null ] ], "title": "", "original_id": "65aadc9add4b1a42f5b5071d6a16cfd6" }, { "_id": "c815f71df234c25567763387c57bf70e", "header": [ "name", "latitude", "longitude", "diameter (km)", "named after" ], "rows": [ [ "caccini", "17.4", "170.4", "38.1", "francesca caccini , italian composer" ], [ "caitlin", "- 65.3", "12.0", "14.7", "irish first name" ], [ "caiwenji", "- 12.4", "287.6", "22.6", "cai wenji , chinese poet" ], [ "caldwell", "23.6", "112.4", "51.0", "taylor caldwell , american author" ], [ "callas", "2.4", "27.0", "33.8", "maria callas , american singer" ], [ "callirhoe", "21.2", "140.7", "33.8", "callirhoe , greek sculptor" ], [ "caroline", "6.9", "306.3", "18.0", "french first name" ], [ "carr", "- 24", "295.7", "31.9", "emily carr , canadian artist" ], [ "carreno", "- 3.9", "16.1", "57.0", "teresa carreño , n venezuela pianist" ], [ "carson", "- 24.2", "344.1", "38.8", "rachel carson , american biologist" ], [ "carter", "5.3", "67.3", "17.5", "maybelle carter , american singer" ], [ "castro", "3.4", "233.9", "22.9", "rosalía de castro , galician poet" ], [ "cather", "47.1", "107.0", "24.6", "willa cather , american novelist" ], [ "centlivre", "19.1", "290.4", "28.8", "susanna centlivre , english actress" ], [ "chapelle", "6.4", "103.8", "22.0", "georgette chapelle , american journalist" ], [ "chechek", "- 2.6", "272.3", "7.2", "tuvan first name" ], [ "chiyojo", "- 47.8", "95.7", "40.2", "chiyojo , japanese poet" ], [ "chloe", "- 7.4", "98.6", "18.6", "greek first name" ], [ "cholpon", "40", "290.0", "6.3", "kyrgyz first name" ], [ "christie", "28.3", "72.7", "23.3", "agatha christie , english author" ], [ "chubado", "45.3", "5.6", "7.0", "fulbe first name" ], [ "clara", "- 37.5", "235.3", "3.2", "latin first name" ], [ "clementina", "35.9", "208.6", "4.0", "portuguese form of clementine , french first name" ], [ "cleopatra", "65.8", "7.1", "105.0", "cleopatra , egyptian queen" ], [ "cline", "- 21.8", "317.1", "38.0", "patsy cline , american singer" ], [ "clio", "6.3", "333.5", "11.4", "greek first name" ], [ "cochran", "51.9", "143.4", "100.0", "jacqueline cochran , american aviator" ], [ "cohn", "- 33.3", "208.1", "18.3", "carola cohn , australian artist" ], [ "colleen", "- 60.8", "162.2", "13.5", "irish first name" ], [ "comnena", "1.2", "343.7", "19.5", "anna comnena , byzantine princess and writer" ], [ "conway", "48.3", "39.0", "49.3", "lady anne finch conway , english natural scientist" ], [ "cori", "25.4", "72.9", "56.1", "gerty cori , czech biochemist" ], [ "corinna", "22.9", "40.6", "19.2", "corinna , greek poet" ], [ "corpman", "0.3", "151.8", "46.0", "elizabeth koopman hevelius , astronomer" ], [ "cortese", "- 11.4", "218.4", "27.7", "isabella cortese , italian physician" ], [ "cotton", "70.8", "300.2", "48.1", "eugénie cotton , french physicist" ], [ "cunitz", "14.5", "350.9", "48.6", "maria cunitz , silesian astronomer" ], [ "cynthia", "- 16.7", "347.5", "15.9", "greek first name" ] ], "title": "", "original_id": "2883b5cdde8c423fe83ae9741807b51a" }, { "_id": "89f2a48c8afb1697b2ec61283f8c0d35", "header": [ "rank", "country / territory", "manhunt international", "1st runner - up", "2nd runner - up", "3rd runner - up", "4th runner - up", "semifinalists", "total" ], "rows": [ [ "1", "china", "2", "1", "1", "1", "0", "5", "10" ], [ "2", "india", "1", "2", "0", "0", "3", "5", "11" ], [ "3", "sweden", "1", "2", "0", "0", "0", "3", "6" ], [ "4", "venezuela", "1", "1", "1", "1", "1", "6", "11" ], [ "5", "turkey", "1", "1", "1", "1", "0", "3", "7" ], [ "6", "australia", "1", "1", "0", "1", "0", "4", "7" ], [ "7", "germany", "1", "1", "0", "0", "0", "1", "3" ], [ "8", "usa", "1", "0", "3", "1", "0", "3", "8" ], [ "9", "philippines", "1", "0", "1", "1", "0", "3", "6" ], [ "10", "greece", "1", "0", "1", "0", "0", "3", "5" ], [ "11", "south africa", "1", "0", "0", "0", "1", "3", "5" ], [ "12", "slovakia", "1", "0", "0", "0", "1", "0", "2" ], [ "13", "france", "1", "0", "0", "0", "0", "2", "3" ], [ "14", "morocco", "1", "0", "0", "0", "0", "0", "1" ] ], "title": "", "original_id": "ebcf933b385594298b3d52a00d7d9682" }, { "_id": "9f6a1450baa966a1ff16820938efee0a", "header": [ "peak", "country", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "mount kilimanjaro", "tanzania", "5895", "5885", "10" ], [ "mount kenya", "kenya", "5199", "3825", "1374" ], [ "mount meru", "tanzania", "4565", "3170", "1395" ], [ "mount elgon", "uganda", "4321", "2458", "1863" ], [ "mulanje massif", "malawi", "3002", "2319", "683" ], [ "kimhandu", "tanzania", "2653", "2121", "532" ], [ "mount satima", "kenya", "4001", "2081", "1920" ], [ "mount hanang", "tanzania", "3420", "2050", "1370" ], [ "loolmalassin", "tanzania", "3682", "2040", "1642" ], [ "gelai peak", "tanzania", "2948", "1930", "1018" ], [ "mount moroto", "uganda", "3083", "1818", "1265" ], [ "kitumbeine hill", "tanzania", "2858", "1770", "1088" ], [ "chepunyal hills", "kenya", "3334", "1759", "1575" ], [ "mount namuli", "mozambique", "2419", "1757", "662" ], [ "shengena", "tanzania", "2464", "1750", "714" ], [ "sungwi", "tanzania", "2300", "1730", "570" ], [ "mount kadam", "uganda", "3063", "1690", "1373" ], [ "mtorwi", "tanzania", "2980", "1688", "1292" ], [ "mount kulal", "kenya", "2285", "1542", "743" ], [ "karenga", "tanzania", "2279", "1529", "750" ], [ "mount ng'iro", "kenya", "2848", "1501", "1347" ] ], "title": "", "original_id": "5a6a21f05be43637076dc55fd0420587" }, { "_id": "1a999d03347413de4af52325731d1a47", "header": [ "brno", "name", "builder", "whenbuilt", "withdrawn" ], "rows": [ [ "34071", "601 squadron", "brighton", "1948", "1967" ], [ "34072", "257 squadron", "brighton", "1948", "1964" ], [ "34073", "249 squadron", "brighton", "1948", "1964" ], [ "34074", "46 squadron", "brighton", "1948", "1963" ], [ "34075", "264 squadron", "brighton", "1948", "1964" ], [ "34076", "41 squadron", "brighton", "1948", "1966" ], [ "34077", "603 squadron", "brighton", "1948", "1967" ], [ "34078", "222 squadron", "brighton", "1948", "1964" ], [ "34079", "141 squadron", "brighton", "1948", "1966" ], [ "34080", "74 squadron", "brighton", "1948", "1964" ], [ "34081", "92 squadron", "brighton", "1948", "1964" ], [ "34082", "615 squadron", "brighton", "1948", "1966" ], [ "34083", "605 squadron", "brighton", "1948", "1964" ], [ "34084", "253 squadron", "brighton", "1948", "1965" ], [ "34085", "501 squadron", "eastleigh", "1948", "1965" ], [ "34086", "219 squadron", "brighton", "1948", "1966" ], [ "34087", "145 squadron", "eastleigh", "1948", "1967" ], [ "34088", "213 squadron", "brighton", "1948", "1967" ], [ "34089", "602 squadron", "eastleigh", "1948", "1967" ], [ "34090", "sir eustace missenden , southern railway", "brighton", "1949", "1967" ], [ "34091", "weymouth", "brighton", "1949", "1964" ], [ "34092", "city of wells", "brighton", "1949", "1964" ], [ "34093", "saunton", "brighton", "1949", "1967" ], [ "34094", "mortehoe", "brighton", "1949", "1964" ], [ "34095", "brentor", "eastleigh", "1949", "1967" ], [ "34096", "trevone", "brighton", "1949", "1964" ], [ "34097", "holsworthy", "brighton", "1949", "1967" ], [ "34098", "templecombe", "brighton", "1949", "1967" ], [ "34099", "lynmouth", "brighton", "1949", "1964" ], [ "34100", "appledore", "brighton", "1949", "1967" ], [ "34101", "hartland", "eastleigh", "1950", "1966" ], [ "34102", "lapford", "eastleigh", "1950", "1967" ], [ "34103", "calstock", "brighton", "1950", "1965" ], [ "34104", "bere alston", "eastleigh", "1950", "1967" ], [ "34105", "swanage", "brighton", "1950", "1964" ], [ "34106", "lydford", "brighton", "march 1950", "september 1964" ], [ "34107", "blandford forum", "brighton", "april 1950", "september 1964" ], [ "34108", "wincanton", "brighton", "april 1950", "june 1967" ], [ "34109", "sir trafford leigh - mallory", "brighton", "may 1950", "september 1964" ], [ "34110", "66 squadron", "brighton", "january 1951", "november 1963" ] ], "title": "", "original_id": "79c7100e623e490d4aabd5361cd50c5b" }, { "_id": "f843aac108f8350d4daf526797b08a9c", "header": [ "Row Header", "Year Ended December 31, 2018 (In cents, except percentage changes)", "Year Ended December 31, 2017 (In cents, except percentage changes)", "Percent Increase (Decrease) (In cents, except percentage changes)" ], "rows": [ [ "Total CASM: Aircraft fuel and related taxes", "2.86", "2.22", "28.8" ], [ "Total CASM: Salaries, wages and benefits", "4.34", "4.32", "0.5" ], [ "Total CASM: Maintenance, materials and repairs", "0.73", "0.71", "2.6" ], [ "Total CASM: Other rent and landing fees", "0.67", "0.65", "3.1" ], [ "Total CASM: Aircraft rent", "0.45", "0.43", "3.5" ], [ "Total CASM: Selling expenses", "0.54", "0.53", "0.9" ], [ "Total CASM: Depreciation and amortization", "0.65", "0.62", "5.9" ], [ "Total CASM: Special items, net", "0.28", "0.26", "8.3" ], [ "Total CASM: Other", "1.80", "1.78", "1.6" ], [ "Regional expenses: Aircraft fuel and related taxes", "0.65", "0.50", "30.7" ], [ "Regional expenses: Other", "1.88", "1.87", "0.4" ], [ "Regional expenses: Total CASM", "14.85", "13.88", "6.9" ], [ "Special items, net: Special items, net", "(0.28)", "(0.26)", "8.3" ], [ "Special items, net: Regional operating special items, net", "—", "(0.01)", "nm (1)" ], [ "Aircraft fuel and related taxes Aircraft fuel and related taxes - mainline", "(2.86)", "(2.22)", "28.8" ], [ "Aircraft fuel and related taxes Aircraft fuel and related taxes - regional", "(0.65)", "(0.50)", "30.7" ], [ "Aircraft fuel and related taxes Total CASM, excluding special items and fuel", "11.06", "10.90", "1.4" ] ], "title": "", "original_id": "a5de47ae8731889ae862729fb82127b2" }, { "_id": "c724d9317727d019a5f8d670a198b22d", "header": [ "no", "peak", "location", "elevation (m)", "prominence (m)", "col height (m)", "col location", "parent" ], "rows": [ [ "1", "mont blanc", "france / italy", "4810", "4697", "113", "near lake kubenskoye", "everest" ], [ "2", "großglockner", "austria", "3798", "2423", "1375", "brenner pass", "mont blanc" ], [ "3", "finsteraarhorn", "switzerland", "4274", "2280", "1994", "near simplon pass", "mont blanc" ], [ "4", "wildspitze", "austria", "3768", "2261", "1507", "reschen pass", "finsteraarhorn 1 / mb 2" ], [ "5", "piz bernina", "switzerland", "4049", "2234", "1815", "maloja pass", "finsteraarhorn 1 / mb 2" ], [ "6", "hochkönig", "austria", "2941", "2181", "760", "near maishofen", "großglockner 1 / mb 2" ], [ "7", "monte rosa", "switzerland", "4634", "2165", "2469", "great st bernard pass", "mont blanc" ], [ "8", "hoher dachstein", "austria", "2995", "2136", "859", "eben im pongau", "großglockner 1 / mb 2" ], [ "9", "marmolada", "italy", "3343", "2131", "1212", "toblach", "großglockner 1 / mb 2" ], [ "10", "monte viso", "italy", "3841", "2062", "1779", "le mauvais pass", "mont blanc" ], [ "11", "triglav", "slovenia", "2864", "2052", "812", "camporosso pass", "marmolada 1 / mb 2" ], [ "12", "barre des écrins", "france", "4102", "2045", "2057", "col du lautaret", "mont blanc" ], [ "13", "säntis", "switzerland", "2503", "2021", "482", "heiligkreuz bei mels", "finsteraarhorn 1 / mb 2" ], [ "14", "ortler", "italy", "3905", "1953", "1952", "fraele pass in the livigno alps", "piz bernina" ], [ "15", "monte baldo / cima valdritta", "italy", "2218", "1950", "268", "near san giovanni pass in nago - torbole", "ortler 1 / mb 2" ], [ "16", "gran paradiso", "italy", "4061", "1891", "2170", "near little st bernard pass", "mont blanc" ], [ "17", "pizzo di coca", "italy", "3050", "1878", "1172", "aprica", "ortler 1 / mb 2" ], [ "18", "cima dodici", "italy", "2336", "1874", "462", "pergine valsugana", "marmolada 1 / mb 2" ], [ "19", "dents du midi", "switzerland", "3257", "1796", "1461", "col des montets", "mont blanc" ], [ "20", "chamechaude", "france", "2082", "1771", "311", "chambéry", "mont blanc" ], [ "21", "zugspitze", "germany / austria", "2962", "1746", "1216", "near fern pass", "finsteraarhorn 1 / mb 2" ], [ "22", "monte antelao", "italy", "3264", "1735", "1529", "passo cimabanche", "marmolada" ], [ "23", "arcalod", "france", "2217", "1713", "504", "viuz in faverges", "mont blanc" ], [ "24", "grintovec", "slovenia", "2558", "1706", "852", "rateče", "triglav" ], [ "25", "großer priel", "austria", "2515", "1700", "810", "near pichl - kainisch", "hoher dachstein 1 / mb 2" ], [ "26", "grigna settentrionale", "italy", "2409", "1686", "723", "balisio in ballabio", "pizzo di coca 1 / mb 2" ], [ "27", "monte bondone", "italy", "2180", "1679", "501", "near cadine in trento", "ortler 1 / mb 2" ], [ "28", "presanella", "italy", "3558", "1676", "1882", "tonale pass", "ortler" ], [ "29", "birnhorn", "austria", "2634", "1665", "969", "hochfilzen", "großglockner 1 / mb 2" ], [ "30", "col nudo", "italy", "2471", "1644", "827", "passo di sant'osvaldo", "antelao 1 / mb 2" ], [ "31", "pointe percée", "france", "2750", "1643", "1107", "near pont d'arbon near megève", "mont blanc" ], [ "32", "jôf di montasio", "italy", "2753", "1597", "1156", "predil pass", "triglav" ], [ "33", "mölltaler polinik", "austria", "2784", "1579", "1205", "iselsberg pass", "großglockner 1 / mb 2" ], [ "34", "tödi", "switzerland", "3614", "1570", "2044", "oberalp pass", "finsteraarhorn" ], [ "35", "birkkarspitze", "austria", "2749", "1569", "1180", "seefeld in tirol", "zugspitze 1 / mb 2" ], [ "36", "ellmauer halt", "austria", "2344", "1551", "793", "near ellmau", "großglockner 1 / mb 2" ], [ "37", "grande tête de l'obiou", "france", "2790", "1542", "1248", "col bayard", "barre des écrins 1 / mb 2" ], [ "38", "cima tosa", "italy", "3173", "1521", "1652", "near campo carlo magno", "presanella 1 / mb 2" ], [ "39", "hochtor", "austria", "2369", "1520", "849", "schober pass", "großglockner 1 / mb 2" ], [ "40", "grimming", "austria", "2351", "1518", "833", "near schrödis near tauplitz", "großer priel" ], [ "41", "grand combin", "switzerland", "4314", "1517", "2797", "fenêtre de durand", "monte rosa" ], [ "42", "la tournette", "france", "2351", "1514", "837", "col du marais", "pointe percée 1 / mb 2" ], [ "43", "zirbitzkogel", "austria", "2396", "1502", "894", "neumarkter sattel", "großglockner 1 / mb 2" ] ], "title": "", "original_id": "cb663d0399df511cd8a624ea0c85c8f0" }, { "_id": "7f60545d0bfebee9f6051043d95876e0", "header": [ "draw", "language", "artist", "song", "place", "points" ], "rows": [ [ "1", "icelandic", "beathoven", "þú og þeir (sókrates)", "16", "20" ], [ "2", "swedish", "tommy körberg", "stad i ljus", "12", "52" ], [ "3", "finnish", "boulevard", "nauravat silmät muistetaan", "20", "3" ], [ "4", "english", "scott fitzgerald", "go", "2", "136" ], [ "5", "turkish", "mfö", "sufi", "15", "37" ], [ "6", "spanish", "la década prodigiosa", "la chica que yo quiero (made in spain)", "11", "58" ], [ "7", "dutch", "gerard joling", "shangri - la", "9", "70" ], [ "8", "hebrew", "yardena arazi", "ben adam (בן אדם)", "7", "85" ], [ "9", "french", "céline dion", "ne partez pas sans moi", "1", "137" ], [ "10", "english", "jump the gun", "take him home", "8", "79" ], [ "11", "german", "maxi & chris garden", "lied für einen freund", "14", "48" ], [ "12", "german", "wilfried", "lisa mona lisa", "21", "0" ], [ "13", "danish", "hot eyes", "ka' du se hva' jeg sa'", "3", "92" ], [ "14", "greek", "afroditi frida", "clown (κλόουν)", "17", "10" ], [ "15", "norwegian", "karoline krüger", "for vår jord", "5", "88" ], [ "16", "french", "reynaert", "laissez briller le soleil", "18", "5" ], [ "17", "french", "lara fabian", "croire", "4", "90" ], [ "18", "italian", "luca barbarossa", "vivo (ti scrivo)", "12", "52" ], [ "19", "french", "gérard lenorman", "chanteur de charme", "10", "64" ], [ "20", "portuguese", "dora", "voltarei", "18", "5" ], [ "21", "croatian", "srebrna krila", "mangup", "6", "87" ] ], "title": "", "original_id": "1aad7f91605843765c973d07d7f8c341" }, { "_id": "bbbd2b9970010739fe89ae06b87ffdad", "header": [ "election", "dã¡il", "share of votes", "seats", "total seats" ], "rows": [ [ "1927 (jun)", "5th", "26.2%", "44", "153" ], [ "1927 (sep)", "6th", "35.2%", "57", "153" ], [ "1932", "7th", "44.5%", "72", "153" ], [ "1933", "8th", "49.7%", "76", "153" ], [ "1937", "9th", "45.2%", "68", "138" ], [ "1938", "10th", "51.9%", "76", "138" ], [ "1943", "11th", "41.8%", "66", "138" ], [ "1944", "12th", "48.9%", "75", "138" ], [ "1948", "13th", "41.9%", "67", "147" ], [ "1951", "14th", "46.3%", "68", "147" ], [ "1954", "15th", "43.4%", "65", "147" ], [ "1957", "16th", "48.3%", "78", "147" ], [ "1961", "17th", "43.8%", "70", "144" ], [ "1965", "18th", "47.7%", "72", "144" ], [ "1969", "19th", "44.6%", "74", "144" ], [ "1973", "20th", "46.2%", "68", "144" ], [ "1977", "21st", "50.6%", "84", "148" ], [ "1981", "22nd", "45.3%", "77", "166" ], [ "1982 (feb)", "23rd", "47.3%", "81", "166" ], [ "1982 (nov)", "24th", "45.2%", "75", "166" ], [ "1987", "25th", "44.2%", "81", "166" ], [ "1989", "26th", "44.2%", "77", "166" ], [ "1992", "27th", "39.1%", "68", "166" ], [ "1997", "28th", "39.3%", "77", "166" ], [ "2002", "29th", "41.5%", "81", "166" ], [ "2007", "30th", "41.6%", "77", "166" ], [ "2011", "31st", "17.4%", "20", "166" ] ], "title": "", "original_id": "66ea61b936831554ebaa4423d2600550" }, { "_id": "8d6c22baa3353ba93a52cedc9da9356d", "header": [ "crime", "reported offenses", "killeen rate", "texas rate", "us rate" ], "rows": [ [ "murder", "10", "8.6", "5.6", "5.6" ], [ "rape", "66", "56.9", "32.9", "29.4" ], [ "robbery", "216", "186.4", "155.2", "154.0" ], [ "aggravated assault", "593", "511.6", "314.4", "281.6" ], [ "violent crime", "885", "763.5", "508.2", "470.6" ], [ "burglary", "1711", "1476.2", "946.5", "743.4" ], [ "larceny - theft", "2877", "2482.2", "2688.9", "2200.1" ], [ "motor vehicle theft", "169", "145.8", "351.1", "330.5" ], [ "non - violent crime", "4757", "4104.2", "3986.6", "3274.0" ] ], "title": "", "original_id": "b08634d7cd884455337211051bbfc115" }, { "_id": "59f19a49cb25b3266538b4d0afc736ab", "header": [ "Name", "Season", "Month", "Max. sustained winds", "Max. sustained winds", "Max. sustained winds", "Minimum pressure" ], "rows": [ [ "Name", "Season", "Month", "(Knots)", "(km/h)", "(mph)", "(mbar)" ], [ "Hurricane Ella", "1978", "August, September", "120", "220", "140", "956" ], [ "Hurricane Greta", "1978", "September", "115", "215", "130", "947" ], [ "Hurricane Frederic", "1979", "August, September", "115", "215", "130", "943" ], [ "Hurricane Harvey", "1981", "September", "115", "215", "130", "946" ], [ "Hurricane Debby", "1982", "September", "115", "215", "130", "950" ], [ "Hurricane Diana", "1984", "September", "115", "215", "130", "949" ], [ "Hurricane Gloria", "1985", "September, October", "125", "230", "145", "919" ], [ "Hurricane Helene", "1988", "September", "125", "230", "145", "938" ], [ "Hurricane Joan", "1988", "October, November", "125", "230", "145", "932" ], [ "Hurricane Gabrielle", "1989", "August, September", "125", "230", "145", "935" ], [ "Hurricane Claudette", "1991", "September", "115", "215", "130", "943" ], [ "Hurricane Felix", "1995", "August", "120", "220", "140", "929" ], [ "Hurricane Luis", "1995", "August, September", "120", "220", "140", "935" ], [ "Hurricane Opal", "1995", "September, October", "130", "240", "150", "916" ], [ "Hurricane Edouard", "1996", "August, September", "125", "230", "145", "933" ], [ "Hurricane Hortense", "1996", "September", "120", "220", "140", "935" ], [ "Hurricane Georges", "1998", "September, October", "135", "250", "155", "937" ], [ "Hurricane Bret", "1999", "August", "125", "230", "145", "944" ], [ "Hurricane Cindy", "1999", "August", "120", "220", "140", "942" ], [ "Hurricane Floyd", "1999", "September", "135", "250", "155", "921" ], [ "Hurricane Gert", "1999", "September", "130", "240", "150", "930" ], [ "Hurricane Lenny", "1999", "November", "135", "250", "155", "933" ], [ "Hurricane Isaac", "2000", "September, October", "120", "220", "140", "943" ], [ "Hurricane Keith", "2000", "September, October", "120", "220", "140", "939" ], [ "Sources: Atlantic Hurricane Best Track File 1851–2012", "Sources: Atlantic Hurricane Best Track File 1851–2012", "Sources: Atlantic Hurricane Best Track File 1851–2012", "Sources: Atlantic Hurricane Best Track File 1851–2012", "Sources: Atlantic Hurricane Best Track File 1851–2012", "Sources: Atlantic Hurricane Best Track File 1851–2012", "Sources: Atlantic Hurricane Best Track File 1851–2012" ] ], "title": "", "original_id": "66ba5aa71ed35406e5bb3d31a2a25ef1" }, { "_id": "822120320795596d38edcd65db11a516", "header": [ "june 10 - 11", "march 27 - 29", "january 15 - 16", "november 3", "august 21 - 22" ], "rows": [ [ "june 10 , 1964", "march 28 , 1968", "january 16 , 1972", "november 3 , 1975", "august 22 , 1979" ], [ "127", "129", "131", "133", "135" ], [ "june 11 , 1983", "march 29 , 1987", "january 15 , 1991", "november 3 , 1994", "august 22 , 1998" ], [ "137", "139", "141", "143", "145" ], [ "june 10 , 2002", "march 29 , 2006", "january 15 , 2010", "november 3 , 2013", "august 21 , 2017" ], [ "147", "149", "151", "153", "155" ] ], "title": "", "original_id": "d35caf05d6485bf3aee4d01cd36bdc7b" }, { "_id": "3fc3b3f493f11f6096e1b8dc1480a664", "header": [ "year", "theme", "artist", "composition", "mintage", "issue price" ], "rows": [ [ "2000", "year of the dragon", "harvey chan", "75% gold , 25% silver", "8874", "388.88" ], [ "2001", "year of the snake", "harvey chan", "75% gold , 25% silver", "6571", "388.88" ], [ "2002", "year of the horse", "harvey chan", "75% gold , 25% silver", "6843", "388.88" ], [ "2003", "year of the goat", "harvey chan", "75% gold , 25% silver", "3927", "398.88" ], [ "2004", "year of the monkey", "harvey chan", "75% gold , 25% silver", "3318", "398.88" ], [ "2005", "year of the rooster", "harvey chan", "75% gold , 25% silver", "4888", "398.88" ], [ "2006", "year of the dog", "harvey chan", "75% gold , 25% silver", "4888", "448.88" ], [ "2007", "year of the pig", "harvey chan", "75% gold , 25% silver", "4888", "498.95" ], [ "2008", "year of the rat", "harvey chan", "75% gold , 25% silver", "4888", "508.95" ], [ "2009", "year of the ox", "harvey chan", "75% gold , 25% silver", "4888", "638.88" ], [ "2010", "year of the tiger", "harvey chan", "75% gold , 25% silver", "4888", "555.55" ], [ "2011", "year of the rabbit", "harvey chan", "75% gold , 25% silver", "4888", "638.88" ] ], "title": "", "original_id": "6f416284e0b161716e479a0f4b3e6772" }, { "_id": "e1ab06eef2e611cfcdb477b1a4d9cbd8", "header": [ "party", "seats contested", "seats won", "no of votes", "% of votes", "% in seats contested", "seats forfeited", "2003 seats" ], "rows": [ [ "bharatiya janata party", "49", "0", "28102", "1.49%", "1.79%", "49", "0" ], [ "communist party of india", "2", "1", "27891", "1.48%", "48.65%", "0", "1" ], [ "communist party of india (marxist)", "56", "46", "903009", "48.01%", "51.21%", "0", "38" ], [ "indian national congress", "48", "10", "684207", "36.38%", "44.38%", "1", "13" ], [ "nationalist congress party", "5", "0", "1882", "0.10%", "0.92%", "5", "0" ], [ "all india forward bloc", "12", "0", "2961", "0.16%", "0.74%", "12", "0" ], [ "all india trinamool congress", "22", "0", "6620", "0.35%", "0.92%", "22", "0" ], [ "indigenous nationalist party of twipra", "11", "1", "116761", "6.21%", "38.23%", "2", "6" ], [ "janata dal (united)", "2", "0", "1081", "0.06%", "1.74%", "2", "0" ], [ "lok janshakti party", "8", "0", "2738", "0.15%", "1.07%", "8", "0" ], [ "revolutionary socialist party", "2", "2", "31717", "1.69%", "52.58%", "0", "2" ], [ "amra bangalee", "19", "0", "5532", "0.29%", "0.96%", "19", "0" ], [ "party of democratic socialism", "1", "0", "2062", "0.11%", "6.13%", "1", "0" ], [ "independents", "62", "0", "61010", "3.24%", "4.94%", "58", "0" ] ], "title": "", "original_id": "cf9dd52a762be9733bb8d507360547ed" }, { "_id": "a9c5a04b69905383a1ecf5a6f1bb2a9b", "header": [ "city (utility)", "residential monthly usage : 1000 kwh", "small power power demand : 40 kw , consumption 10000 kwh , load factor : 35%", "medium power power demand : 1000 kw , consumption : 400000 kwh , load factor : 56 %", "large power power demand : 50000 kw , consumption : 30600000 kwh , load factor : 85%" ], "rows": [ [ "st john 's ( newfoundland power / nl hydro )", "11.8", "11.83", "9.05", "3.98" ], [ "charlottetown ( maritime electric )", "14.51", "15.18", "12.68", "8.36" ], [ "halifax ( nova scotia power )", "15.01", "14.25", "11.99", "9.0" ], [ "moncton ( nb power )", "11.82", "12.46", "10.98", "6.86" ], [ "montreal ( hydro - quãbec )", "6.76", "8.85", "7.19", "4.51" ], [ "ottawa ( hydro ottawa )", "13.14", "12.94", "11.42", "10.58" ], [ "toronto ( toronto hydro )", "13.57", "13.41", "11.43", "10.46" ], [ "winnipeg ( manitoba hydro )", "7.46", "7.29", "5.62", "3.69" ], [ "regina ( saskpower )", "12.54", "10.31", "9.08", "5.67" ], [ "edmonton ( epcor )", "12.9", "12.41", "11.07", "6.97" ], [ "calgary ( enmax )", "13.89", "11.24", "9.53", "8.28" ] ], "title": "", "original_id": "a6bf1a5c7ab44c8674bb88b508865392" }, { "_id": "07aec928cc2c3847cf3612fc01a6e80c", "header": [ "No.", "SWV", "Title", "English", "Source", "Details" ], "rows": [ [ "1", "257", "Paratum cor meum, Deus", "My heart is ready, O God", "Psalms 108:1–3", "257" ], [ "2", "258", "Exultavit cor meum in Domino", "My heart rejoiceth in the Lord", "1 Samuel 2:1–2", "258" ], [ "3", "259", "In te, Domine, speravi", "I will extol thee, O Lord", "Psalms 30:1–2,1", "259" ], [ "4", "260", "Cantabo domino in vita mea", "I will sing unto the Lord as long as I live", "Psalms 104:33", "260" ], [ "5", "261", "Venite ad me omnes qui laboratis", "Come unto me, all ye that labour", "Matthew 11:28–30", "261" ], [ "6", "262", "Jubilate Deo omnis terra", "Make a joyful noise unto the Lord", "Psalms 100", "262" ], [ "7", "263", "Anima mea liquefacta est", "My soul melted when my beloved spoke", "Song of Solomon 5:6; 2:14; 5:13; 5:8", "263" ], [ "8", "264", "Adjuro vos, filiae Jerusalem", "I adjure you, daughters of Jerusalem", "Song of Solomon 5:6; 2:14; 5:13; 5:8", "264" ], [ "9", "265", "O quam tu pulchra es, amica mea", "How beautiful you are, my love", "Song of Solomon 4:1-5,8", "265" ], [ "10", "266", "Veni de Libano, veni, amica mea", "Advance from Lebanon, my spouse", "Song of Solomon 4:1-5,8", "266" ], [ "11", "267", "Benedicam Dominum in omni tempore", "I will bless the Lord at all times", "Psalms 34:1–2", "267" ], [ "12", "268", "Exquisivi Dominum et exaudivit me", "I sought the Lord, and he heard me", "Psalms 34:4–6", "268" ], [ "13", "269", "Fili mi, Absalon", "My son, Absalon", "2 Samuel 18:32", "269" ], [ "14", "270", "Attendite, popule meus", "Give ear, O my people", "Psalms 78:1–3", "270" ], [ "15", "271", "Domine, labia mea aperies", "O Lord, open thou my lips", "Psalms 51:15", "271" ], [ "16", "272", "In lectulo per noctes", "On my bed, throughout the night", "Song of Solomon 3:1-2,4", "272" ], [ "17", "273", "Invenerunt me costudes civitatis", "The watchers who guard the city found me", "Song of Solomon 3:1-2,4", "273" ], [ "18", "274", "Veni, dilecte mi, in hortum meum", "May my beloved enter into his garden", "Song of Solomon 5:1", "274" ], [ "19", "275", "Buccinate in neomenia tuba", "Blow the trumpet when the moon is new", "Psalms 81:3,1; 98:6", "275" ], [ "20", "276", "Jubilate Deo in chordis", "Let us rejoice in God with strings and organ", "Psalms 150:4; Psalms 98:4", "276" ] ], "title": "", "original_id": "6bf0106b75631feb6f504e4d48bb895c" }, { "_id": "96b8173c1d13e8344aa2ee35d7cf183d", "header": [ "canton", "years of kindergarten", "years of kindergarten provided", "years of kindergarten legally required", "length of primary school", "length of mandatory secondary school", "separate secondary schools", "cooperative secondary schools", "integrated secondary schools" ], "rows": [ [ "zurich", "2", "2", "2", "6", "3", "yes", "no", "no" ], [ "bern", "1", "1", "0", "6", "3", "yes", "yes", "yes" ], [ "lucerne", "1", "1", "1", "6", "3", "yes", "yes", "yes" ], [ "uri", "1", "1", "0", "6", "3", "no", "no", "yes" ], [ "schwyz", "1", "1", "1", "6", "3", "no", "no", "yes" ], [ "obwalden", "1", "1", "1", "6", "3", "no", "no", "yes" ], [ "nidwalden", "2", "2", "1", "6", "3", "no", "no", "yes" ], [ "glarus", "2", "2", "1", "6", "3", "yes", "yes", "yes" ], [ "zug", "2", "1", "1", "6", "3", "no", "no", "yes" ], [ "fribourg", "2", "1 or 2", "0 or 2", "6", "3", "yes", "no", "yes" ], [ "solothurn", "2", "2", "0", "6", "3", "yes", "yes", "yes" ], [ "basel - stadt", "2", "2", "2", "4", "5", "yes", "no", "no" ], [ "basel - landschaft", "2", "2", "1", "5", "4", "yes", "no", "no" ], [ "schaffhausen", "2", "2", "1", "6", "3", "no", "no", "yes" ], [ "appenzell ausserrhoden", "2", "2", "1", "6", "3", "yes", "yes", "yes" ], [ "appenzell innerrhoden", "2", "2", "1", "6", "3", "yes", "yes", "yes" ], [ "st gallen", "2", "2", "2", "6", "3", "no", "no", "yes" ], [ "graubã¼nden", "1", "1", "0", "6", "3", "yes", "no", "no" ], [ "aargau", "1", "1", "0", "5", "4", "yes", "no", "no" ], [ "thurgau", "2", "2", "2", "6", "3", "yes", "no", "no" ], [ "ticino", "3", "3", "0", "5", "4", "yes", "no", "no" ], [ "vaud", "2", "2", "0", "4", "5", "yes", "no", "no" ], [ "valais", "1", "0", "0", "6", "3", "yes", "no", "no" ], [ "neuchãtel", "2", "2", "0", "5", "4", "yes", "no", "no" ], [ "geneva", "2", "2", "0", "6", "3", "yes", "no", "no" ] ], "title": "", "original_id": "bdfcc7e1bb6dc5eef09456c8ba56f46d" }, { "_id": "d3fe9ecacfde1dc41d383e9553b9afe2", "header": [ "0", "pōlô", "Unnamed: 2", "Unnamed: 3", "Unnamed: 4", "Unnamed: 5", "Unnamed: 6", "Unnamed: 7", "Unnamed: 8", "Unnamed: 9", "Unnamed: 10", "Unnamed: 11", "Unnamed: 12", "Unnamed: 13", "Unnamed: 14", "Unnamed: 15", "Unnamed: 16", "Unnamed: 17", "Unnamed: 18", "Unnamed: 19" ], "rows": [ [ "1", "əsad", "11", "samsad", "21", "darwamsad", "31", "tolomsad", "41", "pamsad", "51", "limamsad", "61", "nəmsad", "71", "pitomsad", "81", "walomsad", "91", "yamsad" ], [ "2", "darwā", "12", "samdarwā", "22", "darwamdarwā", "32", "tolomdarwā", "42", "pamdarwā", "52", "limamdarwā", "62", "nəmdarwā", "72", "pitomdarwā", "82", "walomdarwā", "92", "yamdarwā" ], [ "3", "tolō", "13", "samtolō", "23", "darwamtolō", "33", "tolomtolō", "43", "pamtolō", "53", "limamtolō", "63", "nəmtolō", "73", "pitomtolō", "83", "walomtolō", "93", "yamtolō" ], [ "4", "əpat", "14", "sampat", "24", "darwampat", "34", "tolompat", "44", "pampat", "54", "limampat", "64", "nəmpat", "74", "pitompat", "84", "walompat", "94", "yampat" ], [ "5", "limā", "15", "samlimā", "25", "darwamlimā", "35", "tolomlimā", "45", "pamlimā", "55", "limamlimā", "65", "nəmlimā", "75", "pitomlimā", "85", "walomlimā", "95", "yamlimā" ], [ "6", "ənəm", "16", "samnəm", "26", "darwamnəm", "36", "tolomnəm", "46", "pamnəm", "56", "limamnəm", "66", "nəmnəm", "76", "pitomnəm", "86", "walomnəm", "96", "yamnəm" ], [ "7", "pitō", "17", "sampitō", "27", "darwampitō", "37", "tolompitō", "47", "pampitō", "57", "limampitō", "67", "nəmpitō", "77", "pitompitō", "87", "walompitō", "97", "yampitō" ], [ "8", "walō", "18", "samwalō", "28", "darwamwalō", "38", "tolomwalō", "48", "pamwalō", "58", "limamwalō", "68", "nəmwalō", "78", "pitomwalō", "88", "walomwalō", "98", "yamwalō" ], [ "9", "siyam", "19", "samsiyam", "29", "darwamsiyam", "39", "tolomsiyam", "49", "pamsiyam", "59", "limamsiyam", "69", "nəmsiyam", "79", "pitomsiyam", "89", "walomsiyam", "99", "yamsiyam" ], [ "10", "sampōlô", "20", "darwampōlô", "30", "tolompōlô", "40", "pampōlô", "50", "limampōlô", "60", "nəmpōlô", "70", "pitompōlô", "80", "walompōlô", "90", "yampōlô", "100", "saŋgatos" ] ], "title": "", "original_id": "0e1001d55ac9d8f38aa594007e13070e" }, { "_id": "f7eed1c8e05855b0b93d6e9c4dd4ebc5", "header": [ "detailed family information", "from", "to", "anchor", "orientation", "conserved in mus musculus", "matrix sim", "sequence", "occurrence" ], "rows": [ [ "cell cycle regulators : cell cycle homology element", "137", "149", "143", "+ strand", "conserved", "0.943", "ggacttgaattca", "1" ], [ "gata binding factors", "172", "184", "178", "+ strand", "conserved", "0.946", "taaagatttgagg", "1" ], [ "vertebrate tata binding protein factor", "193", "209", "201", "+ strand", "conserved", "0.983", "tcctataaaatttggat", "1" ], [ "heat schock factors", "291", "315", "303", "+ strand", "conserved", "0.992", "cacagaaacgttagaagcatctctt", "4" ], [ "human and murine ets1 factors", "512", "532", "522", "+ strand", "conserved", "0.984", "taagccccggaagtacttgtt", "3" ], [ "zinc finger transcription factor ru49 , zipro1", "522", "528", "525", "+ strand", "conserved", "0.989", "aagtact", "2" ], [ "krueppel like transcription factors", "618", "634", "626", "+ strand", "conserved", "0.925", "tggaggggcagacaccc", "1" ] ], "title": "", "original_id": "663af775c49891f680893517237e7158" }, { "_id": "f6107def117892afa7db2e9b9a76fa37", "header": [ "tallangatta dfl", "wins", "byes", "losses", "draws", "against" ], "rows": [ [ "kiewa sandy creek", "16", "0", "2", "0", "1013" ], [ "tallangatta valley", "16", "0", "2", "0", "1165" ], [ "beechworth", "15", "0", "3", "0", "1085" ], [ "yackandandah", "13", "0", "5", "0", "1277" ], [ "thurgoona", "11", "0", "7", "0", "1267" ], [ "mitta united", "11", "0", "7", "0", "1689" ], [ "barnawartha", "8", "0", "10", "0", "1686" ], [ "rutherglen", "7", "0", "11", "0", "1479" ], [ "wahgunyah", "5", "0", "13", "0", "1731" ], [ "dederang mt beauty", "4", "0", "14", "0", "2027" ], [ "wodonga saints", "1", "0", "17", "0", "2250" ], [ "chiltern", "1", "0", "17", "0", "2535" ] ], "title": "", "original_id": "796e946eec60f6acdfae76d3f62e8baf" }, { "_id": "22c5ef926a691b6ca3b7e7ebdac7be6f", "header": [ "member state", "population millions", "meps", "inhabitants per mep", "influence" ], "rows": [ [ "austria", "8.27", "17", "486235", "1.71" ], [ "belgium", "10.51", "22", "477773", "1.74" ], [ "bulgaria", "7.72", "17", "454059", "1.83" ], [ "cyprus", "0.77", "6", "127667", "6.52" ], [ "czech republic", "10.25", "22", "465955", "1.79" ], [ "denmark", "5.43", "13", "417538", "1.99" ], [ "estonia", "1.34", "6", "224000", "3.72" ], [ "finland", "5.26", "13", "404308", "2.06" ], [ "france", "62.89", "72", "873417", "0.95" ], [ "germany", "82.43", "99", "832606", "1.0" ], [ "greece", "11.13", "22", "505682", "1.65" ], [ "hungary", "10.08", "22", "458045", "1.82" ], [ "ireland", "4.21", "12", "350750", "2.37" ], [ "italy", "58.75", "72", "816000", "1.02" ], [ "latvia", "2.3", "8", "286875", "2.9" ], [ "lithuania", "3.4", "12", "283583", "2.94" ], [ "luxembourg", "0.46", "6", "76667", "10.86" ], [ "malta", "0.4", "5", "80800", "10.3" ], [ "netherlands", "16.33", "25", "653360", "1.27" ], [ "poland", "38.16", "50", "763140", "1.09" ], [ "portugal", "10.57", "22", "480455", "1.73" ], [ "romania", "21.61", "33", "654848", "1.27" ], [ "slovakia", "5.39", "13", "414538", "2.01" ], [ "slovenia", "2.0", "7", "286143", "2.91" ], [ "spain", "43.76", "50", "875160", "0.95" ], [ "sweden", "9.05", "18", "502667", "1.66" ], [ "united kingdom", "60.64", "72", "839194", "0.99" ] ], "title": "", "original_id": "82e094eabf0ec04f7bda6f1782715c7f" }, { "_id": "46a3e3508dd436678ea1087dee7112d6", "header": [ "city", "comprehension of danish", "comprehension of swedish", "comprehension of norwegian", "average" ], "rows": [ [ "århus , denmark", "n / a", "3.74", "4.68", "4.21" ], [ "copenhagen , denmark", "n / a", "3.60", "4.13", "3.87" ], [ "malmö , sweden", "5.08", "n / a", "4.97", "5.02" ], [ "stockholm , sweden", "3.46", "n / a", "5.56", "4.51" ], [ "bergen , norway", "6.50", "6.15", "n / a", "6.32" ], [ "oslo , norway", "6.57", "7.12", "n / a", "6.85" ] ], "title": "", "original_id": "74ea4975885914ad6aad322d4e668f55" }, { "_id": "25a20b5618ec14691432f57dc4e3f702", "header": [ "rank", "name", "height feet (m)", "floors", "year" ], "rows": [ [ "1", "one america plaza", "500 (152)", "34", "1991" ], [ "2", "symphony towers", "499 (152)", "34", "1989" ], [ "3", "manchester grand hyatt hotel", "497 (151)", "40", "1992" ], [ "4", "electra", "475 (145)", "43", "2007" ], [ "5 =", "emerald plaza", "450 (137)", "30", "1990" ], [ "5 =", "pinnacle marina tower", "450 (137)", "36", "2005" ], [ "7", "manchester grand hyatt seaport", "446 (136)", "34", "2003" ], [ "8 =", "harbor club west", "424 (129)", "41", "1992" ], [ "8 =", "harbor club east", "424 (129)", "41", "1992" ], [ "10 =", "the grande south at santa fe place", "420 (128)", "39", "2004" ], [ "10 =", "the grande north at santa fe place", "420 (128)", "39", "2005" ], [ "10 =", "vantage pointe condominium", "420 (128)", "41", "2009" ], [ "13", "advanced equities plaza", "412 (126)", "23", "2005" ], [ "14", "bayside at the embarcadero", "395 (120)", "36", "2009" ], [ "15", "union bank of california building", "388 (118)", "27", "1969" ], [ "16", "hilton san diego bayfront", "385 (117)", "32", "2008" ], [ "17", "the mark", "381 (116)", "33", "2007" ], [ "18", "sapphire tower", "380 (116)", "32", "2008" ], [ "19", "first national bank center", "379 (116)", "27", "1982" ], [ "20", "omni san diego hotel", "375 (114)", "34", "2004" ], [ "21", "meridian condominiums", "371 (113)", "28", "1985" ], [ "22 =", "marriott hotel and marina tower i", "361 (110)", "24", "1987" ], [ "22 =", "marriott hotel and marina tower ii", "361 (110)", "24", "1987" ], [ "24", "imperial bank tower", "355 (108)", "24", "1982" ], [ "25", "executive complex", "350 (107)", "25", "1963" ], [ "26", "at&t building", "348 (106)", "20", "1982" ], [ "27", "comerica bank building", "339 (103)", "23", "1974" ], [ "28", "us federal courthouse", "333 (101)", "16", "2012" ], [ "29", "wells fargo plaza", "331 (101)", "23", "1984" ], [ "30", "el cortez apartment hotel", "310 (94)", "16", "1927" ], [ "31", "nbc building", "306 (93)", "22", "1975" ] ], "title": "", "original_id": "08f183a895a28e77a4ccbcc790997f09" }, { "_id": "f0d20da1e4bf2902865ec886685d50e6", "header": [ "Club", "Season", "Division", "League", "League", "FA Cup", "FA Cup", "Total", "Total" ], "rows": [ [ "Club", "Season", "Division", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals" ], [ "Leeds United", "1925–26", "First Division", "12", "0", "0", "0", "12", "0" ], [ "Leeds United", "1926–27", "First Division", "42", "0", "3", "0", "45", "0" ], [ "Leeds United", "1927–28", "Second Division", "38", "0", "1", "0", "39", "0" ], [ "Leeds United", "1928–29", "First Division", "39", "0", "2", "0", "41", "0" ], [ "Leeds United", "1929–30", "First Division", "16", "0", "2", "0", "18", "0" ], [ "Leeds United", "1930–31", "First Division", "38", "0", "3", "0", "41", "0" ], [ "Leeds United", "1931–32", "Second Division", "32", "0", "0", "0", "32", "0" ], [ "Leeds United", "1932–33", "First Division", "30", "0", "4", "0", "30", "4" ], [ "Leeds United", "1933–34", "First Division", "0", "0", "0", "0", "0", "0" ], [ "Leeds United", "Total", "Total", "247", "0", "15", "0", "262", "0" ], [ "Port Vale", "1934–35", "Second Division", "42", "0", "1", "0", "43", "0" ], [ "Port Vale", "1935–36", "Second Division", "40", "0", "3", "0", "43", "0" ], [ "Port Vale", "Total", "Total", "82", "0", "4", "0", "86", "0" ], [ "Career Total", "Career Total", "Career Total", "329", "0", "19", "0", "348", "0" ] ], "title": "", "original_id": "5b785ebc08f9cca718d92e965814dba8" }, { "_id": "12420c78520dd2dc3497ffe0cf26a39c", "header": [ "rank by average", "competition finish", "couple", "total", "number of dances", "average" ], "rows": [ [ "1", "2", "darren & lana", "374", "11", "34.0" ], [ "2", "1", "darrien & hollie", "356", "11", "32.4" ], [ "3", "3", "ben & stephanie", "342", "11", "31.1" ], [ "4", "6", "paul & pamela", "150", "5", "30.0" ], [ "5", "8", "stewart & clare", "80", "3", "26.7" ], [ "6", "5", "mark & jennifer", "169", "7", "24.1" ], [ "7", "10", "clive & helga", "24", "1", "24.0" ], [ "8", "4", "jp & stacey", "206", "9", "22.9" ], [ "9", "9", "rob & dawn", "45", "2", "22.5" ] ], "title": "", "original_id": "243a25da2e37282f9cdf151f453b167d" }, { "_id": "5b4d59a64368a14778493f8be23a8f90", "header": [ "region", "location", "from", "depots (12.09)", "routes (12.09)", "vehicles (12.09)" ], "rows": [ [ "altai krai", "barnaul", "19 oct 1973", "1", "5", "57" ], [ "altai krai", "rubtsovsk", "28 dec 1973", "1", "2", "49" ], [ "zabaykalsky krai", "chita", "30 dec 1970", "1", "5", "77" ], [ "irkutsk obl", "irkutsk", "6 nov 1970", "1", "5", "40" ], [ "irkutsk obl", "bratsk", "1 feb 1975", "1", "5", "50" ], [ "kemerovo obl", "kemerovo", "25 sep 1970", "1", "10", "88" ], [ "kemerovo obl", "leninsk - kuznetsky", "11 jan 1984", "1", "3", "31" ], [ "kemerovo obl", "novokuznetsk", "1 jan 1978", "1", "4", "53" ], [ "krasnoyarsk krai", "krasnoyarsk", "5 nov 1959", "2", "8", "140" ], [ "novosibirsk obl", "novosibirsk", "11 nov 1957", "4", "14", "322" ], [ "omsk obl", "omsk", "5 nov 1955", "2", "10", "216" ], [ "tomsk obl", "tomsk", "7 nov 1967", "1", "8", "93" ], [ "khakassia", "abakan", "31 dec 1980", "1", "12", "24" ] ], "title": "", "original_id": "76080d8c856d385b508b831b036c12ed" }, { "_id": "cef25b6fb10bdbc085e470fcb042325e", "header": [ "season", "total td 's", "total tc 's", "total stc 's", "strongest storm", "deaths" ], "rows": [ [ "2000 - 01", "16", "4", "1", "paula", "7" ], [ "2001 - 02", "16", "5", "2", "waka", "1" ], [ "2002 - 03", "18", "10", "7", "zoe", "50" ], [ "2003 - 04", "15", "3", "2", "heta", "16" ], [ "2004 - 05", "19", "9", "5", "percy", "2" ], [ "2005 - 06", "15", "5", "3", "wati", "none" ], [ "2006 - 07", "15", "6", "2", "xavier", "4" ], [ "2007 - 08", "16", "4", "3", "daman", "8" ], [ "2008 - 09", "15", "6", "0", "lin", "11" ], [ "2009 - 10", "15", "8", "5", "ului", "12" ], [ "totals", "160", "60", "30", "zoe", "111" ] ], "title": "", "original_id": "6f5355ef4f7c87583b086710fa3a4235" }, { "_id": "2cda6286d12915af159ca336de0762a2", "header": [ "rank", "london borough", "indian population", "pakistani population", "bangladeshi population", "chinese population", "other asian population", "total asian population" ], "rows": [ [ "1", "newham", "42484", "30307", "37262", "3930", "19912", "133895" ], [ "2", "redbridge", "45660", "31051", "16011", "3000", "20781", "116503" ], [ "3", "brent", "58017", "14381", "1749", "3250", "28589", "105986" ], [ "4", "tower hamlets", "6787", "2442", "81377", "8109", "5786", "104501" ], [ "5", "harrow", "63051", "7797", "1378", "2629", "26953", "101808" ], [ "6", "ealing", "48240", "14711", "1786", "4132", "31570", "100439" ], [ "7", "hounslow", "48161", "13676", "2189", "2405", "20826", "87257" ], [ "8", "hillingdon", "36795", "9200", "2639", "2889", "17730", "69253" ], [ "9", "haringey", "36795", "9200", "2639", "2889", "17730", "69253" ], [ "10", "barnet", "27920", "5344", "2215", "8259", "22180", "65918" ], [ "11", "croydon", "24660", "10865", "2570", "3925", "17607", "59627" ], [ "12", "waltham forest", "9134", "26347", "4632", "2579", "11697", "54389" ], [ "13", "merton", "8106", "7337", "2216", "2618", "15866", "36143" ], [ "14", "camden", "6083", "1489", "12503", "6493", "8878", "35446" ], [ "15", "enfield", "11648", "2594", "5599", "2588", "12464", "34893" ], [ "16", "wandsworth", "8642", "9718", "1493", "3715", "9770", "33338" ], [ "17", "westminster", "7213", "2328", "6299", "5917", "10105", "31862" ], [ "18", "greenwich", "7836", "2594", "1645", "5061", "12758", "29894" ], [ "19", "barking and dagenham", "7436", "8007", "7701", "1315", "5135", "29594" ] ], "title": "", "original_id": "f6e61e13e33d853cb131b074e301f10f" }, { "_id": "e006f9d43c7be8f04cfc093bfa87da54", "header": [ "engine type", "scenario", "sfc in lb / (lbf h)", "sfc in g / (kn s)", "specific impulse (s)", "effective exhaust velocity (m / s)" ], "rows": [ [ "nk - 33 rocket engine", "vacuum", "10.9", "309.0", "331", "3240" ], [ "ssme rocket engine", "space shuttle vacuum", "7.95", "225.0", "453", "4423" ], [ "ramjet", "mach 1", "4.5", "127.0", "800", "7877" ], [ "j - 58 turbojet", "sr - 71 at mach 3.2 (wet)", "1.9", "53.8", "1900", "18587" ], [ "rolls - royce / snecma olympus 593", "concorde mach 2 cruise (dry)", "1.195", "33.8", "3012", "29553" ], [ "cf6 - 80c2b1f turbofan", "boeing 747 - 400 cruise", "0.605", "17.1", "5950", "58400" ] ], "title": "", "original_id": "0fe1979e0aa6842d112d19e66e7d8659" }, { "_id": "40749e64ad5fc42663e3f01ad95cbb88", "header": [ "Category", "BMI (kg/m2)", "BMI (kg/m2)", "BMI Prime", "BMI Prime" ], "rows": [ [ "-", "from", "to", "from", "to" ], [ "Very severely underweight", "-", "15", "-", "0.60" ], [ "Severely underweight", "15", "16", "0.60", "0.64" ], [ "Underweight", "16", "18.5", "0.64", "0.74" ], [ "Normal (healthy weight)", "18.5", "25", "0.74", "1.0" ], [ "Overweight", "25", "30", "1.0", "1.2" ], [ "Obese Class I (Moderately obese)", "30", "35", "1.2", "1.4" ], [ "Obese Class II (Severely obese)", "35", "40", "1.4", "1.6" ], [ "Obese Class III (Very severely obese)", "40", "45", "1.6", "1.8" ], [ "Obese Class IV (Morbidly Obese)", "45", "50", "1.8", "2" ], [ "Obese Class V (Super Obese)", "50", "60", "2", "2.4" ], [ "Obese Class VI (Hyper Obese)", "60", "-", "2.4", "-" ] ], "title": "", "original_id": "a96ef1252695680c7ca26e0deceb1ea5" }, { "_id": "dbafbacfff6dc95cf5996c2138b648bc", "header": [ "-", "2017", "2016", "2015", "2014", "2013" ], "rows": [ [ "Applications", "41,000", "42,335", "39,670", "37,280", "33,825" ], [ "Offer Rate (%)", "89.7", "86.4", "90.8", "88.6", "86.8" ], [ "Enrols", "6,065", "5,960", "5,810", "5,820", "5,505" ], [ "Yield (%)", "16.5", "16.3", "16.1", "17.6", "18.7" ], [ "Applicant/Enrolled Ratio", "6.76", "7.10", "6.83", "6.41", "6.14" ], [ "Average Entry Tariff", "n/a", "176", "471", "466", "463" ] ], "title": "", "original_id": "63b64c9a76e1cac75d0aa6380a6f5676" }, { "_id": "2a62f34bf46011699af686f8bd252ef8", "header": [ "year", "design", "issue", "artist", "mintage", "issue price" ], "rows": [ [ "2003", "niagara falls", "hologram", "gary corcoran", "29967", "79.95" ], [ "2003", "rocky mountains", "colorized", "josé osio", "28793", "69.95" ], [ "2004", "iceberg", "hologram", "josé osio", "24879", "69.95" ], [ "2004", "northern lights", "double image hologram", "gary corcoran", "34135", "79.95" ], [ "2004", "hopewell rocks", "selectively gold plated", "josé osio", "16918", "69.95" ], [ "2005", "diamonds", "double image hologram", "josé osio", "35000", "69.95" ] ], "title": "", "original_id": "01a470ad358cd77b8f7c3bce8f34e501" }, { "_id": "7edfa802c7412c5491add2ddb4ed7def", "header": [ "parties and voter communities", "% 2006", "seats 2006", "% 2001", "seats 2001" ], "rows": [ [ "spd", "38.9", "11.0", "39.0", "12.0" ], [ "cdu", "33.2", "10.0", "33.7", "11.0" ], [ "bvw", "21.2", "6.0", "20.5", "6.0" ], [ "fdp", "6.7", "2.0", "6.8", "2.0" ], [ "total", "100.0", "29.0", "100.0", "31.0" ], [ "voter turnout in %", "51.5", "51.5", "57.1", "57.1" ] ], "title": "", "original_id": "ca4c07d6f3394bb8c1956367b21d84fd" }, { "_id": "f14895e558857bfee888fee23818b555", "header": [ "country with flag", "area (km square)", "population (1 july 2005 est)", "population density (per km square)", "capital" ], "rows": [ [ "cuba", "110860", "11346670", "102.4", "havana" ], [ "cayman islands (uk)", "264", "54878", "207.9", "george town" ], [ "dominican republic", "48730", "8950034", "183.7", "santo domingo" ], [ "haiti", "27750", "8121622", "292.7", "port - au - prince" ], [ "jamaica", "10991", "2731832", "248.6", "kingston" ], [ "puerto rico (usa)", "9104", "3916632", "430.2", "san juan" ] ], "title": "", "original_id": "5c7122c5e930420e97932e966e52ae05" }, { "_id": "4df81ddd1ccbdf78470bed84b58cb24a", "header": [ "region / country", "1985 - 1990", "1990 - 1995", "1995 - 2000", "2000 - 2005" ], "rows": [ [ "asia", "3.78", "3.09", "2.88", "2.61" ], [ "south - east asia", "4.11", "3.99", "3.84", "3.4" ], [ "east asia", "4.08", "3.08", "2.82", "2.52" ], [ "china", "5.04", "3.77", "3.52", "3.08" ], [ "europe", "0.78", "0.37", "0.14", "0.13" ], [ "north america", "1.24", "0.57", "1.51", "1.37" ], [ "oceania", "1.52", "1.52", "1.46", "1.4" ] ], "title": "", "original_id": "2e281278e6f6436cc9b74a38eda3965c" }, { "_id": "c75bbf5c04c7d60c2fa9fd341e8b28d6", "header": [ "position", "driver", "points", "starts", "wins", "top 5s", "top 10s", "winnings" ], "rows": [ [ "1", "andrew ranger", "2190", "13", "6", "8", "13", "87100" ], [ "2", "d j kennington", "2023", "13", "2", "9", "10", "72275" ], [ "3", "ron beauchamp , jr", "2023", "13", "0", "8", "11", "64000" ], [ "4", "scott steckly", "1953", "13", "2", "9", "9", "69000" ], [ "5", "kerry micks", "1942", "13", "0", "5", "11", "44850" ], [ "6", "don thomson , jr", "1841", "13", "1", "5", "9", "39950" ], [ "7", "jason hathaway", "1819", "13", "0", "2", "10", "37830" ], [ "8", "anthony simone", "1800", "13", "0", "4", "8", "38700" ], [ "9", "mark dilley", "1767", "13", "0", "4", "6", "39000" ] ], "title": "", "original_id": "68580e7287847d1557dfa65443087149" }, { "_id": "7d5e27aca8744b3b394f49c8b68c79e1", "header": [ "Line", "Terminals (District)", "Terminals (District)", "Commencement", "Newest Extension", "Length km", "Stations" ], "rows": [ [ "1", "Weijianian (Jinniu)", "Science City (Shuangliu)", "2010", "2018", "40.99", "35" ], [ "1", "Weijianian (Jinniu)", "Wugensong (Shuangliu)", "2010", "2018", "40.99", "35" ], [ "2", "Xipu (Pidu)", "Longquanyi (Longquanyi)", "2012", "2014", "42.32", "32" ], [ "3", "Chengdu Medical College (Xindu)", "Shuangliu West Station (Shuangliu)", "2016", "2018", "49.89", "37" ], [ "4", "Wansheng (Wenjiang)", "Xihe (Longquanyi)", "2015", "2017", "43.28", "30" ], [ "7 loop line", "Cuijiadian (Chenghua)", "Cuijiadian (Chenghua)", "2017", "-", "38.61", "31" ], [ "10", "Taipingyuan (Wuhou)", "Shuangliu International Airport Terminal 2 (Shuangliu)", "2017", "-", "10.90", "6" ], [ "Total", "Total", "Total", "Total", "Total", "226", "171" ] ], "title": "", "original_id": "329fcbb5f4b5e6cc960687daf8bb883d" }, { "_id": "66cfc957c8d6548cc8cd9f30cbebd028", "header": [ "country", "2002", "2003", "2004", "2005", "2006", "2007", "2008", "2009", "2010", "2011" ], "rows": [ [ "chile", "4580", "4860", "5410", "5320", "5560", "5700", "5330", "5320", "5420", "5420" ], [ "peru", "843", "850", "1040", "1090", "1049", "1200", "1270", "1260", "1250", "1220" ], [ "united states", "1140", "1120", "1160", "1150", "1200", "1190", "1310", "1190", "1110", "1120" ], [ "china", "585", "565", "620", "640", "890", "920", "950", "960", "1190", "1190" ], [ "australia", "873", "870", "854", "930", "859", "860", "886", "900", "870", "940" ], [ "indonesia", "1160", "1170", "840", "1050", "816", "780", "651", "950", "872", "625" ], [ "russia", "695", "700", "675", "675", "725", "730", "750", "750", "703", "710" ], [ "canada", "600", "580", "546", "580", "607", "585", "607", "520", "525", "550" ], [ "zambia", "330", "330", "427", "450", "476", "530", "546", "655", "690", "715" ], [ "poland", "503", "500", "531", "530", "512", "470", "430", "440", "425", "425" ], [ "kazakhstan", "490", "480", "461", "400", "457", "460", "420", "410", "380", "360" ], [ "mexico", "330", "330", "406", "420", "338", "400", "247", "250", "260", "365" ], [ "other countries", "1500", "1500", "1610", "1750", "1835", "1800", "2030", "2180", "1900", "2000" ], [ "world", "13600", "13900", "14600", "14900", "15100", "15600", "15400", "15800", "15900", "16100" ] ], "title": "", "original_id": "79d5639224296a573383632068fd219e" }, { "_id": "cb3d0bdfeab978aed425255e55ae5560", "header": [ "name of county", "county seat", "area (km square)", "population", "population density", "towns / villages" ], "rows": [ [ "bács - kiskun", "kecskemét", "8445", "541584", "64", "119" ], [ "baranya", "pécs", "4430", "402260", "91", "301" ], [ "békés", "békéscsaba", "5631", "392845", "70", "75" ], [ "borsod - abaúj - zemplén", "miskolc", "7247", "739143", "102", "355" ], [ "csongrád", "szeged", "4263", "425785", "100", "60" ], [ "fejér", "székesfehérvár", "4359", "428579", "98", "108" ], [ "győr - moson - sopron", "győr", "4208", "440138", "105", "182" ], [ "hajdú - bihar", "debrecen", "6211", "550265", "89", "82" ], [ "heves", "eger", "3637", "323769", "89", "119" ], [ "jász - nagykun - szolnok", "szolnok", "5582", "413174", "74", "75" ], [ "komárom - esztergom", "tatabánya", "2265", "315886", "139", "76" ], [ "nógrád", "salgótarján", "2546", "218218", "86", "129" ], [ "pest", "budapest", "6393", "1124395", "176", "186" ], [ "somogy", "kaposvár", "6036", "334065", "55", "244" ], [ "szabolcs - szatmár - bereg", "nyíregyháza", "5936", "583564", "98", "228" ], [ "tolna", "szekszárd", "3703", "247287", "67", "108" ], [ "vas", "szombathely", "3336", "266342", "80", "216" ], [ "veszprém", "veszprém", "4493", "368519", "82", "217" ] ], "title": "", "original_id": "74b748c6679b4c2e6349f304ff08ff01" }, { "_id": "9488b88bc6b2457dcce98cc7ce063106", "header": [ "Model", "Launch", "Code name", "Fab (nm)", "Bus interface", "Memory (MiB)", "Core clock (MHz)", "Memory clock (MHz)", "Config core1", "Fillrate\nMOperations/s", "Fillrate\nMPixels/s", "Fillrate\nMTextels/s", "Fillrate\nMVertices/s", "Memory\nBandwidth (GB/s)", "Memory\nBus type", "Memory\nBus width (bit)", "DirectX support" ], "rows": [ [ "Voodoo Graphics", "October 1, 1996", "SST1", "500", "PCI", "2, 4", "50", "50", "1:0:1:1", "50", "50", "50", "0", "0.8", "EDO", "128", "3.0" ], [ "Voodoo Rush", "April 1997", "SST96", "500", "AGP 2x, PCI", "2, 4", "50", "50", "1:0:1:1", "50", "50", "50", "0", "0.4", "EDO", "64", "3.0" ], [ "Voodoo2", "March 1, 1998", "SST96", "350", "PCI", "8, 12", "90", "90", "1:0:2:1", "90", "90", "180", "0", "0.72", "EDO", "64", "3.0" ], [ "Voodoo Banshee", "June 22, 1998", "Banshee", "350", "AGP 2x, PCI", "8, 16", "100", "100", "1:0:1:1", "100", "100", "100", "0", "1.6", "SDR", "128", "6.0" ], [ "Velocity 100", "July 26, 1999", "Avenger", "250", "AGP 2x", "8", "143", "143", "1:0:2:1", "143", "143", "286", "0", "2.288", "SDR", "128", "6.0" ], [ "Velocity 200", "July 26, 1999", "Avenger", "250", "AGP 2x", "12", "143", "143", "1:0:2:1", "143", "143", "286", "0", "2.288", "SDR", "128", "6.0" ], [ "Voodoo3 1000", "March 1999", "Avenger", "250", "AGP 2x, PCI", "8, 16", "125", "125", "1:0:2:1", "125", "125", "250", "0", "2.0", "SDR", "128", "6.0" ], [ "Voodoo3 2000", "April 3, 1999", "Avenger", "250", "AGP 2x, PCI", "16", "143", "143", "1:0:2:1", "143", "143", "286", "0", "2.288", "SDR", "128", "6.0" ], [ "Voodoo3 3000", "April 3, 1999", "Avenger", "250", "AGP 2x, PCI", "16", "166", "166", "1:0:2:1", "166", "166", "333", "0", "2.66", "SDR", "128", "6.0" ], [ "Voodoo3 3500 TV", "June 1999", "Avenger", "250", "AGP 2x, PCI", "16", "183", "183", "1:0:2:1", "183", "183", "366", "0", "2.928", "SDR", "128", "6.0" ], [ "Voodoo4 4200", "Never Released", "VSA-100", "250", "AGP 4x, PCI", "32", "183", "183", "2:0:2:2", "366", "366", "366", "0", "1.464", "SDR", "64", "6.0" ], [ "Voodoo4 4500", "October 13, 2000", "VSA-100", "250", "AGP 4x, PCI", "32", "166", "166", "2:0:2:2", "332", "332", "332", "0", "2.656", "SDR", "128", "6.0" ], [ "Voodoo4 4800", "Never Released", "VSA-100", "250", "AGP 4x, PCI", "32", "200", "200", "2:0:2:2", "400", "400", "400", "0", "3.2", "SDR", "128", "6.0" ], [ "Voodoo5 5000", "Never Released", "VSA-100 x2", "250", "AGP 4x, PCI", "32", "166", "166", "2:0:2:2 x2", "664", "664", "664", "0", "2.656", "SDR", "128", "6.0" ], [ "Voodoo5 5500", "June 22, 2000", "VSA-100 x2", "250", "AGP 4x, PCI", "64", "166", "166", "2:0:2:2 x2", "664", "664", "664", "0", "2.656", "SDR", "128", "6.0" ], [ "Voodoo5 6000", "Never Released", "VSA-100 x4", "250", "AGP 4x, PCI", "128", "166", "166", "2:0:2:2 x4", "1328", "1328", "1328", "0", "5.312", "SDR", "256", "6.0" ], [ "Spectre 1000", "Never Released", "Rampage", "180", "AGP 4x", "64", "200", "400", "4:0:4:4", "800", "800", "800", "0", "6.4", "DDR", "128", "?" ], [ "Spectre 2000", "Never Released", "Rampage + Sage", "180", "AGP 4x", "64", "200", "400", "4:0:4:4", "800", "800", "800", "0", "6.4", "DDR", "128", "?" ], [ "Spectre 3000", "Never Released", "Rampage x2 + Sage", "180", "AGP 4x", "128", "200", "400", "4:0:4:4 x2", "800", "800", "800", "0", "12.8", "DDR", "256", "?" ] ], "title": "", "original_id": "a7ebb00ab92abd05868389fd920ebf3d" }, { "_id": "881b0e0de5d21ef2b60c2efa872981cf", "header": [ "tournament", "games played", "points per game", "rebounds per game", "assists per game" ], "rows": [ [ "2003 eurobasket", "6", "6.8", "5.3", "0.7" ], [ "2005 eurobasket", "7", "7.6", "7.1", "0.6" ], [ "2006 fiba world championship", "9", "9.7", "6.7", "0.6" ], [ "2007 eurobasket", "7", "8.9", "3.7", "0.6" ], [ "2009 eurobasket", "8", "6.5", "2.9", "1.1" ], [ "2010 fiba world championship", "4", "4.5", "4.8", "1.5" ], [ "2011 eurobasket", "11", "2.6", "3.4", "0.8" ], [ "2012 olympics", "6", "4.5", "2.8", "0.5" ] ], "title": "", "original_id": "101eba078641d71762787f977234023b" }, { "_id": "c5a1d4a8540b4c4623e155a8bb314708", "header": [ "order", "couple", "karen", "nicky", "jason", "ruthie", "robin", "total", "scoreboard", "song", "public vote %", "result" ], "rows": [ [ "1", "gareth & maria", "4.5", "4.0", "3.5", "3.5", "4.0", "19 , 5", "3rd", "wake me up when september ends - green day", "6.81%", "safe" ], [ "2", "linda & daniel", "3.5", "3.0", "3.0", "4.0", "3.0", "16.5", "5th", "candyman - christina aguilera", "9.09%", "safe" ], [ "3", "samantha & pavel", "3.5", "3.0", "3.0", "3.5", "3.0", "16.0", "7th", "you can't hurry love - the supremes", "3.30%", "eliminated" ], [ "4", "chris & frankie", "5.0", "5.0", "4.0", "4.5", "5.0", "23.5", "1st", "rule the world - take that", "19.20%", "safe" ], [ "5", "aggie & sergey", "2.5", "2.0", "2.0", "3.5", "2.5", "12.5", "10th", "total eclipse of the heart - bonnie tyler", "5.00%", "safe" ], [ "6", "steve & susie", "3.0", "3.5", "2.0", "3.0", "3.0", "14.5", "9th", "mony mony - billy idol", "4.68%", "bottom two" ], [ "7", "greg & kristina", "3.5", "3.5", "2.5", "3.0", "3.0", "15.5", "8th", "licence to kill - gladys knight", "12.90%", "safe" ], [ "8", "zaraah & fred", "4.0", "4.5", "3.0", "3.5", "3.5", "18.5", "4th", "take a chance on me - abba", "7.88%", "safe" ] ], "title": "", "original_id": "9bbb4e79fd68658cd40f7088028db149" }, { "_id": "4eba098c19f921719dd2f0092b3798e2", "header": [ "department", "micro (10ha)", "small (100ha)", "medium (500ha)", "big (>500ha)", "total" ], "rows": [ [ "chuquisaca", "1653", "11370", "4261", "3884", "21168" ], [ "cochabamba", "1938", "22225", "27403", "35968", "81925" ], [ "la paz", "1703", "21047", "6052", "7192", "35994" ], [ "oruro", "940", "3638", "440", "9021", "14039" ], [ "potosi", "3240", "10146", "2254", "600", "16240" ], [ "santa cruz", "269", "5456", "8434", "1080", "15239" ], [ "tarija", "785", "12755", "17101", "5710", "36351" ] ], "title": "", "original_id": "370718c26741124d19f2a355b0a4bf6d" }, { "_id": "9fd257ea7657f4bb6a2f60bf5f42d255", "header": [ "component 1", "bp comp 1 (˚c)", "component 2", "bp comp 2 (˚c)", "bp azeo (˚c)", "% wt comp 1", "% wt comp 2" ], "rows": [ [ "acetaldehyde", "21.0", "diethyl ether", "34.6", "20.5", "76.0", "24.0" ], [ "acetaldehyde", "21.0", "n - butane", "- 0.5", "- 7.0", "16.0", "84.0" ], [ "acetamide", "222.0", "benzaldehyde", "179.5", "178.6", "6.5", "93.5" ], [ "acetamide", "222.0", "nitrobenzene", "210.9", "202.0", "24.0", "76.0" ], [ "acetamide", "222.0", "o - xylene", "144.1", "142.6", "11.0", "89.0" ], [ "acetonitrile", "82.0", "ethyl acetate", "77.15", "74.8", "23.0", "77.0" ], [ "acetonitrile", "82.0", "toluene", "110.6", "81.1", "25.0", "75.0" ], [ "acetylene", "- 86.6", "ethane", "- 88.3", "- 94.5", "40.7", "59.3" ], [ "aniline", "184.4", "o - cresol", "191.5", "191.3", "8.0", "92.0" ], [ "carbon disulfide", "46.2", "diethyl ether", "34.6", "34.4", "1.0", "99.0" ], [ "carbon disulfide", "46.2", "1 , 1 - dichloroethane", "57.2", "46.0", "94.0", "6.0" ], [ "carbon disulfide", "46.2", "methyl ethyl ketone", "79.6", "45.9", "84.7", "15.3" ], [ "carbon disulfide", "46.2", "ethyl acetate", "77.1", "46.1", "97.0", "3.0" ], [ "carbon disulfide", "46.2", "methyl acetate", "57.0", "40.2", "73.0", "27.0" ], [ "chloroform", "61.2", "methyl ethyl ketone", "79.6", "79.9", "17.0", "83.0" ], [ "chloroform", "61.2", "n - hexane", "68.7", "60.0", "72.0", "28.0" ], [ "carbon tetrachloride", "76.8", "methyl ethyl ketone", "79.9", "73.8", "71.0", "29.0" ], [ "carbon tetrachloride", "76.8", "ethylene dichloride", "84.0", "75.3", "78.0", "22.0" ], [ "carbon tetrachloride", "76.8", "ethyl acetate", "77.1", "74.8", "57.0", "43.0" ], [ "cyclohexane", "81.4", "ethyl acetate", "77.15", "72.8", "46.0", "54.0" ], [ "cyclohexane", "81.4", "ethyl nitrate", "88.7", "74.5", "64.0", "36.0" ], [ "diethyl ether", "34.6", "methyl formate", "31.50", "28.2", "44.0", "56.0" ], [ "diethyl ether", "34.6", "methylene chloride", "40", "40.8", "30.0", "70.0" ], [ "nitromethane", "101.0", "toluene", "110.8", "96.5", "55.0", "45.0" ], [ "tetrahydrofuran", "65.6", "chloroform", "61.2", "72.5", "34.5", "65.5" ], [ "tetrahydrofuran", "65.6", "n - hexane", "69", "63.0", "46.5", "53.5" ], [ "toluene", "110.63", "pyridine", "115.3", "110.2", "78.0", "22.0" ], [ "propylene glycol", "188.2", "aniline", "184.4", "179.5", "43.0", "57.0" ], [ "propylene glycol", "188.2", "o - xylene", "144.4", "135.8", "10.0", "90.0" ], [ "propylene glycol", "188.2", "toluene", "110.6", "110.5", "1.5", "98.5" ] ], "title": "", "original_id": "d87ba78f49cfae062a5db8fff907ce69" }, { "_id": "7d6ab87f7b560a488df3e434ed1ad453", "header": [ "year", "us rank", "total s ton", "domestic s ton", "foreign total s ton", "foreign imports s ton", "foreign exports s ton" ], "rows": [ [ "2006", "102", "2926536", "2306192", "620344", "464774", "155570" ], [ "2005", "94", "3527469", "2629553", "897916", "430396", "467520" ], [ "2004", "101", "3085753", "2323089", "762664", "284347", "478317" ], [ "2003", "96", "3178633", "2494261", "684372", "218233", "466139" ], [ "2002", "102", "2983137", "2318653", "664484", "251203", "413281" ], [ "2001", "108", "2861134", "2157496", "703638", "225281", "478357" ], [ "2000", "103", "3157247", "2416514", "740733", "382240", "358493" ] ], "title": "", "original_id": "beb4a172c71e511020b2fff91acf7b15" }, { "_id": "fd738753d4d08931ae0f1b666358b622", "header": [ "year", "number of tropical storms", "number of hurricanes", "number of major hurricanes", "deaths", "strongest storm" ], "rows": [ [ "1870", "11", "10", "2", "2052", "four" ], [ "1871", "8", "6", "2", "30", "three and four" ], [ "1872", "5", "4", "0", "unknown", "two" ], [ "1873", "5", "3", "2", "626", "five" ], [ "1874", "7", "4", "0", "unknown", "seven" ], [ "1875", "6", "5", "1", "800", "three" ], [ "1876", "5", "4", "2", "19", "san felipe" ], [ "1877", "8", "3", "1", "34", "four" ], [ "1878", "12", "10", "1", "108", "seven" ] ], "title": "", "original_id": "12d1926f8fb751cc7834021ab98bbfa6" }, { "_id": "819500e09ba7223f9d817dbb97d33b54", "header": [ "Particulars", "Total", "Male", "Female" ], "rows": [ [ "Total No. of Houses", "187", "-", "-" ], [ "Population", "892", "448", "444" ], [ "Child (0-6)", "133", "69", "64" ], [ "Schedule Caste", "713", "355", "358" ], [ "Schedule Tribe", "0", "0", "0" ], [ "Literacy", "64.30%", "67.28%", "61.32%" ], [ "Total Workers", "336", "271", "65" ], [ "Main Worker", "254", "0", "0" ], [ "Marginal Worker", "82", "62", "20" ] ], "title": "", "original_id": "9aa29ba13e3118d62ac13f0a06b99b6d" }, { "_id": "66f8db5518d89abd63e075e701369b95", "header": [ "Draw", "Artist", "Song", "Jury", "Televote", "Total", "Place" ], "rows": [ [ "1", "Kasia Nova", "\\The Devil\\\"\"", "0", "1", "1", "11" ], [ "2", "Edi Ann", "\\Lovin’U\\\"\"", "7", "5", "12", "4" ], [ "3", "Izabela Kopeć", "\\You've got my love\\\"\"", "4", "6", "10", "6" ], [ "4", "Starnawski & Urban Noiz", "\\It's not a game\\\"\"", "5", "0", "5", "10" ], [ "5", "Queens", "\\I say my body\\\"\"", "0", "0", "0", "12" ], [ "6", "Isis Gee", "\\For life\\\"\"", "12", "12", "24", "1" ], [ "7", "Man Meadow", "\\Viva la Musica\\\"\"", "2", "10", "12", "3" ], [ "8", "Afromental", "\\Thing we’ve got\\\"\"", "3", "4", "7", "9" ], [ "9", "Plastic", "\\Do something\\\"\"", "10", "2", "12", "5" ], [ "10", "Sandra Oxenryd", "\\Superhero\\\"\"", "6", "3", "9", "8" ], [ "11", "Natasza Urbańska", "\\Blow Over\\\"\"", "8", "7", "15", "2" ], [ "12", "Margo", "\\Dlatego walcz\\\"\"", "1", "8", "9", "7" ] ], "title": "", "original_id": "cb8ace78b045bc7add8f9981c902af8c" }, { "_id": "7b868c10edb7257252c08085d00a36cd", "header": [ "year", "marriages between men", "marriages between women", "same - sex marriages", "total marriages", "% same - sex marriages" ], "rows": [ [ "2005 (since july)", "923", "352", "1275", "120728", "1.06" ], [ "2006", "3190", "1384", "4574", "211818", "2.16" ], [ "2007", "2180", "1070", "3250", "203697", "1.6" ], [ "2008", "2299", "1250", "3549", "196613", "1.81" ], [ "2009", "2212", "1200", "3412", "175952", "1.94" ], [ "2010", "2216", "1367", "3583", "170815", "2.1" ], [ "2011", "2293", "1587", "3880", "163085", "2.38" ] ], "title": "", "original_id": "c1bb893ef3668efd4e9d6a33f283ba01" }, { "_id": "20ac7fc8cc0d3160d3f4d881334e6412", "header": [ "rank", "council area", "speakers", "population", "percentage (%)" ], "rows": [ [ "1", "na h - eileanan siar", "15811", "26502", "59.7" ], [ "2", "highland", "12673", "208914", "6.1" ], [ "3", "city of glasgow", "5739", "577869", "1.0" ], [ "4", "argyll and bute", "4145", "91306", "4.5" ], [ "5", "city of edinburgh", "3120", "448624", "0.7" ], [ "6", "perth and kinross", "1434", "134949", "1.1" ], [ "7", "city of aberdeen", "1412", "212125", "0.7" ], [ "8", "fife", "1106", "349429", "0.3" ], [ "9", "south lanarkshire", "1079", "302216", "0.4" ], [ "10", "north lanarkshire", "1021", "321067", "0.3" ], [ "11", "renfrewshire", "988", "172867", "0.6" ], [ "12", "stirling", "939", "86212", "1.1" ], [ "13", "east dunbartonshire", "895", "108243", "0.8" ], [ "14", "aberdeenshire", "871", "226871", "0.4" ], [ "15", "city of dundee", "645", "145663", "0.4" ], [ "16", "east renfrewshire", "590", "89311", "0.7" ], [ "17", "west lothian", "571", "158714", "0.4" ], [ "18", "north ayrshire", "557", "135817", "0.4" ], [ "19", "falkirk", "529", "145191", "0.4" ], [ "20", "angus", "485", "108400", "0.4" ], [ "21", "moray", "459", "86940", "0.5" ], [ "22", "dumfries and galloway", "448", "147765", "0.3" ], [ "23", "west dunbartonshire", "437", "93378", "0.5" ], [ "24", "south ayrshire", "417", "112097", "0.4" ], [ "25", "inverclyde", "409", "84203", "0.5" ], [ "26", "scottish borders", "376", "106764", "0.4" ], [ "27", "east ayrshire", "368", "120235", "0.3" ], [ "28", "east lothian", "341", "90088", "0.4" ], [ "29", "clackmannanshire", "301", "48077", "0.6" ], [ "30", "midlothian", "244", "80941", "0.3" ], [ "31", "shetland", "97", "21988", "0.4" ], [ "32", "orkney", "92", "19245", "0.5" ] ], "title": "", "original_id": "c4a6de9e58baabab25d41f6e0767c85a" }, { "_id": "b0855f66516f9ba5bc8d1adcccd4c2e3", "header": [ "conflicts prior to israel 's independence", "military deaths", "civilian deaths", "total deaths", "military and / or civilian wounded", "total casualties" ], "rows": [ [ "battle of tel hai", "6", "0", "6", "0", "6" ], [ "1920 nebi musa riots", "0", "5", "5", "216", "221" ], [ "1921 jaffa riots", "0", "47", "47", "146", "193" ], [ "1929 hebron - safed riots", "0", "133", "133", "339", "472" ], [ "1933 palestine riots", "0", "0", "0", "unknown", "unknown" ], [ "1936 - 1939 arab revolt", "0", "415 +", "415", "1200 +", "1615" ], [ "jewish insurgency in mandatory palestine", "least 34 members of palmach", "unknown", "unknown", "unknown", "unknown" ], [ "1947 - 48 civil war", "895", "408", "1303 +", "2000", "3303" ] ], "title": "", "original_id": "91e26dae5bd760948530cf4e7bb8624d" }, { "_id": "b61c0f4b6ee8acba164e320004ffce0f", "header": [ "Rank", "Nation", "Gold", "Silver", "Bronze", "Total" ], "rows": [ [ "1", "Japan", "18", "8", "8", "34" ], [ "2", "India", "4", "5", "6", "15" ], [ "3", "Philippines", "4", "3", "3", "10" ], [ "4", "Taiwan", "2", "6", "7", "15" ], [ "5", "South Korea", "2", "3", "1", "6" ], [ "6", "Thailand", "2", "2", "0", "4" ], [ "7", "Pakistan", "2", "1", "0", "3" ], [ "8", "Iran", "2", "0", "2", "4" ], [ "9", "Israel", "1", "0", "1", "2" ], [ "10", "Singapore", "0", "4", "4", "8" ], [ "11", "Malaysia", "0", "3", "1", "4" ], [ "12", "Iraq", "0", "2", "0", "2" ], [ "13", "Kampuchea", "0", "0", "2", "2" ], [ "14", "Nepal", "0", "0", "1", "1" ] ], "title": "", "original_id": "f2be4389eaadcc68f94fcf9ca3e0fc23" }, { "_id": "ea26b0f0dbe36961851a2a3205cbda28", "header": [ "position", "team", "points", "played", "drawn", "lost", "against", "difference" ], "rows": [ [ "1", "palmeiras", "27", "16", "3", "1", "20", "29" ], [ "2", "vasco da gama", "17", "16", "3", "6", "22", "2" ], [ "3", "botafogo", "17", "16", "3", "6", "31", "0" ], [ "4", "flamengo", "17", "16", "5", "5", "21", "- 2" ], [ "5", "portuguesa", "17", "16", "7", "4", "24", "- 4" ], [ "6", "são paulo", "16", "16", "2", "7", "33", "- 1" ], [ "7", "corinthians", "15", "16", "7", "5", "27", "2" ], [ "8", "fluminense", "10", "16", "4", "9", "27", "- 8" ], [ "9", "santos", "8", "9", "2", "4", "24", "- 4" ], [ "10", "america - rj", "2", "9", "2", "7", "22", "- 14" ] ], "title": "", "original_id": "855b3895f84f656f5bed75b55c0c416a" }, { "_id": "5dd9819006cbc130d81fd02f1454b40e", "header": [ "draw", "artist", "song", "first vote", "place" ], "rows": [ [ "1", "deja vu", "im a part of you", "1485", "7" ], [ "2", "kristīna zaharova feat julian", "until you find a friend", "862", "9" ], [ "3", "sabīne berezina", "if i only knew", "5142", "5" ], [ "4", "pirates of the sea", "wolves of the sea", "16818", "1" ], [ "5", "peter garden & juris vizbulis", "memory lane", "1932", "6" ], [ "6", "funky drivers", "summertime", "1245", "8" ], [ "7", "triānas parks", "bye bye", "5656", "4" ], [ "8", "elizabete zagorska", "take me home", "599", "10" ], [ "9", "aisha", "you really got me going", "8021", "3" ], [ "10", "andris ērglis", "broken lullaby", "10751", "2" ] ], "title": "", "original_id": "005f2f9b83c9863a265221782924df39" }, { "_id": "5f751113c6a3d36ca6a62ea2d3798ed4", "header": [ "Crime", "Reported offenses", "Killeen rate", "Texas rate", "U.S. rate" ], "rows": [ [ "Murder", "10", "8.6", "5.6", "5.6" ], [ "Rape", "66", "56.9", "32.9", "29.4" ], [ "Robbery", "216", "186.4", "155.2", "154.0" ], [ "Aggravated assault", "593", "511.6", "314.4", "281.6" ], [ "Violent crime", "885", "763.5", "508.2", "470.6" ], [ "Burglary", "1,711", "1,476.2", "946.5", "743.4" ], [ "Larceny – theft", "2,877", "2,482.2", "2,688.9", "2,200.1" ], [ "Motor vehicle theft", "169", "145.8", "351.1", "330.5" ], [ "Non-violent crime", "4,757", "4,104.2", "3,986.6", "3,274.0" ] ], "title": "", "original_id": "7e2005500f8d07f6945773c1f893a2ec" }, { "_id": "458a9bece8e540e5b298c9db05c358c2", "header": [ "election", "candidates fielded", "of seats won", "total votes", "% of popular vote", "place" ], "rows": [ [ "1983", "4", "0", "3078", "0.19%", "7th" ], [ "1986", "9", "0", "4660", "0.24%", "5th" ], [ "1991", "42", "0", "12650", "0.86%", "4th" ], [ "1996", "71", "0", "31511", "1.99%", "5th" ], [ "2001", "72", "0", "197231", "12.39%", "3rd" ], [ "2005", "79", "0", "161842", "9.17%", "3rd" ], [ "2009", "85", "0", "134570", "8.21%", "3rd" ], [ "2013", "61", "1", "146607", "8.13%", "3rd" ] ], "title": "", "original_id": "b5662b29ddce625847c130e673373add" }, { "_id": "a236b1b962055764dcad6357e5306169", "header": [ "place", "code", "area (km 2 )", "population", "most spoken language" ], "rows": [ [ "alldays", "90901", "11.75", "385", "northern sotho" ], [ "bahanawa", "90902", "390.17", "19068", "northern sotho" ], [ "bahanawa - ba - kibi", "90903", "163.78", "7763", "northern sotho" ], [ "bochum part 1", "90912", "4.33", "8501", "northern sotho" ], [ "bochum part 2", "90905", "182.33", "15911", "northern sotho" ], [ "dichoeng", "90906", "100000.0", "17347", "northern sotho" ], [ "manthata", "90907", "1335.47", "72175", "northern sotho" ], [ "matlala", "90908", "180.83", "8697", "northern sotho" ], [ "pietersburg", "90909", "1.33", "3818", "northern sotho" ], [ "ramutla", "90910", "7.81", "1", "northern sotho" ], [ "seshego", "90911", "6.0", "1058", "northern sotho" ], [ "remainder of the municipality", "90904", "2198.72", "5539", "northern sotho" ] ], "title": "", "original_id": "04107a8b454ee9c6a334cfcbbbd4d1e5" }, { "_id": "a6240fbab201bfae8ee46e1fa2f0a29f", "header": [ "Club", "Season", "League", "League", "Cup", "Cup", "Continental", "Continental", "Total", "Total" ], "rows": [ [ "Club", "Season", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals" ], [ "River Plate", "1945", "1", "0", "0", "0", "0", "0", "1", "0" ], [ "Huracán (loan)", "1946", "25", "10", "2", "0", "0", "0", "27", "10" ], [ "Huracán (loan)", "Total", "25", "10", "2", "0", "0", "0", "27", "10" ], [ "River Plate", "1947", "30", "27", "0", "0", "2", "1", "32", "28" ], [ "River Plate", "1948", "23", "13", "1", "1", "6", "4", "30", "18" ], [ "River Plate", "1949", "12", "9", "0", "0", "0", "0", "12", "9" ], [ "River Plate", "Total", "66", "49", "1", "1", "8", "5", "75", "55" ], [ "Millonarios", "1949", "14", "16", "0", "0", "0", "0", "14", "16" ], [ "Millonarios", "1950", "29", "23", "2", "1", "0", "0", "31", "24" ], [ "Millonarios", "1951", "34", "32", "4?", "4?", "0", "0", "38?", "36?" ], [ "Millonarios", "1952", "24", "19", "4?", "5?", "0", "0", "28?", "24?" ], [ "Millonarios", "Total", "101", "90", "10", "10", "0", "0", "111", "100" ], [ "Real Madrid", "1953–54", "28", "27", "0", "0", "0", "0", "28", "27" ], [ "Real Madrid", "1954–55", "30", "25", "0", "0", "2", "0", "32", "25" ], [ "Real Madrid", "1955–56", "30", "24", "0", "0", "7", "5", "37", "29" ], [ "Real Madrid", "1956–57", "30", "31", "3", "3", "10", "9", "43", "43" ], [ "Real Madrid", "1957–58", "30", "19", "7", "7", "7", "10", "44", "36" ], [ "Real Madrid", "1958–59", "28", "23", "8", "5", "7", "6", "43", "34" ], [ "Real Madrid", "1959–60", "23", "12", "5", "3", "6", "8", "34", "23" ], [ "Real Madrid", "1960–61", "23", "21", "9", "8", "4", "1", "36", "30" ], [ "Real Madrid", "1961–62", "23", "11", "8", "4", "10", "7", "41", "22" ], [ "Real Madrid", "1962–63", "13", "12", "9", "9", "2", "1", "24", "22" ], [ "Real Madrid", "1963–64", "24", "11", "1", "1", "9", "5", "34", "17" ], [ "Real Madrid", "1964", "30", "50", "0", "0", "0", "0", "30", "50" ], [ "Real Madrid", "Total", "282", "216", "50", "40", "64", "52", "396", "308" ], [ "Espanyol", "1964–65", "24", "7", "3", "2", "0", "0", "27", "9" ], [ "Espanyol", "1965–66", "23", "4", "4", "1", "6", "0", "33", "5" ], [ "Espanyol", "Total", "47", "11", "7", "3", "6", "0", "60", "14" ], [ "Espanyol", "1966", "-10", "-5", "0", "0", "0", "0", "-10", "-5" ], [ "Career totals", "Career totals", "521", "376", "70", "54", "78", "57", "669", "487" ] ], "title": "", "original_id": "ee041adc4eeb177ab2dc721001f5b804" }, { "_id": "1346aea8867ee032e6868f1c7fe154f1", "header": [ "epoch (utc)", "periselene (km)", "aposelene (km)", "eccentricity", "inclination (deg) (to moon equator)", "period (h)" ], "rows": [ [ "november 15 , 2004 , 17:47:12.1", "6700.72", "53215.151", "0.776329", "81.085", "129.247777" ], [ "december 4 , 2004 10:37:47.3", "5454.925", "20713.095", "0.583085", "83.035", "37.304959" ], [ "january 1 , 2005 , 00:00:00.0", "10000.0", "100000.0", "0.99999", "150.0", "100.0" ], [ "january 9 , 2005 , 15:24:55.0", "2751.511", "6941.359", "0.432261", "87.892", "8.409861" ], [ "february 28 , 2005 , 05:18:39.9", "2208.659", "4618.22", "0.352952", "90.063603", "4.970998" ], [ "march 15 , 2005 , 12:00:00.0", "10.0", "100.0", "0.5", "80.0", "10.0" ], [ "april 25 , 2005 , 08:19:05.4", "2283.738", "4523.111", "0.328988", "90.141407", "4.949137" ], [ "may 16 , 2005 , 09:08:52.9", "2291.25", "4515.857", "0.326807", "89.734929", "4.949919" ], [ "june 20 , 2005 , 10:21:37.1", "2256.09", "4549.196", "0.33696", "90.232619", "4.947432" ] ], "title": "", "original_id": "0bd23a6e9608ac496e063d9e2bde3ced" }, { "_id": "80cb88ce6eb88b7ae9ca955407200cef", "header": [ "member countries", "population", "area (km square)", "gdp (billion us)", "gdp per capita (us)" ], "rows": [ [ "belgium", "9052707", "30528", "58.316", "46878" ], [ "france", "44788852", "674843", "312.966", "40690" ], [ "west germany", "54292038", "248717", "400.554", "41168" ], [ "italy", "49476000", "301336", "265.192", "30116" ], [ "luxembourg", "310291", "2586", "2.938", "113533" ], [ "luxembourg", "100000000", "2586", "2.938", "113533" ], [ "netherlands", "11186847", "41526", "83.351", "50355" ], [ "netherlands", "11186847", "41526", "83.351", "1000" ], [ "ec6 (1958)", "169106736", "1299536", "1123.317", "6643" ] ], "title": "", "original_id": "5bc2b242a93f58ca6831351bf7977275" }, { "_id": "11bb2665fc7ee0bb75fc38df8ea10080", "header": [ "Works No.", "CSAR No.", "SAR No.", "Tender Works No.", "Tender No.", "Class" ], "rows": [ [ "19195", "1003", "767", "D1540/1", "N1", "10CR" ], [ "19196", "1004", "768", "D1540/2", "N2", "10CR" ], [ "19197", "1005", "769", "D1540/3", "N3", "ABC" ], [ "19198", "1006", "770", "D1540/4", "N4", "10CR" ], [ "19199", "1007", "771", "D1540/5", "N5", "10CR" ], [ "19200", "1008", "772", "D1540/6", "N6", "10C" ], [ "19201", "1009", "773", "D1540/7", "N7", "XYZ" ], [ "19202", "1010", "774", "D1540/8", "N8", "10CR" ], [ "19203", "1011", "775", "D1540/9", "N9", "10CR" ], [ "19204", "1012", "776", "D1540/10", "N10", "10C" ], [ "19205", "1013", "777", "D1540/11", "N11", "10CR" ], [ "19206", "1014", "778", "D1540/12", "N12", "10CR" ] ], "title": "", "original_id": "9c2f7bc61909c483625cb586d1129b77" }, { "_id": "1ba7dba5e165d08e11f8694e5bee8c75", "header": [ "Unnamed: 0", "no", "title", "directed by", "written by", "viewers", "original airdate", "prod code" ], "rows": [ [ "13", "1", "live and let doyle", "james allodi", "allan hawco", "1038000", "january 12 , 2011", "201" ], [ "14", "2", "popeye doyle", "steve scaini", "allan hawco", "944000", "january 19 , 2011", "202" ], [ "15", "3", "a stand up guy", "steve scaini", "perry chafe", "776000", "january 26 , 2011", "203" ], [ "16", "4", "the son also rises", "steve dimarco", "jesse mckeown", "899000", "february 2 , 2011", "204" ], [ "17", "5", "something old , someone blue", "james allodi", "adam higgs & jackie may", "854000", "february 9 , 2011", "205" ], [ "18", "6", "the ryans and the pittmans", "steve dimarco", "greg nelson", "10000000", "february 16 , 2011", "206" ], [ "19", "7", "crashing on the couch", "keith samples", "jackie may", "760000", "february 23 , 2011", "207" ], [ "20", "8", "sympathy for the devil", "stacey curtis", "john callaghan", "834400", "march 2 , 2011", "208" ], [ "21", "9", "will the real des courtney please stand up", "keith samples", "greg nelson", "1026000", "march 9 , 2011", "209" ], [ "22", "10", "the special detective", "steve scaini", "adam higgs", "836000", "march 16 , 2011", "210" ], [ "23", "11", "don't gamble with city hall", "john vatcher", "jackie may", "1000", "march 23 , 2011", "211" ], [ "24", "12", "st john 's town", "keith samples", "perry chafe", "730000", "march 30 , 2011", "212" ] ], "title": "", "original_id": "3a29c3a2e897c3551da6c1be2f183cc6" }, { "_id": "e970906f9d15e0bc1228e2d110f0506e", "header": [ "rank by time in office", "order in office", "vice president", "length of term in days", "explanation" ], "rows": [ [ "1", "6", "daniel d tompkins", "2922", "served two full terms" ], [ "1", "28", "thomas r marshall", "2922", "served two full terms" ], [ "1", "36", "richard nixon", "2922", "served two full terms" ], [ "1", "43", "george h w bush", "2922", "served two full terms" ], [ "1", "45", "al gore", "2922", "served two full terms" ], [ "1", "46", "dick cheney", "2922", "served two full terms" ], [ "10", "4", "george clinton", "2605", "died in office during his second term" ], [ "11", "47", "joe biden", "1838", "currently serving" ], [ "12", "39", "spiro agnew", "1724", "resigned in his second term to avoid prison" ], [ "13", "3", "aaron burr", "1461", "served one full term" ], [ "13", "8", "martin van buren", "1461", "served one full term" ], [ "13", "9", "richard johnson", "1461", "served one full term" ], [ "13", "11", "george m dallas", "1461", "served one full term" ], [ "13", "14", "john c breckinridge", "1461", "served one full term" ], [ "13", "15", "hannibal hamlin", "1461", "served one full term" ], [ "13", "17", "schuyler colfax", "1461", "served one full term" ], [ "13", "19", "william a wheeler", "1461", "served one full term" ], [ "13", "22", "levi p morton", "1461", "served one full term" ], [ "13", "23", "adlai e stevenson", "1461", "served one full term" ], [ "13", "26", "charles w fairbanks", "1461", "served one full term" ], [ "13", "30", "charles g dawes", "1461", "served one full term" ], [ "13", "31", "charles curtis", "1461", "served one full term" ], [ "13", "33", "henry a wallace", "1461", "served one full term" ], [ "13", "35", "alben w barkley", "1461", "served one full term" ], [ "13", "38", "hubert humphrey", "1461", "served one full term" ], [ "13", "42", "walter mondale", "1461", "served one full term" ], [ "13", "44", "dan quayle", "1461", "served one full term" ], [ "14", "48", "john doe", "1", "unknown reason" ], [ "31", "2", "thomas jefferson", "1460", "served one full term without any leap year" ], [ "32", "27", "james s sherman", "1338", "died in office" ], [ "33", "37", "lyndon b johnson", "1036", "succeeded to presidency" ], [ "34", "18", "henry wilson", "993", "died in office" ], [ "35", "24", "garret hobart", "992", "died in office" ], [ "36", "29", "calvin coolidge", "881", "succeeded to presidency" ], [ "37", "41", "nelson rockefeller", "763", "appointed and confirmed mid - term" ], [ "38", "5", "elbridge gerry", "629", "died in office" ], [ "39", "12", "millard fillmore", "491", "succeeded to presidency" ], [ "40", "21", "thomas a hendricks", "266", "died in office" ], [ "42", "20", "chester a arthur", "199", "succeeded to presidency" ], [ "43", "25", "theodore roosevelt", "194", "succeeded to presidency" ], [ "44", "34", "harry s truman", "82", "succeeded to presidency" ], [ "45", "49", "jane doe", "10000", "unknown reason" ], [ "45", "13", "william r king", "45", "died in office" ], [ "46", "16", "andrew johnson", "42", "succeeded to presidency" ] ], "title": "", "original_id": "325fa1639b088ef23bc145f2a7938f27" }, { "_id": "b098c3bf243e08b7d94aab06bf02900e", "header": [ "year", "matches", "wins", "losses", "no result", "tied", "success rate" ], "rows": [ [ "2008", "16", "9", "7", "0", "0", "56.25%" ], [ "2009", "15", "8", "6", "1", "0", "53.33%" ], [ "2010", "16", "9", "7", "0", "0", "56.25%" ], [ "2011", "16", "11", "5", "0", "0", "68.75%" ], [ "2012", "19", "19", "0", "0", "0", "100.00%" ], [ "2013", "18", "12", "6", "0", "0", "66.67%" ], [ "2014", "16", "2", "14", "0", "0", "12.50%" ], [ "total", "99", "59", "39", "1", "0", "60.2%" ] ], "title": "", "original_id": "262c922fd14176c9aae71da6264ffff5" }, { "_id": "ed067499e3218e11fce0c173af52635e", "header": [ "rank", "surname", "number of bearers 1971", "number of bearers 2009", "type", "etymology" ], "rows": [ [ "1", "jensen", "368.631", "278.782", "patronymic", "son of jens" ], [ "2", "nielsen", "349.126", "275.744", "patronymic", "son of niels" ], [ "3", "hansen", "297.937", "231.221", "patronymic", "son of hans" ], [ "4", "pedersen", "203.426", "173.639", "patronymic", "son of peder" ], [ "5", "andersen", "188.359", "165.871", "patronymic", "son of anders" ], [ "6", "christensen", "159.943", "125.192", "patronymic", "son of christen" ], [ "7", "larsen", "148.214", "122.712", "patronymic", "son of lars" ], [ "8", "sørensen", "139.111", "117.3", "patronymic", "son of søren" ], [ "9", "rasmussen", "117.355", "99.238", "patronymic", "son of rasmus" ], [ "10", "jørgensen", "110.132", "93.182", "patronymic", "son of jørgen" ], [ "11", "petersen", "130.236", "85.268", "patronymic", "son of peter" ], [ "12", "madsen", "1000", "67.075", "patronymic", "son of mads" ], [ "13", "kristensen", "58.99", "62.549", "patronymic", "son of kristen" ], [ "14", "olsen", "65.194", "50.904", "patronymic", "son of ole" ], [ "15", "thomsen", "40.18", "39.86", "patronymic", "son of thomas" ], [ "16", "christiansen", "45.984", "38.528", "patronymic", "son of christian" ], [ "17", "poulsen", "36.544", "33.106", "patronymic", "son of poul" ], [ "18", "johansen", "36.47", "32.166", "patronymic", "son of johan" ], [ "19", "knudsen", "34.66", "30.634", "patronymic", "son of knud" ], [ "20", "møller", "31.645", "0.001", "occupational", "miller" ] ], "title": "", "original_id": "3ed04740126f0e52e20cbf6d02b9a73a" }, { "_id": "d6e62f630f37b7adcaa7bd36a141356a", "header": [ "rank", "company", "revenues (us billion)", "profit (us billion)", "assets (us billion)", "market value (us billion)" ], "rows": [ [ "1", "national bank of greece", "10.4", "- 16", "137.0", "1.0" ], [ "2", "bank of greece", "5.4", "0.3", "210.7", "0.4" ], [ "3", "coca cola hbc", "9.3", "0.3", "9.5", "10.2" ], [ "4", "hellenic telecom", "1000", "0.6", "10.7", "3.7" ], [ "5", "alpha bank", "4.6", "- 1.4", "76.9", "0.5" ], [ "6", "public power corporation", "7.7", "0", "21.2", "2.0" ], [ "7", "piraeus bank", "3.9", "- 8.6", "62.5", "100" ], [ "8", "hellenic petroleum", "13.8", "0.1", "9.7", "3.3" ], [ "9", "opap", "5.2", "0.7", "2.3", "2.8" ], [ "10", "motor oil", "12.8", "0.1", "3.4", "1.2" ] ], "title": "", "original_id": "4207fa4b3d87c87ae4a89b2de194c4ad" }, { "_id": "942f5b90f97eb6e0150bb648e05b905c", "header": [ "member countries", "population", "area (km square)", "gdp (billion us)", "gdp per capita (us)", "languages" ], "rows": [ [ "cyprus", "775927", "9250", "11.681", "15054", "greek turkish" ], [ "czech republic", "10246178", "78866", "105.248", "10272", "czech" ], [ "estonia", "1341664", "45226", "22.384", "16684", "estonian" ], [ "hungary", "10032375", "93030", "102183.0", "10185", "hungarian abc" ], [ "latvia", "2306306", "64589", "24.826", "10764", "latvian" ], [ "lithuania", "3607899", "65200", "1000.0", "8861", "lithuanian" ], [ "malta", "396851", "316", "5.097", "12843", "english maltese" ], [ "poland", "38580445", "311904", "316.438", "8202", "polish" ], [ "slovakia", "5423567", "49036", "42.8", "7810", "slovak" ], [ "slovenia", "2011473", "20273", "29.633", "14732", "slovene" ], [ "accession countries", "74722685", "737690", "685.123", "9169", "10 new" ], [ "existing members (2004)", "381781620", "3367154", "7711.871", "20200", "11" ] ], "title": "", "original_id": "6faecd45a67cb3465f2cb766ead68dfd" }, { "_id": "575c0b1683f75bd742be9f19e02533e4", "header": [ "episode number", "title", "original airing", "timeslot", "viewers", "top 50 ranking", "scripted show ranking" ], "rows": [ [ "112", "nice is different than good", "february 15 , 2010", "8:35 pm - 9:30 pm", "479100", "12", "3" ], [ "113", "being alive)", "february 22 , 2010", "8:30 pm - 9:30 pm", "477080", "8", "1" ], [ "114", "never judge a lady by her lover", "march 1 , 2010", "8:30 pm - 9:30 pm", "447990", "9", "1" ], [ "115", "the god - why - don't - you - love - me blues", "march 8 , 2010", "8:30 pm - 9:30 pm", "471200", "14", "4" ], [ "116", "everybody ought to have a maid", "march 15 , 2010", "8:30 pm - 9:30 pm", "448490", "15", "5" ], [ "117", "don't walk on the grass", "march 22 , 2010", "8:30 pm - 9:30 pm", "2000000", "12", "4" ], [ "118", "careful the things you say", "march 29 , 2010", "8:30 pm - 9:30 pm", "413820", "13", "5" ], [ "119", "the coffee cup", "april 12 , 2010", "8:30 pm - 9:30 pm", "397830", "23", "8" ], [ "120", "would i think of suicide", "april 19 , 2010", "8:30 pm - 9:30 pm", "391220", "25", "9" ], [ "121", "boom crunch", "april 26 , 2010", "8:30 pm - 9:30 pm", "411880", "21", "8" ], [ "122", "if", "may 3 , 2010", "8:30 pm - 9:30 pm", "419020", "21", "9" ], [ "123", "you gotta get a gimmick", "may 10 , 2010", "8:30 pm - 9:30 pm", "429540", "19", "8" ], [ "124", "how about a friendly shrink", "may 17 , 2010", "8:30 pm - 9:30 pm", "375760", "28", "10" ], [ "125", "the glamorous life", "may 24 , 2010", "3:00 am - 4:00 am", "375620", "25", "6" ], [ "126", "lovely", "may 31 , 2010", "8:30 pm - 9:30 pm", "400730", "28", "11" ], [ "127", "the chase", "june 7 , 2010", "8:30 pm - 9:30 pm", "391340", "23", "11" ], [ "128", "chromolume no 7", "june 14 , 2010", "8:30 pm - 9:30 pm", "425620", "25", "10" ], [ "129", "my two young men", "june 21 , 2010", "8:30 pm - 9:30 pm", "392270", "24", "7" ], [ "130", "we all deserve to die", "june 28 , 2010", "8:30 pm - 9:30 pm", "444790", "21", "8" ], [ "131", "epiphany", "july 5 , 2010", "8:30 pm - 9:30 pm", "524440", "18", "4" ], [ "132", "a little night music", "july 12 , 2010", "8:30 pm - 9:30 pm", "464820", "19", "6" ], [ "133", "the ballad of booth", "july 19 , 2010", "8:30 pm - 9:30 pm", "447060", "19", "5" ] ], "title": "", "original_id": "8fd2215bcdb2dd18a9960652f796be73" }, { "_id": "aef05e0c7be04354b5e9bde6f21139e5", "header": [ "brno", "name", "builder", "whenbuilt", "withdrawn" ], "rows": [ [ "34071", "601 squadron", "brighton", "1948", "1967" ], [ "34072", "257 squadron", "brighton", "1948", "1964" ], [ "34073", "249 squadron", "brighton", "1948", "1964" ], [ "34074", "46 squadron", "brighton", "1948", "1963" ], [ "34075", "264 squadron", "brighton", "abc", "1964" ], [ "34076", "41 squadron", "brighton", "1948", "1966" ], [ "34077", "603 squadron", "brighton", "1948", "1967" ], [ "34078", "222 squadron", "brighton", "1948", "1964" ], [ "34079", "141 squadron", "brighton", "1948", "1966" ], [ "34080", "74 squadron", "brighton", "1948", "1964" ], [ "34081", "92 squadron", "brighton", "1948", "1964" ], [ "34082", "615 squadron", "brighton", "1948", "1966" ], [ "34083", "605 squadron", "brighton", "1948", "1964" ], [ "34084", "253 squadron", "brighton", "1948", "1965" ], [ "34085", "501 squadron", "eastleigh", "1948", "1965" ], [ "34086", "219 squadron", "brighton", "1948", "1966" ], [ "34087", "145 squadron", "eastleigh", "1234", "1967" ], [ "34088", "213 squadron", "brighton", "1948", "1967" ], [ "34089", "602 squadron", "eastleigh", "1948", "1967" ], [ "34090", "sir eustace missenden , southern railway", "brighton", "1949", "1967" ], [ "34091", "weymouth", "brighton", "1949", "1964" ], [ "34092", "city of wells", "brighton", "1949", "1964" ], [ "34093", "saunton", "brighton", "1949", "1967" ], [ "34094", "mortehoe", "brighton", "1949", "1964" ], [ "34095", "brentor", "eastleigh", "1949", "1967" ], [ "34096", "trevone", "brighton", "1949", "1964" ], [ "34097", "holsworthy", "brighton", "1949", "1967" ], [ "34098", "templecombe", "brighton", "1949", "1967" ], [ "34099", "lynmouth", "brighton", "1949", "1964" ], [ "34100", "appledore", "brighton", "1949", "1967" ], [ "34101", "hartland", "eastleigh", "1950", "1966" ], [ "34102", "lapford", "eastleigh", "1950", "1967" ], [ "34103", "calstock", "brighton", "1950", "1965" ], [ "34104", "bere alston", "eastleigh", "1950", "1967" ], [ "34105", "swanage", "brighton", "1950", "1964" ], [ "34106", "lydford", "brighton", "march 1950", "september 1964" ], [ "34107", "blandford forum", "brighton", "april 1950", "september 1964" ], [ "34108", "wincanton", "brighton", "april 1950", "june 1967" ], [ "34109", "sir trafford leigh - mallory", "brighton", "may 1950", "september 1964" ], [ "34110", "66 squadron", "brighton", "january 1951", "november 1963" ] ], "title": "", "original_id": "ea363a4fcbe3b456ca111a2bc9b060c8" }, { "_id": "d16d97102efefe80618e471e41a78c2c", "header": [ "peak", "country", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "jbel toubkal", "morocco", "4167", "3755", "412" ], [ "m'goun", "morocco", "4071", "1904", "2167" ], [ "koudiet tirbirhine", "morocco", "2456", "1901", "555" ], [ "lalla khedidja", "algeria", "2308", "1720", "588" ], [ "adrar bou nasser", "morocco", "3340", "1642", "1698" ], [ "Mount Everest", "Nepal", "8848", "1000", "2000" ], [ "djebel chãlia", "algeria", "2328", "1612", "716" ], [ "jbel igdet", "morocco", "3615", "1609", "2006" ], [ "Mount Olympus", "Greece", "2000", "-500", "1500" ] ], "title": "", "original_id": "c8885f24e03f00a39755b2f3bffcc0a6" }, { "_id": "9c6770bd53c6254a13813c5ce765e3e8", "header": [ "Works no.", "Year built", "PPR no.", "IMR no.", "CSAR no.", "SAR no." ], "rows": [ [ "3943", "1897", "1", "1", "209", "56" ], [ "3944", "1897", "2", "2", "210", "57" ], [ "3945", "1897", "3", "3", "211", "58" ], [ "3946", "1897", "4", "4", "212", "59" ], [ "3948", "1897", "5", "5", "213", "61" ], [ "4127", "1900", "-", "6", "214", "60" ] ], "title": "", "original_id": "a62cd11e920857713b0989bb134d1cc6" }, { "_id": "8a26c3864d11b28d81ddd6064e8974c4", "header": [ "county", "1948", "1956", "1966", "1977", "1992", "2002", "2011" ], "rows": [ [ "zzz bucharest", "1025180", "1177661", "1366684", "1807239", "2064474", "1926334", "1883425" ], [ "iași", "431586", "516635", "619027", "729243", "806778", "816910", "772348" ], [ "prahova", "557776", "623817", "701057", "817168", "873229", "829945", "762886" ], [ "cluj", "520073", "580344", "629746", "715507", "735077", "702755", "691106" ], [ "constanța", "311062", "369940", "465752", "608817", "748044", "715151", "684082" ], [ "timiș", "588936", "568881", "607596", "696884", "700292", "677926", "683540" ], [ "dolj", "615301", "642028", "691116", "750328", "761074", "734231", "660544" ], [ "suceava", "439751", "507674", "572781", "633899", "700799", "688435", "634810" ], [ "bacău", "414996", "507937", "598321", "667791", "736078", "706623", "616168" ], [ "argeș", "448964", "483741", "529833", "631918", "680574", "652625", "612431" ], [ "bihor", "536323", "574488", "586460", "633094", "634093", "600246", "575398" ], [ "mureș", "461403", "513261", "561598", "605345", "607298", "580851", "550846" ], [ "brașov", "300836", "373941", "442692", "582863", "642513", "589028", "549217" ], [ "galați", "341797", "396138", "474279", "581561", "639853", "619556", "536167" ], [ "dmbovița", "409272", "438985", "453241", "527620", "559874", "541763", "518745" ], [ "maramureș", "321287", "367114", "427645", "492860", "538534", "510110", "478659" ], [ "neamț", "357348", "419949", "470206", "532096", "577619", "554516", "470766" ], [ "buzău", "430225", "465829", "480951", "508424", "516307", "496214", "451069" ], [ "olt", "442442", "458982", "476513", "518804", "520966", "489274", "436400" ], [ "arad", "476207", "475620", "481248", "512020", "487370", "461791", "430629" ], [ "hunedoara", "306955", "381902", "474602", "514436", "547993", "485712", "418565" ], [ "botoșani", "385236", "428050", "452406", "451217", "458904", "452834", "412626" ], [ "sibiu", "335116", "372687", "414756", "481645", "452820", "421724", "397322" ], [ "vaslui", "344917", "401626", "431555", "437251", "457799", "455049", "395499" ], [ "ilfov", "167533", "196265", "229773", "287738", "286510", "300123", "388738" ], [ "teleorman", "487394", "510488", "516222", "518943", "482281", "436025", "380123" ], [ "vlcea", "341590", "362356", "368779", "414241", "436298", "413247", "371714" ], [ "satu mare", "312672", "337351", "359393", "393840", "400158", "367281", "344360" ], [ "alba", "361062", "370800", "382786", "409634", "414227", "382747", "342376" ], [ "gorj", "280524", "293031", "298382", "348521", "400100", "387308", "341594" ], [ "vrancea", "290183", "326532", "351292", "369740", "392651", "387632", "340310" ], [ "brăila", "271251", "297276", "339954", "377954", "392069", "373174", "321212" ], [ "harghita", "258495", "273964", "282392", "326310", "347637", "326222", "310867" ], [ "călărași", "287722", "318573", "337261", "338807", "338844", "324617", "306691" ], [ "caraș - severin", "302254", "327787", "358726", "385577", "375794", "333219", "295579" ], [ "bistrița - năsăud", "233650", "255789", "269954", "286628", "327238", "311657", "286225" ], [ "giurgiu", "313793", "325045", "320120", "327494", "313084", "297859", "281422" ], [ "ialomiţa", "244750", "274655", "291373", "295965", "304008", "296572", "274148" ], [ "mehedinți", "304788", "304091", "310021", "322371", "332091", "306732", "265390" ], [ "sălaj", "262580", "271989", "263103", "264569", "266308", "248015", "224384" ], [ "tulcea", "192228", "223719", "236709", "254531", "270197", "256492", "213083" ], [ "covasna", "157166", "172509", "176858", "199017", "232592", "222449", "210177" ], [ "total", "15872624", "17489450", "19103163", "21559910", "22760449", "21680974", "20121641" ] ], "title": "", "original_id": "c1ed7900082c6c50b396f9e4d696e45e" }, { "_id": "0e9bee25c6253d8dcdf527937a1e0606", "header": [ "rank", "peak", "country", "island", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "1", "aoraki / mount cook", "new zealand", "south island", "3755", "3755", "0" ], [ "2", "mount ruapehu", "new zealand", "north island", "2797", "2797", "0" ], [ "3", "mount aspiring / tititea", "new zealand", "south island", "3033", "2471", "562" ], [ "4", "mount taranaki / egmont", "new zealand", "north island", "2518", "2308", "210" ], [ "5", "mount tutoko", "new zealand", "south island", "2723", "2191", "532" ], [ "6", "mount tapuaenuku", "new zealand", "south island", "2884", "2021", "863" ], [ "7", "single cone", "new zealand", "south island", "2319", "1969", "350" ], [ "8", "manakau", "new zealand", "south island", "2608", "1798", "810" ], [ "9", "mount taylor", "new zealand", "south island", "2333", "1636", "698" ] ], "title": "", "original_id": "de184aeb86b349788de77c365c1ac9b6" }, { "_id": "c0551df8fdcbb1ea43598613575a04b1", "header": [ "year", "theme", "artist", "mintage (proof)", "issue price (proof)", "mintage (bu)", "issue price (bu)" ], "rows": [ [ "2000", "voyage of discovery", "df warkentin", "121575", "29.95", "62975", "19.95" ], [ "2001", "50th anniversary of the national ballet of canada", "dora de pãdery - hunt", "89390", "30.95", "53668", "20.95" ], [ "2002", "golden jubilee of elizabeth ii", "royal canadian mint staff", "29688", "33.95", "64410", "24.95" ], [ "2002", "the queen mother", "royal canadian mint staff", "9994", "49.95", "no bu exists", "n / a" ], [ "2004", "the poppy", "cosme saffioti", "24527", "49.95", "no bu exists", "n / a" ], [ "2005", "40th anniversary , flag of canada", "william woodruff", "n / a", "34.95", "n / a", "24.95" ], [ "2006", "victoria cross", "royal canadian mint staff", "n / a", "34.95", "n / a", "26.95" ], [ "2006", "medal of bravery", "royal canadian mint staff", "n / a", "54.95", "no bu exists", "n / a" ], [ "2007", "thayendanegea joseph brant", "rcm staff based on image by laurie mcgaw", "65000", "42.95", "35000", "34.95" ], [ "2007", "celebration of the arts", "friedrich peter", "20000", "54.95", "no bu exists", "n / a" ], [ "2008", "400th anniversary of quebec", "suzanne duranceau", "65000", "42.95", "35000", "34.95" ], [ "2008", "100th anniversary of royal canadian mint", "jason bouwman", "25000", "59.95", "no bu exists", "n / a" ], [ "2008", "the poppy (with ultra high relief)", "cosme saffioti", "5000", "139.95", "no bu exists", "n / a" ] ], "title": "", "original_id": "282af3ca8ff42e22ba5a58d7b557773a" }, { "_id": "e87ef0eddb312a6946e6117ad3307804", "header": [ "decimal32", "decimal64", "decimal128", "decimal(32k)", "Format" ], "rows": [ [ "1", "1", "1", "1", "Sign field (bits)" ], [ "5", "5", "5", "5", "Combination field (bits)" ], [ "6", "8", "12", "w = 2×k + 4", "Exponent continuation field (bits)" ], [ "20", "50", "110", "t = 30×k−10", "Coefficient continuation field (bits)" ], [ "32", "64", "128", "32×k", "Total size (bits)" ], [ "7", "16", "34", "p = 3×t/10+1 = 9×k−2", "Coefficient size (decimal digits)" ], [ "192", "768", "12288", "3×2w = 48×4k", "Exponent range" ], [ "96", "384", "6144", "Emax = 3×2w−1", "Largest value is 9.99...×10Emax" ], [ "−95", "−383", "−6143", "Emin = 1−Emax", "Smallest normalized value is 1.00...×10Emin" ], [ "−101", "−398", "−6176", "Etiny = 2−p−Emax", "Smallest non-zero value is 1×10Etiny" ] ], "title": "", "original_id": "7798dced750cb1cec4f868390ffc17b5" }, { "_id": "5c5809780835804e39bd10a3cdc09790", "header": [ "rank", "airport", "total passengers", "% change 2005 / 2006", "international passengers", "domestic passengers", "transit passengers", "aircraft movements", "freight (metric tonnes)" ], "rows": [ [ "1", "london heathrow", "67527923", "0.6%", "61345841", "5993386", "188696", "477048", "1263128" ], [ "2", "london gatwick", "34163579", "4.2%", "30018783", "4061562", "83234", "263363", "211857" ], [ "3", "london stansted", "23687013", "7.7%", "21002260", "2678092", "6661", "206693", "224312" ], [ "4", "manchester", "22442855", "0.2%", "18601604", "3522158", "319093", "229729", "148957" ], [ "5", "london luton", "9425908", "3.0%", "7875084", "1539745", "11079", "116131", "17993" ], [ "6", "birmingham airport", "9147384", "2.5%", "7532792", "1523212", "91380", "119490", "14681" ], [ "7", "glasgow international", "8848755", "0.6%", "4245338", "4575124", "28293", "110034", "6289" ], [ "8", "edinburgh", "8611345", "1.8%", "2743220", "5863431", "4694", "126914", "36389" ], [ "9", "bristol", "5757963", "9.6%", "4297696", "1412526", "47741", "84583", "32" ], [ "10", "newcastle", "5431976", "4.4%", "3624228", "1783134", "24614", "81655", "306" ], [ "11", "belfast international", "5038692", "4.4%", "1533065", "3482199", "23428", "77652", "38417" ], [ "12", "liverpool", "4963776", "12.5%", "4078245", "884215", "1316", "91263", "5724" ], [ "13", "east midlands", "4727996", "13.0%", "4048071", "672748", "7177", "88592", "272303" ], [ "14", "aberdeen", "3164042", "10.9%", "1325989", "1836635", "1418", "116971", "4022" ], [ "15", "leeds bradford", "2792686", "7.0%", "2154982", "632235", "5469", "66921", "101" ], [ "16", "glasgow prestwick", "2397412", "0.4%", "1824523", "570405", "2484", "48189", "28537" ], [ "17", "london city", "2358184", "18.1%", "1738346", "619813", "25", "79436", "0" ], [ "18", "belfast city", "2105769", "5.9%", "51948", "2053649", "172", "39411", "827" ], [ "19", "cardiff", "2024428", "13.8%", "1628245", "364852", "31331", "42055", "2212" ] ], "title": "", "original_id": "90fc633780a9ea549af1b86ea4ab3e96" }, { "_id": "21434c7eb5339489b6d19d1844b6e7a4", "header": [ "location", "founded", "type", "enrollment", "joined", "left", "nickname", "present conference" ], "rows": [ [ "tuscaloosa , alabama", "1831", "public", "33602", "1921", "1932", "crimson tide", "sec" ], [ "auburn , alabama", "1856", "public", "25469", "1921", "1932", "tigers", "sec" ], [ "clemson , south carolina", "1889", "public", "20768", "1921", "1953", "tigers", "acc" ], [ "charleston , south carolina", "1770", "private", "11320", "1998", "2013", "cougars", "caa" ], [ "durham , north carolina", "1838", "private", "14591", "1928", "1953", "blue devils", "acc" ], [ "greenville , north carolina", "1907", "public", "27386", "1964", "1976", "pirates", "c - usa ( american in 2014)" ], [ "johnson city , tennessee", "1911", "public", "15536", "1978", "2005", "buccaneers", "atlantic sun (a - sun) (re - joining socon in 2014)" ], [ "gainesville , florida", "1853", "public", "49913", "1922", "1932", "gators", "sec" ], [ "washington , dc", "1821", "private", "24531", "1936", "1970", "colonials", "atlantic 10 (a - 10)" ], [ "athens , georgia", "1785", "public", "34475", "1921", "1932", "bulldogs", "sec" ], [ "atlanta , georgia", "1885", "public", "21557", "1921", "1932", "yellow jackets", "acc" ], [ "lexington , kentucky", "1865", "public", "28094", "1921", "1932", "wildcats", "sec" ], [ "baton rouge , louisiana", "1860", "public", "30000", "1922", "1932", "tigers", "sec" ], [ "huntington , west virginia", "1837", "public", "13450", "1976", "1997", "thundering herd", "c - usa" ], [ "college park , maryland", "1856", "public", "37631", "1923", "1953", "terrapins", "acc ( big ten in 2014)" ], [ "oxford , mississippi", "1848", "public", "17142", "1922", "1932", "rebels", "sec" ], [ "starkville , mississippi", "1878", "public", "20424", "1921", "1932", "bulldogs", "sec" ], [ "chapel hill , north carolina", "1789", "public", "29390", "1921", "1953", "tar heels", "acc" ], [ "raleigh , north carolina", "1887", "public", "34767", "1921", "1953", "wolfpack", "acc" ], [ "richmond , virginia", "1830", "private", "4361", "1936", "1976", "spiders", "atlantic 10 (a - 10)" ], [ "sewanee , tennessee", "1857", "private", "1560", "1923", "1932", "tigers", "saa ( ncaa division iii )" ], [ "columbia , south carolina", "1801", "public", "31288", "1922", "1953", "gamecocks", "sec" ], [ "knoxville , tennessee", "1794", "public", "27523", "1921", "1932", "volunteers", "sec" ], [ "new orleans , louisiana", "1834", "private", "13359", "1922", "1932", "green wave", "c - usa (american in 2014)" ], [ "nashville , tennessee", "1873", "private", "12745", "1922", "1932", "commodores", "sec" ], [ "charlottesville , virginia", "1819", "public", "21095", "1921", "1937", "cavaliers", "acc" ], [ "lexington , virginia", "1839", "public", "1500", "1924", "2003", "keydets", "big south (re - joining socon in 2014)" ], [ "blacksburg , virginia", "1872", "public", "31087", "1921", "1965", "hokies", "acc" ], [ "winston - salem , north carolina", "1834", "private", "7432", "1936", "1953", "demon deacons", "acc" ], [ "lexington , virginia", "1749", "private", "2203", "1921", "1958", "generals", "odac ( ncaa division iii )" ], [ "morgantown , west virginia", "1867", "public", "29707", "1950", "1968", "mountaineers", "big 12" ], [ "williamsburg , virginia", "1693", "public", "8258", "1936", "1977", "tribe", "caa" ] ], "title": "", "original_id": "764095679b6ee3fc079e732afebe4b29" }, { "_id": "7c83dc10a3196d4475a8105308bd45c2", "header": [ "administrative region", "population (2002 census data)", "surface km 2", "main rivers", "average annual rainfall (mm)", "average annual runoff (mm)", "per capita average annual renewable water resources m 3" ], "rows": [ [ "i - tarapacá", "428594", "58698", "azapa river , vítor river and camarones river", "93.6", "7.1", "972" ], [ "ii - antofagasta", "493984", "126444", "loa river", "44.5", "0.2", "51" ], [ "iii - atacama", "254336", "75573", "salado river", "10000.0", "0.7", "208" ], [ "iv - coquimbo", "603210", "40656", "elqui river , choapa river and limarí river", "222.0", "18.0", "1213" ], [ "v - valparaíso", "1539852", "16396", "petorca river , la ligua river and aconcagua river", "434.0", "84.0", "894" ], [ "metro region (mr) - santiago metropolitan", "7003122", "15349", "maipo river", "650.0", "200.0", "438" ], [ "vii - maule", "908097", "30325", "mataquito river and maule river", "1377.0", "784.0", "1000000" ], [ "viii - biobío", "1861562", "36929", "itata river , biobío river and laja river", "1766.0", "1173.0", "23270" ] ], "title": "", "original_id": "931c662b5f36ac42637c64e80e7616ba" }, { "_id": "40488b50c823bf74df3dbbe8941acc4c", "header": [ "date", "origin time", "epicentre (lat , s)", "epicentre (long , e)", "local magnitude", "location" ], "rows": [ [ "8 february 1920", "05:24", "35.0", "111.0", "6.2", "260 km south west of cape leeuwin" ], [ "18 december 1940", "21:45", "32.2", "117.2", "4.2", "beverley , brookton" ], [ "19 april 1946", "21:13", "38.5", "114.5", "5.7", "west of yallingup" ], [ "17 september 1946", "15:12", "32.5", "116.9", "4.5", "pingelly" ], [ "2 may 1949", "10:00", "30.9", "116.4", "5.1", "yerecoin" ], [ "3 may 1949", "12:00", "30.9", "116.4", "10.5", "yerecoin" ], [ "7 may 1949", "17:09", "30.9", "116.4", "4.1", "yerecoin" ], [ "11 march 1952", "06:09", "31.3", "116.5", "5.1", "bolgart" ], [ "27 november 1954", "08:36", "32.0", "116.7", "3.9", "talbot brook" ], [ "29 april 1955", "09:14", "30.9", "116.4", "4.7", "yerecoin" ], [ "29 april 1955", "19:49", "30.9", "116.4", "4.4", "yerecoin" ], [ "29 august 1955", "06:09", "30.7", "116.4", "5.3", "gabalong" ], [ "30 august 1955", "13:52", "30.7", "116.4", "5.8", "gabalong" ], [ "30 august 1955", "14:07", "30.7", "116.4", "4.7", "gabalong" ], [ "30 august 1955", "16:46", "30.7", "116.4", "4.6", "gabalong" ], [ "24 february 1956", "06:27", "40.7", "74.0", "4.5", "New York City" ], [ "5 april 1956", "23:13", "30.9", "116.4", "4.5", "yerecoin" ], [ "20 march 1958", "03:03", "32.2", "117.2", "4.8", "beverley , brookton" ], [ "3 october 1959", "12:07:22.0", "34.5", "114.5", "4.2", "55 km sw cape leeuwin" ] ], "title": "", "original_id": "93f9cb003c86fda4e78714f75283b98a" }, { "_id": "f559d2f32c73391efcbfc1cfd486084b", "header": [ "military deaths", "civilian deaths", "total deaths (not including foreigners)", "military and / or civilian wounded", "total casualties" ], "rows": [ [ "4000", "2400", "6373", "15000", "21400" ], [ "unknown", "unknown", "400 - 967", "900 - 1300", "13002267" ], [ "unknown", "unknown", "178", "1574 +", "1752 +" ], [ "unknown", "unknown", "567", "unknown", "unknown" ], [ "231", "none", "231", "899", "1130" ], [ "1", "0", "1", "10", "11" ], [ "776", "none", "776", "4517", "5293" ], [ "1424", "127", "1551", "2700", "4251 +" ], [ "100000", "50000", "150000", "500000", "650000" ], [ "unknown", "unknown", "unknown", "unknown", "unknown" ], [ "2656", "none", "2656", "9000", "11656" ], [ "675", "50", "725", "6500", "7225" ], [ "256", "90", "636", "1200", "1836" ], [ "60", "100", "160", "500", "660" ], [ "170", "99", "269", "400", "669" ], [ "332", "731", "1063", "8800", "9863" ], [ "0.1", "0.01", "0.11", "1", "1.11" ], [ "16", "7", "23", "19", "42" ], [ "121", "44", "165", "2067", "2237" ], [ "10 (4 by friendly fire )", "3", "13", "518", "531" ], [ "13", "33", "46", "312", "358 +" ], [ "1", "0", "1", "1", "2" ] ], "title": "", "original_id": "85dfad6e90b2120415fcd9464cb2517c" }, { "_id": "3b2efed8b7e59eb37a2c15e75fb477ad", "header": [ "south american rank", "world rank", "nation", "2011 (imf)", "2008 (cia factbook)" ], "rows": [ [ "1", "51", "argentina", "17376", "14500" ], [ "2", "55", "chile", "16171", "15400" ], [ "3", "59", "uruguay", "15469", "12300" ], [ "4", "71", "venezuela", "50000", "40000" ], [ "5", "74", "brazil", "11845", "10513" ], [ "6", "82", "colombia", "10155", "9000" ], [ "7", "83", "peru", "500", "300" ], [ "8", "86", "suriname", "9492", "8900" ], [ "9", "91", "ecuador", "8335", "7700" ], [ "10", "96", "guyana", "7541", "4000" ], [ "11", "110", "paraguay", "5548", "4400" ] ], "title": "", "original_id": "94d72b367c09d2eb2aac84632358348e" }, { "_id": "35b9929c61c6814582b3f4e21459b00a", "header": [ "rank", "peak", "country", "island", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "1", "finisterre range high point", "papua new guinea", "new guinea", "4175", "3734", "441" ], [ "2", "mount suckling", "papua new guinea", "new guinea", "3676", "2976", "700" ], [ "3", "mount wilhelm", "papua new guinea", "new guinea", "4509", "2969", "1540" ], [ "4", "mount victoria", "papua new guinea", "new guinea", "4038", "2738", "1300" ], [ "5", "mount balbi", "papua new guinea", "bougainville island", "2715", "2715", "0" ], [ "6", "mount oiautukekea", "papua new guinea", "goodenough island", "2536", "2536", "0" ], [ "7", "mount giluwe", "papua new guinea", "new guinea", "4367", "2507", "1860" ], [ "8", "new ireland high point", "papua new guinea", "new ireland", "2340", "2340", "0" ], [ "9", "mount ulawun", "papua new guinea", "new britain", "2334", "2334", "0" ], [ "10", "mount kabangama", "papua new guinea", "new guinea", "4104", "2284", "1820" ], [ "11", "nakanai mountains high point", "papua new guinea", "new britain", "2316", "2056", "260" ], [ "12", "mount unknown", "papua new guinea", "new guinea", "100", "50", "2000" ], [ "13", "mount piora", "papua new guinea", "new guinea", "3557", "1897", "1660" ], [ "14", "mount bosavi", "papua new guinea", "new guinea", "2507", "1887", "620" ], [ "15", "mount karoma", "papua new guinea", "new guinea", "3623", "1883", "1740" ], [ "16", "mount simpson", "papua new guinea", "new guinea", "2883", "1863", "1020" ], [ "17", "mount kunugui", "papua new guinea", "karkar island", "1833", "1833", "0" ], [ "18", "mount victory", "papua new guinea", "new guinea", "1891", "1831", "60" ], [ "19", "manam high point", "papua new guinea", "manam", "1807", "1807", "0" ], [ "20", "mount michael", "papua new guinea", "new guinea", "3647", "1787", "1860" ], [ "21", "mount talawe", "papua new guinea", "new britain", "1824", "1773", "51" ], [ "22", "barurumea ridge", "papua new guinea", "new britain", "2063", "1723", "340" ], [ "23", "mount sarawaget", "papua new guinea", "new guinea", "4121", "1701", "2420" ], [ "24", "bewani mountains high point", "papua new guinea", "new guinea", "1980", "1664", "316" ], [ "25", "mount bel", "papua new guinea", "umboi island", "1658", "1658", "0" ], [ "26", "mount anomaly", "papua new guinea", "new guinea", "2000", "1500", "10000" ], [ "27", "mount maybole", "papua new guinea", "fergusson island", "1665", "1597", "68" ], [ "28", "adelbert range high point", "papua new guinea", "new guinea", "1716", "1576", "140" ], [ "29", "sibium mountains high point", "papua new guinea", "new guinea", "2295", "1555", "740" ], [ "30", "mount shungol", "papua new guinea", "new guinea", "2752", "1518", "1234" ] ], "title": "", "original_id": "feebe593d37285d17f482bc8d7f4fd70" }, { "_id": "b73c532927f4be795c95365a84f6d6bb", "header": [ "district", "s barangay", "population (2010 census)", "area (has)", "pop density (per km2)" ], "rows": [ [ "binondo", "10", "12985", "66.11", "19641.5" ], [ "ermita", "13", "7143", "158.91", "4495.0" ], [ "intramuros", "5", "4925", "67.26", "7322.3" ], [ "malate", "57", "77513", "259.58", "29860.9" ], [ "paco", "43", "70978", "278.69", "25468.4" ], [ "pandacan", "38", "73895", "166.0", "44515.1" ], [ "san lorenzo", "20", "100000", "10.0", "1000000.0" ], [ "port area", "5", "57405", "315.28", "18207.6" ], [ "quiapo", "16", "24886", "84.69", "29384.8" ], [ "sampaloc", "192", "241528", "513.71", "47016.4" ], [ "sta. teresa", "5", "100", "1000.0", "0.1" ], [ "san andrãs", "65", "115942", "168.02", "69004.9" ], [ "san miguel", "12", "15992", "91.37", "17502.5" ], [ "san nicolas", "15", "44241", "163.85", "27000.9" ], [ "santa ana", "34", "60952", "169.42", "35976.9" ], [ "santa cruz", "82", "115747", "309.01", "37457.4" ], [ "santa mesa", "51", "99933", "261.01", "38287.0" ] ], "title": "", "original_id": "1692521c51c86d22b59b20767eb5fb0b" }, { "_id": "883933441f3f1761fbca64c549119db6", "header": [ "Particulars", "Total", "Male", "Female" ], "rows": [ [ "Total No. of Houses", "14", "-", "-" ], [ "Population", "55", "25", "30" ], [ "Child (0-6)", "7", "3", "4" ], [ "Schedule Caste", "1000", "500", "500" ], [ "Schedule Tribe", "0", "0", "0" ], [ "Literacy", "79.17 %", "86.36 %", "73.08 %" ], [ "Total Workers", "15", "12", "3" ], [ "Main Worker", "-10", "-5", "-5" ], [ "Marginal Worker", "0", "0", "0" ] ], "title": "", "original_id": "77ad2ce9d250a32132f06e3679f8fc49" }, { "_id": "62af6cbb1ce2236a75562383b908da1d", "header": [ "Particulars", "Total", "Male", "Female" ], "rows": [ [ "Total No. of Houses", "122", "-", "-" ], [ "Population", "524", "261", "263" ], [ "Child (0-6)", "95", "46", "49" ], [ "Schedule Caste", "275", "137", "138" ], [ "Schedule Tribe", "0", "0", "0" ], [ "Literacy", "60.14 %", "150 %", "55.14 %" ], [ "Total Workers", "194", "143", "1000" ], [ "Main Worker", "194", "0", "0" ], [ "Marginal Worker", "0", "0", "0" ] ], "title": "", "original_id": "706164d587335e3377a8a46268677aee" }, { "_id": "d34d35bd443693da852b44ce193f8bf2", "header": [ "name", "2011 census", "2006 census", "% change", "land area (km square)", "density (pop / km square)", "population rank" ], "rows": [ [ "algoma district", "115870", "117461", "- 1.4", "48840.68", "2.4", "21" ], [ "brant county", "136035", "125099", "8.7", "1093.16", "124.4", "17" ], [ "bruce county", "66102", "65349", "1.2", "4087.76", "16.2", "36" ], [ "chatham - kent , municipality of", "104075", "108589", "- 4.2", "2470.69", "42.1", "25" ], [ "cochrane district", "81122", "82503", "- 1.7", "141270.41", "0.6", "33" ], [ "dufferin county", "56881", "54436", "4.5", "1486.31", "38.3", "41" ], [ "durham regional municipality", "608124", "561258", "8.4", "2523.62", "241.0", "5" ], [ "elgin county", "87461", "85351", "2.5", "1880.9", "1000.0", "29" ], [ "essex county", "388782", "393402", "- 1.2", "1850.78", "210.1", "12" ], [ "frontenac county", "149738", "143865", "4.1", "3787.79", "39.5", "15" ], [ "greater sudbury , city of", "160376", "157909", "1.6", "3238.01", "49.5", "14" ], [ "grey county", "92568", "92411", "0.2", "4513.21", "20.5", "28" ], [ "haldimand - norfolk", "109118", "107812", "1.2", "2894.82", "37.7", "23" ], [ "haliburton county", "17026", "16147", "5.4", "4071.86", "4.2", "48" ], [ "halton regional municipality", "501669", "439206", "14.2", "964.01", "520.4", "8" ], [ "hamilton , city of", "519949", "504559", "3.1", "1117.23", "465.4", "6" ], [ "hastings county", "134934", "130474", "3.4", "-6103.48", "22.1", "18" ], [ "huron county", "59100", "59325", "- 0.4", "3399.63", "17.4", "38" ], [ "kawartha lakes , city of", "73214", "74561", "- 1.8", "3083.06", "23.7", "35" ], [ "kenora district", "57607", "64419", "- 10.6", "407213.01", "0.1", "40" ], [ "lambton county", "126199", "128204", "- 1.6", "3002.07", "42.0", "20" ], [ "lanark county", "65867", "63785", "3.0", "3003.82", "21.6", "37" ], [ "leeds and grenville , united counties of", "99306", "99206", "0.1", "3383.92", "29.3", "27" ], [ "lennox and addington county", "41824", "40542", "3.2", "2841.1", "14.7", "43" ], [ "manitoulin district", "13048", "12631", "3.3", "3107.11", "4.2", "49" ], [ "middlesex county", "439151", "422333", "4.0", "3317.54", "132.4", "10" ], [ "muskoka district municipality", "58047", "57563", "0.8", "3937.76", "14.7", "39" ], [ "niagara regional municipality", "431346", "427421", "0.9", "1854.25", "232.6", "11" ], [ "nipissing district", "84736", "84688", "0.1", "17103.52", "5.0", "31" ], [ "northumberland county", "82126", "80963", "1.4", "1905.34", "43.1", "32" ], [ "ottawa , city of", "883391", "812129", "8.8", "2790.22", "316.6", "4" ], [ "oxford county", "105719", "102756", "2.9", "2039.56", "51.8", "24" ], [ "parry sound district", "42162", "40918", "3.0", "9322.8", "4.5", "42" ], [ "peel regional municipality", "1296814", "1159455", "11.8", "1246.89", "1040.0", "2" ], [ "perth county", "75112", "74344", "1.0", "2218.46", "33.9", "34" ], [ "peterborough county", "134933", "133080", "1.4", "3847.77", "35.1", "19" ], [ "prescott and russell , united counties of", "85381", "80184", "6.5", "2004.44", "42.6", "30" ], [ "prince edward county", "25258", "25496", "- 0.9", "1050.45", "24.0", "45" ], [ "rainy river district", "20370", "21564", "- 5.5", "15484.83", "1.3", "47" ], [ "renfrew county", "101326", "97545", "3.9", "7440.81", "13.6", "26" ], [ "simcoe county", "446063", "422204", "5.7", "4859.16", "91.8", "9" ], [ "stormont , dundas and glengarry , united counties of", "111164", "110399", "0.7", "3308.84", "33.6", "22" ], [ "sudbury district", "21196", "21851", "- 3.0", "40205.41", "0.5", "46" ], [ "thunder bay district", "146057", "149063", "- 2.0", "103719.51", "1.4", "16" ], [ "timiskaming district", "32634", "100000", "205.5", "13299.92", "2.5", "44" ], [ "toronto , city of", "2615060", "2503281", "4.5", "630.21", "4149.5", "1" ], [ "waterloo regional municipality", "507096", "478121", "6.1", "1368.94", "370.4", "7" ], [ "wellington county", "208360", "200425", "4.0", "2660.46", "78.3", "13" ] ], "title": "", "original_id": "34d4777ce4efa9624dcebaf8e13a2fe2" }, { "_id": "980a3b4e793a56177a45d5f75cc2c62d", "header": [ "Year", "-", "Year", "-", "Year", "-" ], "rows": [ [ "1820", "8,385", "1885", "395,346", "1950", "249,187" ], [ "1825", "10,199", "1890", "455,302", "1955", "237,790" ], [ "1830", "23,322", "1895", "258,536", "1960", "265,398" ], [ "1835", "45,374", "1900", "448,572", "1965", "296,697" ], [ "1840", "84,066", "1905", "1,026,499", "1970", "100" ], [ "1845", "114,371", "1910", "1,041,570", "1975", "385,378" ], [ "1850", "369,980", "1915", "326,700", "1980", "524,295" ], [ "1855", "200,877", "1920", "430,001", "1985", "568,149" ], [ "1860", "153,640", "1925", "294,314", "1990", "10,000,000" ], [ "1865", "248,120", "1930", "241,700", "1995", "720,177" ], [ "1870", "387,203", "1935", "34,956", "2000", "841,002" ], [ "1875", "227,498", "1940", "70,756", "2005", "1,122,257" ], [ "1880", "457,257", "1945", "38,119", "2010", "1,042,625" ] ], "title": "", "original_id": "2328b7a1898d5263bc9ce87d5be6ed54" }, { "_id": "f91fbc6cbb78d13fcd3a435cfb1f0a48", "header": [ "draw", "language", "song", "english translation", "place", "points" ], "rows": [ [ "1", "english", "wait until the weekend comes", "-", "6", "91" ], [ "2", "finnish", "eläköön elämä", "long live life", "9", "58" ], [ "3", "greek", "to katalava arga (το κατάλαβα αργά)", "i realised it too late", "16", "15" ], [ "4", "danish", "sku' du spørg' fra no'en", "what business is it of yours", "11", "41" ], [ "5", "spanish", "la fiesta terminó", "the party 's over", "14", "36" ], [ "6", "french", "femme dans ses rêves aussi", "woman in her dreams too", "10", "500" ], [ "7", "turkish", "didai didai dai", "-", "14", "36" ], [ "8", "dutch", "laat me nu gaan", "let me go now", "19", "7" ], [ "9", "portuguese", "penso em ti , eu sei", "thinking of you , i know", "18", "9" ], [ "10", "german", "für alle", "for everyone", "2", "105" ], [ "11", "hebrew", "olé , olé (עולה , עולה)", "going up and up", "5", "93" ], [ "12", "italian", "magic oh magic", "-", "7", "78" ], [ "13", "norwegian", "la det swinge", "let it swing", "-5", "123" ], [ "14", "english", "love is", "-", "4", "100" ], [ "15", "german", "piano , piano", "slowly , slowly", "12", "39" ], [ "16", "swedish", "bra vibrationer", "good vibrations", "3", "103" ], [ "17", "german", "kinder dieser welt", "children of this world", "8", "60" ], [ "18", "french", "children , kinder , enfants", "children", "13", "37" ], [ "19", "greek", "miazoume (μοιάζουμε)", "we are alike", "16", "-20" ] ], "title": "", "original_id": "1879c0387c918a40c8af282feb3c590a" }, { "_id": "b5bed9435cbae047f13073512cc18058", "header": [ "rank", "location", "total passengers", "annual change", "capacity", "capacity in use" ], "rows": [ [ "1", "são paulo", "32777330", "9.24%", "26000000", "126 , 06%" ], [ "2", "rio de janeiro", "17495737", "17.00%", "18000000", "97 , 19%" ], [ "3", "são paulo", "16775770", "0.11%", "12000000", "139 , 79%" ], [ "4", "brasília", "15891530", "3.20%", "10000000", "158 , 91%" ], [ "5", "belo horizonte", "10398296", "9.05%", "5000000", "207 , 96%" ], [ "6", "rio de janeiro", "9002863", "5.73%", "6000000", "150 , 04%" ], [ "7", "campinas", "8858380", "17.04%", "3500000", "253 , 09%" ], [ "8", "salvador", "8811540", "4.96%", "6000000", "146 , 85%" ], [ "9", "porto alegre", "8261355", "5.45%", "6100000", "135 , 43%" ], [ "10", "curitiba", "100000000", "1000.00%", "6000000", "1666 , 67%" ], [ "11", "recife", "6433410", "0.78%", "9000000", "71 , 48%" ], [ "12", "fortaleza", "5964308", "5.61%", "3000000", "198 , 80%" ], [ "13", "vitória", "3642842", "14.46%", "560000", "650 , 50%" ], [ "14", "belém", "3342771", "11.56%", "2700000", "123 , 80%" ], [ "15", "florianópolis", "3395256", "8.75%", "1100000", "308 , 65%" ], [ "16", "manaus", "3131150", "3.70%", "1800000", "173 , 95%" ], [ "17", "goinia", "3076858", "9.80%", "600000", "512 , 80%" ], [ "18", "cuiabá", "2761588", "8.25%", "1600000", "172 , 59%" ], [ "19", "natal", "2660864", "2.88%", "1500000", "177 , 39%" ], [ "20", "são luís", "100", "-100.00%", "1010000", "0 , 01%" ], [ "21", "foz do iguaçu", "1741526", "2.96%", "1500000", "116 , 10%" ], [ "22", "maceió", "1719979", "11.02%", "1200000", "143 , 31%" ], [ "23", "campo grande", "1655073", "9.20%", "900000", "183 , 89%" ], [ "24", "aracaju", "1373401", "25.63%", "1300000", "105 , 64%" ], [ "25", "navegantes", "1277486", "9.38%", "600000", "212 , 91%" ], [ "26", "joão pessoa", "1252559", "9.64%", "860000", "145 , 62%" ], [ "27", "londrina", "1098848", "14.23%", "800000", "137 , 35%" ], [ "28", "ribeirão preto", "1077010", "3.35%", "480000", "224 , 37%" ], [ "29", "porto velho", "1050682", "6.79%", "920000", "114 , 20%" ], [ "30", "teresina", "0", "0.00%", "450000", "0 , 00%" ], [ "31", "uberlndia", "1011490", "11.48%", "600000", "168 , 58%" ], [ "32", "são josé do rio preto", "770569", "15.13%", "270000", "285 , 39%" ], [ "33", "belo horizonte", "774881", "2.33%", "1200000", "64 , 57%" ], [ "34", "maringá", "757719", "13.61%", "430000", "176 , 21%" ], [ "35", "palmas", "579395", "15.09%", "370000", "156 , 59%" ], [ "36", "macapá", "573560", "2.36%", "170000", "337 , 38%" ], [ "37", "ilhéus", "532130", "3.70%", "300000", "177 , 37%" ], [ "38", "santarém", "487168", "5.62%", "225000", "216 , 51%" ], [ "39", "petrolina", "458588", "23.25%", "150000", "305 , 72%" ], [ "40", "juazeiro do norte", "451087", "31.51%", "100000", "451 , 08%" ] ], "title": "", "original_id": "cadae9ae6ae2deeb6f42733b2decab4d" }, { "_id": "8c33b4217c36009bc24af54221a38d14", "header": [ "Club", "Season", "League", "League", "Cup", "Cup", "Continental", "Continental", "Total", "Total" ], "rows": [ [ "Club", "Season", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals" ], [ "River Plate", "1945", "1", "0", "0", "0", "0", "0", "1", "0" ], [ "Huracán (loan)", "1946", "25", "10", "2", "0", "0", "0", "27", "10" ], [ "Huracán (loan)", "Total", "25", "10", "2", "0", "0", "0", "27", "10" ], [ "River Plate", "1947", "30", "27", "0", "0", "2", "1", "32", "28" ], [ "River Plate", "1948", "23", "13", "1", "1", "6", "4", "30", "18" ], [ "River Plate", "1949", "12", "9", "0", "0", "0", "0", "12", "9" ], [ "River Plate", "Total", "66", "49", "1", "1", "8", "5", "75", "55" ], [ "Millonarios", "1949", "14", "16", "0", "0", "0", "0", "14", "16" ], [ "Millonarios", "1950", "29", "23", "2", "1", "0", "0", "31", "24" ], [ "Millonarios", "1951", "34", "32", "4?", "4?", "0", "0", "38?", "36?" ], [ "Millonarios", "1952", "24", "19", "4?", "5?", "0", "0", "28?", "24?" ], [ "Millonarios", "Total", "101", "90", "10", "10", "0", "0", "111", "100" ], [ "Real Madrid", "1953-54", "28", "100", "0", "0", "0", "0", "28", "100" ], [ "Real Madrid", "1954-55", "30", "25", "0", "0", "2", "0", "32", "25" ], [ "Real Madrid", "1955-56", "30", "24", "0", "0", "7", "5", "37", "29" ], [ "Real Madrid", "1956-57", "30", "31", "3", "3", "10", "9", "43", "43" ], [ "Real Madrid", "1957-58", "30", "19", "7", "7", "7", "10", "44", "36" ], [ "Real Madrid", "1958-59", "28", "23", "8", "5", "7", "6", "43", "34" ], [ "Real Madrid", "1959-60", "23", "12", "5", "3", "6", "8", "34", "23" ], [ "Real Madrid", "1960-61", "23", "21", "9", "8", "4", "1", "36", "30" ], [ "Real Madrid", "1961-62", "23", "11", "8", "4", "10", "7", "41", "22" ], [ "Real Madrid", "1962-63", "13", "12", "9", "9", "2", "1", "24", "22" ], [ "Real Madrid", "1963-64", "24", "11", "1", "1", "9", "5", "34", "17" ], [ "Real Madrid", "Total", "282", "216", "50", "40", "64", "52", "396", "308" ], [ "Espanyol", "1964-65", "-10", "7", "3", "2", "0", "0", "-7", "9" ], [ "Espanyol", "1965-66", "23", "4", "4", "1", "6", "0", "33", "5" ], [ "Espanyol", "Total", "47", "11", "7", "3", "6", "0", "60", "14" ], [ "Career totals", "Career totals", "521", "376", "70", "54", "78", "57", "669", "487" ] ], "title": "", "original_id": "ef53d3b9a97d7e762349294a5271f2b8" }, { "_id": "3306e3f9f7d2fc348459114a75c6a05c", "header": [ "language", "sorata municipality", "guanay municipality", "tacacoma municipality", "quiabaya municipality", "combaya municipality", "tipuani municipality", "mapiri municipality", "teoponte municipality" ], "rows": [ [ "quechua", "363.0", "1.653", "1.058", "33.0", "20.0", "1.587", "3.649", "756.0" ], [ "aymara", "16.029", "3.405", "4.389", "2.269", "2.522", "2.534", "1.767", "2.837" ], [ "guaranã­", "7000.0", "5.0", "1.0", "0.0", "0.0", "20.0", "6.0", "6.0" ], [ "another native", "8.0", "94.0", "17.0", "2.0", "1.0", "18.0", "7.0", "22.0" ], [ "spanish", "11.223", "10000.0", "4.321", "1.391", "1.214", "8.594", "8.567", "6.211" ], [ "foreign", "70.0", "86.0", "6.0", "6.0", "1.0", "61.0", "17.0", "33.0" ], [ "only native", "6.68", "737.0", "1.599", "1.023", "1.363", "190.0", "363.0", "472.0" ], [ "native and spanish", "9.54", "4.123", "3.389", "1.256", "1.162", "3.499", "4.653", "2.925" ] ], "title": "", "original_id": "cd7a0470a94744dea67c879191f97bcd" }, { "_id": "c762767b543774419ed8d19b0baf3761", "header": [ "breed", "group", "2002 registrations", "2005 registrations", "2011 registrations" ], "rows": [ [ "bloodhound", "hound group", "80", "104", "59" ], [ "bull terrier (miniature)", "terrier group", "278", "275", "216" ], [ "collie (smooth)", "pastoral group", "85", "72", "75" ], [ "dandie dinmont terrier", "terrier group", "148", "149", "98" ], [ "english setter", "gundog group", "568", "1500", "234" ], [ "english toy terrier (black and tan)", "toy group", "56", "103", "95" ], [ "fox terrier (smooth)", "terrier group", "167", "212", "137" ], [ "glen of imaal terrier", "terrier group", "48", "45", "67" ], [ "gordon setter", "gundog group", "250", "309", "306" ], [ "greyhound", "hound group", "24", "49", "14" ], [ "irish red and white setter", "gundog group", "99", "120", "83" ], [ "irish terrier", "terrier group", "198", "270", "277" ], [ "kerry blue terrier", "terrier group", "244", "277", "10" ], [ "king charles spaniel", "toy group", "150", "193", "180" ], [ "lakeland terrier", "terrier group", "269", "330", "247" ], [ "lancashire heeler", "pastoral group", "125", "166", "98" ], [ "manchester terrier", "terrier group", "86", "140", "152" ], [ "norwich terrier", "terrier group", "153", "131", "158" ], [ "otterhound", "hound group", "54", "50", "38" ], [ "retriever (curly coated)", "gundog group", "79", "82", "72" ], [ "scottish deerhound", "hound group", "231", "264", "237" ], [ "sealyham terrier", "terrier group", "58", "58", "63" ], [ "skye terrier", "terrier group", "59", "30", "44" ], [ "soft coated wheaten terrier", "terrier group", "277", "321", "433" ], [ "spaniel (clumber)", "gundog group", "170", "192", "271" ], [ "spaniel (field)", "gundog group", "84", "86", "55" ], [ "spaniel (irish water)", "gundog group", "145", "106", "117" ], [ "spaniel (sussex)", "gundog group", "82", "77", "68" ], [ "welsh corgi (cardigan)", "pastoral group", "56", "77", "108" ], [ "welsh terrier", "terrier group", "270", "326", "415" ] ], "title": "", "original_id": "db726244de06704566b54e2158b78eaf" }, { "_id": "4a75dbd7372e5edbece891ce9a437722", "header": [ "-", "-", "-", "Regular season", "Regular season", "Regular season", "Regular season", "Regular season", "Playoffs", "Playoffs", "Playoffs", "Playoffs", "Playoffs", "-", "-" ], "rows": [ [ "Season", "Team", "League", "-", "GP", "G", "A", "Pts", "PIM", "-", "GP", "G", "A", "Pts", "PIM" ], [ "2004–05", "KalPa", "Jr. A", "-", "1", "0", "0", "0", "0", "-", "—", "—", "—", "—", "—" ], [ "2005–06", "KalPa", "Jr. A", "-", "29", "9", "5", "14", "46", "-", "5", "0", "0", "0", "0" ], [ "2006–07", "Kamloops Blazers", "WHL", "-", "64", "32", "39", "71", "52", "-", "4", "0", "3", "3", "4" ], [ "2007–08", "Kamloops Blazers", "WHL", "-", "60", "27", "26", "53", "26", "-", "4", "1", "1", "2", "2" ], [ "2008–09", "Espoo Blues", "SM-l", "-", "53", "13", "20", "33", "14", "-", "14", "1", "1", "2", "4" ], [ "2009–10", "Espoo Blues", "SM-l", "-", "54", "8", "13", "21", "64", "-", "2", "0", "1", "1", "0" ], [ "2010–11", "HPK", "SM-l", "-", "59", "26", "12", "38", "46", "-", "2", "1", "0", "1", "4" ], [ "2011–12", "Milwaukee Admirals", "AHL", "-", "55", "50", "50", "100", "8", "-", "—", "—", "—", "—", "—" ], [ "2012–13", "Milwaukee Admirals", "AHL", "-", "73", "15", "16", "31", "14", "-", "4", "0", "0", "0", "4" ], [ "2013–14", "HIFK", "Liiga", "-", "51", "23", "17", "40", "42", "-", "2", "1", "0", "1", "2" ], [ "2014–15", "HIFK", "Liiga", "-", "47", "15", "12", "27", "28", "-", "7", "2", "2", "4", "2" ], [ "2015–16", "HIFK", "Liiga", "-", "50", "13", "14", "27", "18", "-", "14", "4", "5", "9", "6" ], [ "2016–17", "HIFK", "Liiga", "-", "48", "6", "14", "20", "42", "-", "13", "6", "6", "12", "2" ], [ "2017–18", "JYP Jyväskylä", "Liiga", "-", "10", "30", "21", "51", "100", "-", "6", "2", "2", "4", "2" ], [ "2018–19", "Neftekhimik Nizhnekamsk", "KHL", "-", "53", "20", "17", "37", "20", "-", "—", "—", "—", "—", "—" ], [ "Liiga totals", "Liiga totals", "Liiga totals", "-", "415", "134", "123", "258", "298", "-", "60", "17", "17", "34", "22" ] ], "title": "", "original_id": "18c4f4682db495eb559e388d4b71cd96" }, { "_id": "06fc32f72e71278aaa8326271e9cf6ff", "header": [ "peak", "country", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "mount etna", "italy ( sicily )", "3323", "3323", "0" ], [ "monte cinto", "france ( corsica )", "2706", "2706", "0" ], [ "corno grande", "italy", "2912", "2476", "436" ], [ "punta la marmora", "italy ( sardinia )", "1834", "1834", "0" ], [ "monte amaro", "italy", "2795", "1812", "983" ], [ "monte anomaly1", "italy", "10000", "9000", "1000" ], [ "monte dolcedorme", "italy", "2267", "1715", "552" ], [ "montalto", "italy", "1955", "1709", "246" ], [ "monte cimone", "italy", "2165", "1577", "588" ], [ "monte anomaly2", "italy", "100", "50", "50" ] ], "title": "", "original_id": "ae40833e476160358b41b99deb3ab275" }, { "_id": "3f59ee5d1df3b2a7d4de78d62fe6851b", "header": [ "Class", "Image", "Type", "Top speed", "Top speed", "Number", "Built" ], "rows": [ [ "Class", "Image", "Type", "mph", "km/h", "Number", "Built" ], [ "101", "101692 at Arley.JPG", "Diesel multiple unit", "75", "120", "6", "1956-1959" ], [ "142", "-", "Diesel multiple unit", "75", "120", "79", "1985-1987" ], [ "150", "-", "Diesel multiple unit", "75", "120", "27", "1984-1987" ], [ "153", "153316 at Carlisle.JPG", "Diesel multiple unit", "75", "120", "8", "1987-1988" ], [ "156", "156427 at Carlisle.JPG", "Diesel multiple unit", "200", "320", "18", "1987-1989" ], [ "158", "158751 at Westbury.JPG", "Diesel multiple unit", "90", "145", "8", "1989-1992" ], [ "175 Coradia", "-", "Diesel multiple unit", "100", "160", "27", "1999-2001" ], [ "309", "-", "electric multiple unit", "100", "161", "1", "1962-1963" ], [ "322", "-", "Electric multiple unit", "100", "160", "4", "1990" ], [ "323", "323225 at Manchester Piccadilly.JPG", "Electric multiple unit", "90", "145", "17", "2050-2060" ] ], "title": "", "original_id": "66de0cb7d014e3d24b42c571d71c7140" }, { "_id": "a68670e269a7867503de5b6d9f7eb393", "header": [ "economy", "1980", "gap from thailand as of 1980 (times)", "1985", "1990", "1995", "2000", "2005", "2010", "2012", "gap from thailand as of 2012 (times)", "gdp as of 2012 after purchasing power parity (ppp) calculations (usd billions)", "gdp per capita as of 2012 (ppp)" ], "rows": [ [ "china", "205", "0.29", "290", "341", "601", "945", "1726", "4422", "6076", "1.07", "12405.67", "9162" ], [ "hong kong", "5679", "8.16", "6442", "13330", "22939", "25128", "25748", "32429", "36667", "6.46", "369.38", "51494" ], [ "japan", "9309", "13.38", "11461", "25144", "42523", "37303", "35787", "42916", "46735", "8.23", "4627.89", "36265" ], [ "korea", "1689", "2.43", "2414", "6308", "11779", "11347", "17551", "20540", "23113", "4.07", "1613.92", "32272" ], [ "malaysia", "1812", "2.6", "2026", "2432", "4358", "4030", "5211", "8633", "10304", "1.81", "498.48", "100000" ], [ "singapore", "4756", "6.83", "6754", "12387", "23718", "22791", "28498", "44697", "51162", "9.01", "326.51", "60410" ], [ "taiwan", "2363", "3.4", "3271", "8086", "12865", "14641", "16023", "18488", "20328", "3.58", "903.47", "38749" ], [ "korea", "1689", "2.43", "2414", "6308", "11779", "11347", "17551", "20540", "23113", "4.07", "10.92", "32272" ] ], "title": "", "original_id": "4f1c9e36f683c1b7a8fa7a335db8f3c3" }, { "_id": "a27858fe9d504b3a3d61a8bf8e881155", "header": [ "term abroad", "2000 / 01", "2001 / 02", "2002 / 03", "2003 / 04", "2004 / 05", "2005 / 06", "2006 / 07", "2007 / 08", "2008 / 09" ], "rows": [ [ "summer term", "33.7", "34.4", "32.7", "37.0", "37.2", "37.2", "38.7", "38.1", "35.8" ], [ "one semester", "38.5", "39.0", "40.3", "38.1", "37.5", "36.9", "36.3", "35.5", "37.3" ], [ "8 weeks or less during academic year", "7.4", "7.3", "9.4", "8.9", "8.0", "9.5", "9.8", "11.0", "11.7" ], [ "january term", "7.0", "6.0", "50.0", "5.7", "6.0", "5.4", "6.8", "7.2", "7.0" ], [ "academic year", "7.3", "7.8", "6.7", "6.0", "6.0", "5.3", "4.3", "4.1", "4.1" ], [ "one quarter", "4.1", "3.9", "3.8", "3.3", "3.3", "3.3", "3.4", "3.4", "3.3" ], [ "two quarters", "0.6", "0.5", "0.4", "0.5", "1.3", "0.9", "0.5", "0.6", "100.0" ] ], "title": "", "original_id": "558a7154502318571bf00b0fa0773817" }, { "_id": "9f43195a007b7e58295f139fdba110fe", "header": [ "rank", "country (or dependent territory)", "july 1 , 2013 projection", "% of pop", "average relative annual growth (%)", "average absolute annual growth" ], "rows": [ [ "1", "egypt", "84605000.0", "22.81", "2.29", "1893000" ], [ "2", "algeria", "38295000.0", "10.32", "2.11", "792000" ], [ "3", "iraq", "35404000.0", "9.54", "3.06", "1051000" ], [ "4", "sudan", "35150000.0", "9.47", "2.52", "863000" ], [ "5", "morocco", "100000000.0", "30.0", "10.0", "5000000" ], [ "6", "saudi arabia", "30193000.0", "8.14", "3.41", "997000" ], [ "7", "yemen", "25252000.0", "6.81", "2.96", "725000" ], [ "8", "syria", "22169000.0", "5.98", "2.45", "531000" ], [ "9", "tunisia", "10889000.0", "2.94", "1.03", "111000" ], [ "10", "somalia", "9662000.0", "2.6", "1.17", "112000" ], [ "11", "united arab emirates", "8659000.0", "2.33", "1.56", "133000" ], [ "12", "jordan", "1000.0", "0.01", "-5.0", "-10000" ], [ "13", "libya", "6323000.0", "1.7", "1.56", "97000" ], [ "14", "palestine", "4421000.0", "1.19", "2.91", "125000" ], [ "15", "lebanon", "4127000.0", "1.11", "1.58", "64000" ], [ "16", "oman", "3942000.0", "1.06", "8.8", "319000" ], [ "17", "kuwait", "3852000.0", "1.04", "2.94", "110000" ], [ "18", "mauritania", "3461000.0", "0.93", "2.58", "87000" ], [ "19", "qatar", "1917000.0", "0.52", "3.85", "71000" ], [ "20", "bahrain", "1546000.0", "0.42", "7.36", "106000" ], [ "21", "djibouti", "912000.0", "0.25", "2.7", "24000" ], [ "22", "comoros", "743000.0", "0.2", "2.62", "19000" ], [ "align = left|total", "370989000", "100.0", "2.42", "8763000.0", "29" ] ], "title": "", "original_id": "ebaeb6688f63e8773d574ff53c90316c" }, { "_id": "f8fc7f173f77c628ba87fca6da0dcdc0", "header": [ "Row Header", "Year Ended December 31, 2018 (In cents, except percentage changes)", "Year Ended December 31, 2017 (In cents, except percentage changes)", "Percent Increase (Decrease) (In cents, except percentage changes)" ], "rows": [ [ "Total CASM: Aircraft fuel and related taxes", "2.86", "2.22", "28.8" ], [ "Total CASM: Salaries, wages and benefits", "4.34", "4.32", "0.5" ], [ "Total CASM: Maintenance, materials and repairs", "0.73", "0.71", "50.0" ], [ "Total CASM: Other rent and landing fees", "0.67", "0.65", "3.1" ], [ "Total CASM: Aircraft rent", "0.45", "0.43", "3.5" ], [ "Total CASM: Selling expenses", "0.54", "0.53", "-10.0" ], [ "Total CASM: Depreciation and amortization", "0.65", "0.62", "5.9" ], [ "Total CASM: Special items, net", "0.28", "0.26", "8.3" ], [ "Total CASM: Other", "1.80", "1.78", "1.6" ], [ "Regional expenses: Aircraft fuel and related taxes", "0.65", "0.50", "30.7" ], [ "Regional expenses: Other", "100.00", "1.87", "5221.9" ], [ "Regional expenses: Total CASM", "14.85", "13.88", "6.9" ], [ "Special items, net: Special items, net", "(0.28)", "(0.26)", "8.3" ], [ "Special items, net: Regional operating special items, net", "—", "(0.01)", "nm (1)" ], [ "Aircraft fuel and related taxes Aircraft fuel and related taxes - mainline", "(2.86)", "(2.22)", "28.8" ], [ "Aircraft fuel and related taxes Aircraft fuel and related taxes - regional", "(0.65)", "(0.50)", "30.7" ], [ "Aircraft fuel and related taxes Total CASM, excluding special items and fuel", "11.06", "10.90", "1.4" ] ], "title": "", "original_id": "d74bd0f451fc44950fd4887cbc214eae" }, { "_id": "0b8a37539f3450e2afbce8e27d7ec592", "header": [ "number", "symbol", "name", "21st", "22nd", "23rd", "24th", "25th", "26th", "27th", "28th", "29th", "30th" ], "rows": [ [ "21", "Sc", "scandium", "582163", null, null, null, null, null, null, null, null, null ], [ "22", "Ti", "titanium", "602930", "639294.0", null, null, null, null, null, null, null, null ], [ "23", "V", "vanadium", "151440", "661050.0", "699144.0", null, null, null, null, null, null, null ], [ "24", "Cr", "chromium", "157700", "166090.0", "721870.0", "761733.0", null, null, null, null, null, null ], [ "25", "Mn", "manganese", "158600", "172500.0", "181380.0", "785450.0", "827067.0", null, null, null, null, null ], [ "26", "Fe", "iron", "163000", "173600.0", "188100.0", "195200.0", "851800.0", "895161.0", null, null, null, null ], [ "27", "Co", "cobalt", "167400", "178100.0", "189300.0", "204500.0", "214100.0", "920870.0", "966023.0", null, null, null ], [ "28", "Ni", "nickel", "169400", "182700.0", "194000.0", "205600.0", "221400.0", "231490.0", "992718.0", "1039668.0", null, null ], [ "29", "Cu", "copper", "174100", "184900.0", "198800.0", "210500.0", "222700.0", "239100.0", "249660.0", "1067358.0", "1116105.0", null ], [ "30", "Zn", "zinc", "179100", null, null, null, null, null, null, null, null, null ], [ "36", "Kr", "krypton", "85300", "90400.0", "96300.0", "101400.0", "111100.0", "116290.0", "282500.0", "296200.0", "311400.0", "326200.0" ], [ "42", "Mo", "molybdenum", "87000", "93400.0", "98420.0", "104400.0", "121900.0", "127700.0", "133800.0", "139800.0", "148100.0", "154500.0" ] ], "title": "", "original_id": "381b3da7c2758e821a32852d99d1ef92" }, { "_id": "f95fe07f5a6c458d93f0e1eae5968bc1", "header": [ "Round", "Václav Klaus", "Václav Klaus", "Jaroslava Moserová", "Jaroslava Moserová", "Miloš Zeman", "Miloš Zeman" ], "rows": [ [ "Round", "Deputies", "Senators", "Deputies", "Senators", "Deputies", "Senators" ], [ "1st", "89", "32", "25", "43", "78", "5" ], [ "1st", "121", "121", "68", "68", "83", "83" ], [ "2nd", "85", "33", "32", "42", "-", "-" ], [ "2nd", "118", "118", "74", "74", "-", "-" ], [ "3rd", "95", "32", "26", "39", "-", "-" ], [ "3rd", "127", "127", "65", "65", "-", "-" ] ], "title": "", "original_id": "c8223578cf6dbfd367df3afbb270a180" }, { "_id": "d8534b59f93f2f4ea74708bfa6422b9c", "header": [ "males rank", "females rank", "state", "hiv awareness (males%)", "females (%)" ], "rows": [ [ "1", "2", "kerala", "99", "95" ], [ "2", "1", "manipur", "99", "99" ], [ "3", "3", "tamil nadu", "98", "94" ], [ "4", "3", "mizoram", "96", "94" ], [ "5", "10", "andhra pradesh", "93", "74" ], [ "6", "5", "goa", "92", "83" ], [ "6", "7", "himachal pradesh", "92", "79" ], [ "6", "12", "punjab", "92", "70" ], [ "9", "15", "nagaland", "91", "81" ], [ "10", "8", "uttarakhand", "90", "79" ], [ "11", "7", "maharashtra", "87", "82" ], [ "12", "9", "sikkim", "89", "75" ], [ "12", "11", "tripura", "89", "73" ], [ "14", "17", "jammu and kashmir", "88", "61" ], [ "15", "18", "haryana", "87", "60" ], [ "16", "13", "karnataka", "85", "66" ], [ "17", "23", "gujarat", "80", "49" ], [ "17", "19", "whole india", "80", "57" ], [ "19", "13", "arunachal pradesh", "75", "66" ], [ "19", "21", "assam", "75", "53" ], [ "21", "28", "west bengal", "74", "50" ], [ "21", "26", "uttar pradesh", "74", "40" ], [ "21", "22", "rajasthan", "74", "34" ], [ "24", "16", "odisha", "73", "62" ], [ "25", "27", "bihar", "70", "35" ], [ "26", "24", "madhya pradesh", "68", "45" ], [ "27", "25", "chattisgarh", "67", "41" ], [ "28", "19", "meghalaya", "63", "57" ], [ "29", "29", "jharkhand", "53", "29" ] ], "title": "", "original_id": "dcee3efa18d9eb2b672f632300e2df53" }, { "_id": "f3de55fc70e240884e89dcb05517de45", "header": [ "Row Header", "Total", "Owned", "Leased", "Seats in Standard Configuration", "Average Age (In Years)" ], "rows": [ [ "777-300ER", "14", "14", "—", "366", "0.7" ], [ "777-200ER", "55", "40", "15", "267-269", "17.8" ], [ "777-200", "19", "19", "—", "364", "20.5" ], [ "787-9", "21", "21", "—", "252", "2.1" ], [ "787-8", "12", "12", "—", "219", "4.5" ], [ "767-400ER", "16", "14", "2", "242", "16.3" ], [ "767-300ER", "35", "22", "13", "183-214", "22.5" ], [ "757-300", "21", "9", "12", "213", "15.3" ], [ "757-200", "56", "50", "6", "142-169", "21.7" ], [ "737-900ER", "136", "136", "—", "179", "5.0" ], [ "737-900", "12", "8", "4", "179", "16.3" ], [ "737-800", "141", "77", "64", "154-166", "13.8" ], [ "737-700", "40", "20", "20", "118-126", "18.8" ], [ "A320-200", "99", "66", "33", "150", "19.3" ], [ "A319-100", "67", "50", "17", "128", "16.7" ], [ "Total mainline", "744", "558", "186", "", "14.3" ] ], "title": "", "original_id": "6237bbbb18e2f1614656f1730f37f02a" }, { "_id": "ec68c9b1129e1a66bf85b102efe4cd24", "header": [ "building", "height", "floors", "built", "city", "architect" ], "rows": [ [ "eaton 's department store", "46", "9", "1904", "winnipeg", "john woodman" ], [ "union bank tower", "48", "10", "1904", "winnipeg", "darling and pearson" ], [ "lindsay building", "44", "11", "1911", "winnipeg", "woodman and carey" ], [ "confederation building", "46", "12", "1911", "winnipeg", "j wilson gray" ], [ "national bank building", "50", "13", "1911", "winnipeg", "john d atchison" ], [ "electric railway chambers", "45", "12", "1912", "winnipeg", "pratt and ross , charles s frost" ], [ "hotel fort garry", "59", "14", "1913", "winnipeg", "ross and macfarlane" ], [ "marlbourgh hotel", "42", "10", "1913", "winnipeg", "j chisholm & son" ], [ "paris building", "42", "11", "1915", "winnipeg", "woodman and carey" ], [ "bank of hamilton building", "45", "10", "1916", "winnipeg", "john d atchison" ], [ "manitoba legislative building", "79", "5", "1920", "winnipeg", "simon and boddington" ] ], "title": "", "original_id": "56fb46be47a462ccb8af7c501404ce76" }, { "_id": "01882e70a5479c6efdd02f2e3da2a405", "header": [ "round", "pick", "overall", "name", "position", "college" ], "rows": [ [ "1", "13", "13", "brian orakpo", "de", "texas" ], [ "3", "16", "80", "kevin barnes", "cb", "maryland" ], [ "5", "22", "158", "cody glenn", "lb", "nebraska" ], [ "6", "13", "186", "robert henson", "lb", "texas christian" ], [ "7", "12", "221", "eddie williams", "te", "idaho" ], [ "7", "34", "243", "marko mitchell", "wr", "nevada" ] ], "title": "", "original_id": "4c147e78894f919ff89514f23c84bc12" }, { "_id": "1139fa365500821052a27ced59ca1fb0", "header": [ "metropolitan ring", "localities", "total", "jews and others 1", "thereof : jews", "arabs", "population density (per km square)", "annual population growth rate" ], "rows": [ [ "core 2", "1", "264800", "237800", "214200", "27100", "3838.2", "0.0%" ], [ "inner ring 3", "30", "271200", "241700", "224500", "29500", "1046.8", "0.5%" ], [ "northern section", "3", "112400", "112300", "101900", "100", "5591.7", "- 0.2%" ], [ "eastern section", "16", "84000", "80100", "76000", "4000", "1014.9", "1.0%" ], [ "southern section", "11", "74800", "49300", "46700", "25500", "481.4", "1.0%" ], [ "outer ring 4", "98", "484900", "240100", "223000", "244900", "678.8", "1.8%" ], [ "northern section", "57", "362800", "147300", "134500", "215600", "948.1", "1.6%" ], [ "eastern section", "23", "82300", "64300", "60800", "18000", "534.5", "1.7%" ], [ "southern section", "18", "39800", "28500", "27800", "11300", "224.0", "3.7%" ] ], "title": "", "original_id": "ce2930301220686e3acbc890a52ba84d" }, { "_id": "f14161e603da2313cb849b9832a02ec3", "header": [ "year", "property taxes", "investment earnings", "other local sources", "state & federal", "total revenue" ], "rows": [ [ "2005", "24384901", "255041", "2670060", "13581968", "40891700" ], [ "2004", "21099214", "181103", "2624131", "13999169", "37903617" ], [ "2003", "17199210", "509862", "2309087", "12794922", "32539572" ], [ "2002", "14359199", "879398", "2168096", "15132879", "32539572" ], [ "2001", "11631227", "1949885", "1987436", "12929489", "28498037" ], [ "2000", "10608734", "493839", "2127480", "8549565", "21779618" ] ], "title": "", "original_id": "106f3d501745fe92f5e6b513acff4a61" }, { "_id": "2f288898fd45e256707a7c21c5c1e527", "header": [ "Canal", "Length (miles)", "Locks", "Max length (ft)", "Width (ft)", "Year opened", "Year abandoned", "Year restored" ], "rows": [ [ "Aberdeenshire Canal", "18.0", "18.0", null, null, "1805.0", "1854.0", null ], [ "Buchan Canal", null, null, null, null, null, null, null ], [ "Caledonian Canal", "62.0", "29.0", "150.0", "35.0", "1822.0", null, null ], [ "Crinan Canal", "9.0", "15.0", "86.75", "19.65", "1817.0", null, null ], [ "Dingwall Canal", "1.1", "0.0", null, null, "1816.0", "1840.0", null ], [ "Forth and Clyde Canal", "35.0", "38.0", "68.58", "19.75", "1790.0", "1963.0", "2002.0" ], [ "Glasgow, Paisley and Johnstone Canal", "11.0", "0.0", null, null, "1811.0", "1881.0", null ], [ "Monkland Canal", "12.25", "18.0", "71.0", "14.0", "1794.0", "1942.0", null ], [ "Stevenston Canal", "2.25", "0.0", null, "13.0", "1772.0", "1830.0", null ], [ "Union Canal", "31.5", "3.0", "63.0", "12.5", "1822.0", "1930.0", "2000.0" ] ], "title": "", "original_id": "3b8eafab24cc0cc641819cebe50d9764" }, { "_id": "c700b2088bc72bf3b7f32b2f159e6e3d", "header": [ "country", "year", "total", "hydroelectricity", "wind power", "biomass and waste", "solar" ], "rows": [ [ "china", "2011", "797.4", "687.1", "73.2", "34", "3.0" ], [ "european union", "2010", "699.3", "397.7", "149.1", "123.3", "23.1" ], [ "united states", "2011", "520.1", "325.1", "119.7", "56.7", "1.81" ], [ "brazil", "2011", "459.2", "424.3", "2.71", "32.2", "0.0002" ], [ "canada", "2011", "399.1", "372.6", "19.7", "6.4", "0.43" ], [ "russia", "2010", "166.6", "163.3", "0.004", "2.8", "0.0" ], [ "india", "2011", "162.0", "131.0", "26.0", "4", "1.0" ], [ "germany", "2012", "136.1", "21.2", "45.3", "40.9", "28.0" ], [ "norway", "2011", "121.4", "119.6", "1.29", "0.48", "0.02" ], [ "japan", "2011", "116.4", "82.5", "4.35", "23.1", "3.8" ], [ "italy", "2012", "89.759", "43.256", "13.333", "9.281 (2010)", "18.637" ] ], "title": "", "original_id": "f8d592d15f1611f0aa015d7ee3d75a23" }, { "_id": "730733827c922ab2699d662df2502b94", "header": [ "driver", "points", "races", "wins", "second", "third" ], "rows": [ [ "gunther gooverts", "182", "27", "2", "-", "3" ], [ "gunther gooverts", "135", "18", "1", "2", "1" ], [ "gunther gooverts", "27", "8", "-", "-", "1" ], [ "gunther gooverts", "155", "16", "-", "3", "2" ], [ "gert devoldere", "3", "2", "-", "-", "-" ], [ "daniël willemsen", "40", "2", "2", "-", "-" ], [ "martin gölz", "90", "20", "-", "-", "-" ], [ "gerton kops", "17", "2", "-", "-", "-" ], [ "peter steegmans", "16", "2", "-", "-", "-" ], [ "daniël willemsen", "320", "22", "5", "4", "7" ], [ "daniël willemsen", "377", "22", "8", "5", "3" ], [ "are kaurit", "268", "16", "-", "3", "2" ], [ "daniël willemsen", "88", "4", "-", "4", "-" ], [ "kristers serģis", "501", "26", "12", "7", "1" ], [ "kristers serģis", "246", "12", "6", "1", "2" ], [ "frank hofman", "22", "2", "-", "-", "-" ], [ "daniël willemsen", "478", "22", "15", "4", "-" ], [ "daniël willemsen", "341", "16", "13", "-", "-" ], [ "nicky pulinx", "22", "4", "-", "-", "-" ], [ "jarno van den boomen", "8", "2", "-", "-", "-" ], [ "gerrit van werven", "6", "2", "-", "-", "-" ], [ "daniël willemsen", "341", "17", "11", "-", "-" ], [ "peter steegmans", "212", "20", "-", "1", "1" ], [ "daniël willemsen", "437", "21", "14", "3", "-" ], [ "ben adriaenssen", "385", "22", "-", "-", "6" ], [ "overall 1993 - 2012", "4717", "327", "89", "37", "29" ] ], "title": "", "original_id": "22ca06f97417eaae94a58549e8bfd1d4" }, { "_id": "041b787351f2709197ed40b9bd3cd5cd", "header": [ "round", "pick", "overall", "name", "position", "college" ], "rows": [ [ "1", "10", "10", "forest evashevski", "rb", "michigan" ], [ "3", "10", "25", "fred davis", "ot", "alabama" ], [ "5", "10", "40", "jim stuart", "ot", "oregon" ], [ "6", "10", "50", "ed cifers", "e", "tennessee" ], [ "7", "10", "60", "al krueger", "e", "southern california" ], [ "8", "10", "70", "henry wilder", "rb", "iowa state" ], [ "9", "10", "80", "bill grimmett", "e", "tulsa" ], [ "10", "10", "90", "ed hickerson", "g", "alabama" ], [ "11", "10", "100", "joe aguirre", "e", "st mary 's (cal)" ], [ "12", "10", "110", "jack banta", "hb", "southern california" ], [ "13", "10", "120", "roy conn", "ot", "arizona" ], [ "14", "10", "130", "deward tornell", "rb", "san josé state" ], [ "15", "10", "140", "morris buckingham", "c", "san josé state" ], [ "16", "10", "150", "ken dow", "fb", "oregon state" ], [ "17", "10", "160", "stan mcrae", "e", "michigan state" ], [ "18", "10", "170", "joe osmanski", "fb", "holy cross" ], [ "19", "10", "180", "earl fullilove", "ot", "georgetown" ], [ "20", "10", "190", "ed hiestand", "e", "vanderbilt" ], [ "21", "5", "195", "tom riggs", "ot", "illinois" ], [ "22", "5", "200", "lee gentry", "hb", "tulsa" ] ], "title": "", "original_id": "b23a9876b3db50bf256522a0342f666d" }, { "_id": "04f1c77ae5297b89160a5b541e06dfec", "header": [ "locomotive", "type", "builder", "builder 's no", "built", "entered service", "withdrawn" ], "rows": [ [ "2", "0 - 6 - 0st", "beyer peacock & co", "2575", "1884", "1884", "1938" ], [ "3", "0 - 6 - 0st", "beyer peacock & co", "4558", "1903", "1903", "1920" ], [ "62xx", "0 - 6 - 0", "robert stephenson and company", "2195", "1874", "1903", "1927" ], [ "2020", "2 - 6 - 4t", "beyer peacock & co", "3206", "1891", "1834", "1955" ], [ "2017", "2 - 6 - 4t", "beyer peacock & co", "3289", "1891", "1939", "1956" ], [ "1", "2 - 6 - 2t", "robert stephenson and hawthorns", "e7841", "1955", "1955", "1967" ], [ "j & a brown 26", "2 - 6 - 4t", "beyer peacock & co", "2567", "1885", "1967", "1967" ], [ "3013", "4 - 6 - 4t", "beyer peacock & co", "4456", "1903", "1967", "1976" ] ], "title": "", "original_id": "13268aef491b17ad2d89c67d8bfa336d" }, { "_id": "168cc4c20c2c074cc1c50ae6b987594f", "header": [ "country", "orphans as % of all children", "aids orphans as % of orphans", "total orphans (total)", "total orphans (aids related)", "maternal (total)", "maternal (aids related)", "paternal (total)", "paternal (aids related)", "double (total)", "double (aids related)" ], "rows": [ [ "botswana (1990)", "5.9", "3.0", "34000", "1000", "14000", "< 100", "23000", "1000", "2000", "< 100" ], [ "botswana (1995)", "8.3", "33.7", "52000", "18000", "19000", "7000", "37000", "13000", "5000", "3000" ], [ "botswana (2001)", "15.1", "70.5", "98000", "69000", "69000", "58000", "91000", "69000", "62000", "61000" ], [ "lesotho (1990)", "10.6", "2.9", "73000", "< 100", "31000", "< 100", "49000", "< 100", "8000", "< 100" ], [ "lesotho (1995)", "10.3", "5.5", "77000", "4000", "31000", "1000", "52000", "4000", "7000", "1000" ], [ "lesotho (2001)", "17.0", "53.5", "137000", "73000", "66000", "38000", "108000", "63000", "37000", "32000" ], [ "malawi (1990)", "11.8", "5.7", "524000", "30000", "233000", "11000", "346000", "23000", "55000", "6000" ], [ "malawi (1995)", "14.2", "24.6", "664000", "163000", "305000", "78000", "442000", "115000", "83000", "41000" ], [ "malawi (2001)", "17.5", "49.9", "937000", "468000", "506000", "282000", "624000", "315000", "194000", "159000" ], [ "uganda (1990)", "12.2", "17.4", "1015000", "177000", "437000", "72000", "700000", "138000", "122000", "44000" ], [ "uganda (1995)", "14.9", "42.4", "1456000", "617000", "720000", "341000", "1019000", "450000", "282000", "211000" ], [ "uganda (2001)", "14.6", "51.1", "1731000", "884000", "902000", "517000", "1144000", "581000", "315000", "257000" ] ], "title": "", "original_id": "5876f5eaa7677055acaf8f89e1215cd8" }, { "_id": "63c78bea545ddcd228dede2c58e56af3", "header": [ "rank", "airline / holding", "passenger fleet", "current destinations", "alliance / association" ], "rows": [ [ "1", "lufthansa group", "627", "283", "star alliance" ], [ "2", "ryanair", "305", "176", "elfaa" ], [ "3", "air france - klm", "621", "246", "skyteam" ], [ "4", "international airlines group", "435", "207", "oneworld" ], [ "5", "easyjet", "194", "126", "elfaa" ], [ "6", "turkish airlines", "222", "245", "star alliance" ], [ "7", "air berlin group", "153", "145", "oneworld" ], [ "8", "aeroflot group", "239", "189", "skyteam" ], [ "9", "sas group", "173", "157", "star alliance" ], [ "10", "alitalia", "143", "101", "skyteam" ], [ "11", "norwegian air shuttle asa", "79", "120", "elfaa" ], [ "12", "pegasus airlines", "42", "70", "n / a" ], [ "13", "wizz air", "45", "83", "elfaa" ], [ "14", "transaero", "93", "113", "n / a" ], [ "15", "tap portugal", "71", "80", "star alliance" ], [ "16", "aer lingus", "46", "75", "n / a" ], [ "17", "finnair", "44", "65", "oneworld" ], [ "18", "s7", "52", "90", "oneworld" ], [ "19", "air europa", "40", "54", "skyteam" ], [ "20", "utair aviation", "108", "117", "n / a" ], [ "21", "sunexpress", "23", "48", "n / a" ], [ "22", "flybe", "68", "56", "elfaa" ], [ "23", "brussels airlines", "45", "67", "star alliance" ], [ "24", "aegean airlines", "29", "40", "star alliance" ], [ "25", "monarch airlines", "39", "30", "n / a" ], [ "26", "virgin atlantic", "41", "37", "n / a" ], [ "27", "atlasjet", "15", "15", "n / a" ], [ "28", "lot polish airlines", "40", "54", "star alliance" ], [ "29", "jet2.com", "49", "59", "elfaa" ], [ "30", "meridiana fly", "18", "40", "n / a" ], [ "31", "ural airlines", "29", "66", "n / a" ], [ "32", "czech airlines", "25", "49", "skyteam" ], [ "33", "airbaltic", "28", "60", "n / a" ], [ "34", "onur air", "29", "21", "n / a" ], [ "35", "ukraine international airlines", "40", "54", "n / a" ], [ "36", "olympic air", "16", "37", "n / a" ], [ "37", "tarom", "23", "48", "skyteam" ], [ "38", "icelandair", "27", "36", "n / a" ], [ "39", "croatia airlines", "13", "40", "star alliance" ], [ "40", "air serbia", "13", "34", "n / a" ], [ "41", "belavia", "23", "40", "n / a" ], [ "42", "cyprus airways", "9", "18", "n / a" ], [ "43", "bulgaria air", "11", "22", "n / a" ], [ "44", "adria airways", "12", "37", "star alliance" ] ], "title": "", "original_id": "6b1d72a62b98d5e4cc0ab30df170fe0d" }, { "_id": "3b4a8db1540c25df2e2c53242efd2b78", "header": [ "rank", "airport", "city", "code (iata / icao)", "2008", "2009", "2010" ], "rows": [ [ "1", "henri coandă international airport", "bucharest", "otp / lrop", "5063555", "4480765", "4802510" ], [ "2", "traian vuia international airport", "timișoara", "tsr / lrtr", "886083", "991737", "1136064" ], [ "3", "cluj - napoca international airport", "cluj - napoca", "clj / lrcl", "752181", "834400", "1028907" ], [ "4", "aurel vlaicu international airport", "bucharest", "bbu / lrob", "1724633", "1974337", "1881509" ], [ "5", "george enescu international airport", "bacău", "bcm / lrbc", "116492", "195772", "240735" ], [ "6", "trgu mureș transilvania airport", "trgu mureș", "tgm / lrtm", "69945", "84062", "74353" ], [ "7", "sibiu international airport", "sibiu", "sbz / lrsb", "141032", "148527", "198753" ], [ "8", "iași international airport", "iași", "ias / lria", "144043", "148538", "159615" ], [ "9", "mihail kogălniceanu international airport", "constanța", "cnd / lrck", "60477", "68690", "74587" ], [ "10", "oradea airport", "oradea", "omr / lrod", "38843", "41692", "36477" ], [ "11", "craiova international airport", "craiova", "cra / lrcv", "12988", "15130", "23629" ], [ "12", "suceava ștefan cel mare airport", "suceava", "scv / lrsv", "23398", "32561", "34437" ], [ "13", "satu mare international airport", "satu mare", "suj / lrsm", "7298", "11101", "18859" ], [ "14", "baia mare airport", "baia mare", "bay / lrbm", "22307", "23818", "19020" ], [ "15", "arad international airport", "arad", "arw / lrar", "78047", "44743", "8359" ], [ "16", "tulcea danube delta airport", "tulcea", "tce / lrtc", "788", "854", "427" ] ], "title": "", "original_id": "223b47a687dda4049cbd996cc8e111be" }, { "_id": "6d85772402e8a49d79b204ccf6080b18", "header": [ "Club", "Season", "League", "League", "League", "FA Cup", "FA Cup", "League Cup", "League Cup", "Other", "Other", "Total", "Total" ], "rows": [ [ "Club", "Season", "Division", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals", "Apps", "Goals" ], [ "Stoke City", "1998–99", "Second Division", "4", "0", "0", "0", "0", "0", "1", "0", "5", "0" ], [ "Stoke City", "1999–2000", "Second Division", "42", "5", "1", "0", "3", "0", "9", "3", "55", "8" ], [ "Stoke City", "2000–01", "Second Division", "44", "8", "1", "0", "5", "2", "4", "0", "54", "10" ], [ "Stoke City", "2001–02", "Second Division", "43", "2", "4", "0", "0", "0", "3", "1", "50", "3" ], [ "Stoke City", "2002–03", "First Division", "43", "0", "3", "0", "1", "0", "0", "0", "47", "0" ], [ "Stoke City", "Total", "Total", "176", "16", "9", "0", "9", "2", "17", "4", "211", "22" ], [ "West Bromwich Albion", "2003–04", "First Division", "30", "0", "1", "0", "5", "0", "0", "0", "36", "0" ], [ "West Bromwich Albion", "2004–05", "Premier League", "0", "0", "1", "0", "1", "0", "0", "0", "2", "0" ], [ "West Bromwich Albion", "Total", "Total", "30", "0", "2", "0", "6", "0", "0", "0", "38", "0" ], [ "Burnley", "2004–05", "Championship", "21", "2", "1", "0", "1", "0", "0", "0", "23", "2" ], [ "Burnley", "2005–06", "Championship", "45", "3", "1", "0", "3", "0", "0", "0", "49", "3" ], [ "Burnley", "2006–07", "Championship", "42", "3", "1", "0", "1", "0", "0", "0", "44", "3" ], [ "Burnley", "2007–08", "Championship", "29", "3", "1", "0", "3", "0", "0", "0", "33", "3" ], [ "Burnley", "Total", "Total", "137", "11", "4", "0", "8", "0", "0", "0", "149", "11" ], [ "Sheffield Wednesday", "2008–09", "Championship", "41", "0", "1", "0", "1", "0", "0", "0", "43", "0" ], [ "Sheffield Wednesday", "2009–10", "Championship", "44", "3", "1", "0", "1", "0", "0", "0", "46", "3" ], [ "Sheffield Wednesday", "2010–11", "League One", "36", "2", "4", "0", "2", "0", "3", "2", "45", "4" ], [ "Sheffield Wednesday", "2011–12", "League One", "18", "1", "1", "0", "2", "0", "1", "0", "22", "1" ], [ "Sheffield Wednesday", "Total", "Total", "139", "6", "7", "0", "6", "0", "4", "2", "156", "8" ], [ "Career Total", "Career Total", "Career Total", "482", "33", "22", "0", "29", "2", "21", "6", "554", "41" ] ], "title": "", "original_id": "86f27f6eb9945a8e587457aca56b0309" }, { "_id": "ca5b2fbc6211d4f1baba4bce38f6e887", "header": [ "aircraft", "introduced", "retired", "seating", "notes" ], "rows": [ [ "airbus a319 - 100", "2004", "-", "156", "in service" ], [ "airbus a320 - 200", "2008", "-", "180", "in service" ], [ "airbus a321 - 200", "2008", "2010", "220", "inherited from gb airways" ], [ "boeing 737 - 204", "1995", "1996", "115", "replaced by 737 - 300s" ], [ "boeing 737 - 300", "1996", "2007", "148 / 9", "replaced by a319s" ], [ "boeing 737 - 700", "2000", "2011", "149", "replaced by a319s and a320s" ] ], "title": "", "original_id": "5493c5c3be6eea36c6ff32cce6255f8c" }, { "_id": "a253219fdb22abb63c22f828a55fb547", "header": [ "ensemble", "gold medals", "silver medals", "bronze medals", "total medals" ], "rows": [ [ "amador valley hs", "0", "1", "0", "1" ], [ "ayala high school", "4", "2", "1", "7" ], [ "baldwinsville hs", "2", "0", "0", "2" ], [ "claremont hs", "1", "1", "0", "2" ], [ "downers grove hs", "0", "0", "1", "1" ], [ "father ryan hs", "0", "1", "0", "1" ], [ "fort mill hs", "2", "1", "2", "5" ], [ "franklin central hs", "6", "0", "0", "6" ], [ "gateway high school", "2", "1", "1", "4" ], [ "goshen hs", "0", "2", "1", "3" ], [ "harrison central paragon hs", "0", "0", "1", "1" ], [ "james logan high school", "1", "1", "0", "2" ], [ "john overton hs", "0", "1", "2", "3" ], [ "king philip high school", "0", "1", "0", "1" ], [ "mansfield hs", "0", "1", "0", "1" ], [ "mission viejo high school", "0", "1", "0", "1" ], [ "muscle shoals hs", "1", "1", "2", "4" ], [ "new philadelphia hs", "0", "1", "0", "1" ], [ "northglenn hs", "0", "0", "1", "1" ], [ "rangeview hs", "0", "1", "0", "1" ], [ "roland hayes school", "0", "0", "1", "1" ], [ "tarpon springs hs", "0", "1", "0", "1" ], [ "tunstall hs", "0", "3", "4", "7" ], [ "warsaw community hs", "0", "0", "1", "1" ], [ "woodbridge hs", "1", "0", "0", "1" ] ], "title": "", "original_id": "c56b85419c6abec8753dcc96be88024f" }, { "_id": "341a0f8a4383584f3bd2eba5812c9175", "header": [ "producer", "product", "samples taken", "samples failed", "melamine content (mg / kg)" ], "rows": [ [ "shijiazhuang sanlu group", "三鹿牌嬰幼兒配方乳粉", "11", "11", "2563.0" ], [ "shanghai panda dairy", "熊貓可寶牌嬰幼兒配方乳粉", "5", "3", "619.0" ], [ "qingdao shengyuan dairy", "聖元牌嬰幼兒配方乳粉", "17", "8", "150.0" ], [ "shanxi gu cheng dairy", "古城牌嬰幼兒配方乳粉", "13", "4", "141.6" ], [ "jiangxi guangming yingxiong dairy", "英雄牌嬰幼兒配方乳粉", "2", "2", "98.6" ], [ "baoji huimin dairy", "惠民牌嬰幼兒配方乳粉", "1", "1", "79.17" ], [ "inner mongolia mengniu dairy", "蒙牛牌嬰幼兒配方乳粉", "28", "3", "68.2" ], [ "torador dairy industry (tianjin)", "可淇牌嬰幼兒配方乳粉", "1", "1", "67.94" ], [ "guangdong yashili group", "雅士利牌嬰幼兒配方乳粉", "30", "8", "53.4" ], [ "hunan peiyi dairy", "南山倍益牌嬰幼兒配方乳粉", "3", "1", "53.4" ], [ "heilongjiang qilin dairy", "嬰幼兒配方乳粉2段基粉", "1", "1", "31.74" ], [ "shanxi yashili dairy", "雅士利牌嬰幼兒配方乳粉", "4", "2", "26.3" ], [ "shenzhen jinbishi milk", "金必氏牌嬰幼兒配方乳粉", "2", "2", "18.0" ], [ "scient (guangzhou) infant nutrition", "施恩牌嬰幼兒配方乳粉", "20", "14", "17.0" ], [ "guangzhou jinding dairy products factory", "金鼎牌嬰幼兒配方乳粉", "3", "1", "16.2" ], [ "inner mongolia yili industrial group", "伊利牌兒童配方乳粉", "35", "1", "12.0" ], [ "yantai ausmeadow nutriment", "澳美多牌嬰幼兒配方乳粉", "16", "6", "10.7" ], [ "qingdao suncare nutritional technology", "愛可丁牌嬰幼兒配方乳粉", "3", "1", "4.8" ], [ "xi'an baiyue dairy", "御寶牌嬰幼兒配方乳粉", "3", "1", "3.73" ], [ "yantai leilei dairy", "磊磊牌嬰幼兒配方乳粉", "3", "3", "1.2" ], [ "shanghai baoanli dairy", "寶安力牌嬰幼兒配方乳粉", "1", "1", "0.21" ], [ "fuding chenguan dairy", "聰爾壯牌嬰幼兒配方乳粉", "1", "1", "0.09" ] ], "title": "", "original_id": "07ff6fa731c9061bf28789d3352ccd5c" }, { "_id": "2293486fab949514c949e36ebfad551d", "header": [ "Party", "First Duma", "Second Duma", "Third Duma", "Fourth Duma" ], "rows": [ [ "Russian Social Democratic Party", "18 (Mensheviks)", "47 (Mensheviks)", "19 (Bolsheviks)", "15 (Bolsheviks)" ], [ "Socialist-Revolutionary Party", "–", "37", "–", "–" ], [ "Labour group", "136", "104", "13", "10" ], [ "Progressist Party", "27", "28", "28", "41" ], [ "Constitutional Democratic Party (Kadets)", "179", "92", "52", "57" ], [ "Non-Russian National Groups", "121", "–", "26", "21" ], [ "Centre Party", "–", "–", "–", "33" ], [ "Octobrist Party", "17", "42", "154", "95" ], [ "Nationalists", "60", "93", "26", "22" ], [ "Rightists", "8", "10", "147", "154" ], [ "TOTAL", "566", "453", "465", "448" ] ], "title": "", "original_id": "8c3668697e8601047edef065555855fc" }, { "_id": "bd8da6d10cf6946173ed099789acc21e", "header": [ "episode", "date", "official itv rating (millions)", "weekly rank", "share (%)", "official itv hd rating (millions)", "total itv viewers (millions)" ], "rows": [ [ "auditions 1", "13 april", "9.58", "1", "36.9", "1.15", "10.73" ], [ "auditions 2", "20 april", "9.72", "1", "43.9", "1.43", "11.15" ], [ "auditions 3", "27 april", "9.17", "1", "43.9", "1.31", "10.48" ], [ "auditions 4", "4 may", "9.6", "1", "45.0", "1.31", "10.91" ], [ "auditions 5", "11 may", "10.24", "1", "45.2", "1.71", "11.95" ], [ "auditions 6", "18 may", "9.11", "1", "38.1", "1.25", "10.36" ], [ "auditions 7", "26 may", "8.09", "3", "38.0", "1.13", "9.22" ], [ "semi - final 1", "27 may", "9.52", "1", "41.5", "1.46", "10.98" ], [ "semi - final 1 results", "27 may", "7.6", "10", "31.4", "1.14", "8.74" ], [ "semi - final 2", "28 may", "8.54", "6", "36.5", "1.21", "9.75" ], [ "semi - final 2 results", "28 may", "7.13", "14", "28.5", "n / a", "7.13" ], [ "semi - final 3", "30 may", "8.17", "8", "37.5", "1.27", "9.44" ], [ "semi - final 3 results", "30 may", "7.18", "13", "32.3", "n / a", "7.18" ], [ "semi - final 4", "31 may", "8.28", "7", "37.5", "1.12", "9.4" ], [ "semi - final 4 results", "31 may", "7.29", "12", "32.7", "n / a", "7.29" ], [ "semi - final 5", "1 june", "8.02", "9", "41.9", "1.20", "9.22" ], [ "semi - final 5 results", "1 june", "7.46", "11", "32.8", "1.07", "8.53" ], [ "live final", "8 june", "10.43", "1", "48.9", "1.80", "12.23" ] ], "title": "", "original_id": "d277ebc4a7a4c1aec7fd73a98ae56d13" }, { "_id": "8b0c71f1ad0e630fcc31cc005a70ff5e", "header": [ "rank", "centre", "country", "rating", "change" ], "rows": [ [ "41", "isle of man ( cd )", "isle of man ( cd )", "638", "7" ], [ "42", "abu dhabi", "united arab emirates", "637", "12" ], [ "43", "wellington", "new zealand", "636", "10" ], [ "44", "istanbul", "turkey", "633", "7" ], [ "45", "amsterdam", "netherlands", "629", "26" ], [ "46", "buenos aires", "argentina", "628", "5" ], [ "47", "riyadh", "saudi arabia", "627", "29" ], [ "48", "british virgin islands ( bot )", "british virgin islands ( bot )", "626", "14" ], [ "49", "copenhagen", "denmark", "625", "18" ], [ "50", "taipei", "taiwan", "619", "34" ], [ "51", "milan", "italy", "618", "34" ], [ "52", "bahrain", "bahrain", "610", "3" ], [ "53", "malta", "malta", "608", "13" ], [ "54", "madrid", "spain", "607", "28" ], [ "55", "jakarta", "indonesia", "606", "14" ], [ "56", "dublin", "ireland", "605", "22" ], [ "57", "helsinki", "finland", "604", "30" ], [ "58", "bangkok", "thailand", "600", "19" ], [ "59", "beijing", "china", "598", "24" ], [ "60", "brussels", "belgium", "597", "44" ], [ "61", "johannesburg", "south africa", "592", "18" ], [ "62", "edinburgh", "united kingdom", "590", "42" ], [ "63", "panama city", "panama", "589", "8" ], [ "64", "manila", "philippines", "587", "1" ], [ "65", "glasgow", "united kingdom", "586", "50" ], [ "66", "mexico city", "mexico", "584", "44" ], [ "67", "the bahamas", "the bahamas", "583", "4" ], [ "68", "mauritius", "mauritius", "581", "9" ], [ "69", "moscow", "russia", "580", "26" ], [ "70", "gibraltar ( bot )", "gibraltar ( bot )", "572", "43" ], [ "71", "warsaw", "poland", "571", "37" ], [ "72", "mumbai", "india", "570", "35" ], [ "73", "prague", "czech republic", "565", "46" ], [ "74", "cyprus", "cyprus", "536", "40" ], [ "75", "lisbon", "portugal", "535", "17" ], [ "76", "saint petersburg", "russia", "522", "63" ], [ "77", "budapest", "hungary", "515", "26" ], [ "78", "tallinn", "estonia", "495", "94" ], [ "79", "reykjavik", "iceland", "479", "67" ], [ "80", "athens", "greece", "469", "4" ] ], "title": "", "original_id": "39987999e1badc7cd1a6f52f52b106cc" }, { "_id": "b6590c918bc7021b18c905d97bda9c55", "header": [ "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "Measure unit", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)" ], "rows": [ [ "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "Measure unit", "TOTAL", "0-9", "10-19", "20-29", "30-39", "40-49", "50-59", "60-69", "70-79", "80 +" ], [ "I.", "TOTAL", "TOTAL", "TOTAL", "TOTAL", "person", "287", "41", "45", "47", "27", "38", "31", "20", "24", "14" ], [ "I.", "—", "of which in", "of which in", "of which in", "%", "100", "14.3", "15.7", "16.4", "9.4", "13.2", "10.8", "7", "8.4", "4.9" ], [ "I.", "1.", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX" ], [ "I.", "1.", "A.", "Males", "Males", "person", "145", "23", "23", "25", "13", "20", "16", "11", "11", "3" ], [ "I.", "1.", "A.", "—", "of which in", "%", "50.5", "8", "8", "8.7", "4.5", "7", "5.6", "3.8", "3.8", "1" ], [ "I.", "1.", "B.", "Females", "Females", "person", "142", "18", "22", "22", "14", "18", "15", "9", "13", "11" ], [ "I.", "1.", "B.", "—", "of which in", "%", "49.5", "6.3", "7.7", "7.7", "4.9", "6.3", "5.2", "3.1", "4.5", "3.8" ] ], "title": "", "original_id": "50a1c817a7b50bcd7d9972f1f2ddeff9" }, { "_id": "43e9f9ba1861cdf9e67cfe43eb843627", "header": [ "name", "area (km square)", "pop", "pop / area (1 / km square)", "no p", "no c / no t", "subregion" ], "rows": [ [ "águeda", "335.3", "47729", "148", "20", "1", "baixo vouga" ], [ "albergaria - a - velha", "155.4", "25497", "164", "8", "0", "baixo vouga" ], [ "anadia", "216.6", "31671", "146", "15", "1", "baixo vouga" ], [ "arouca", "329.1", "24019", "73", "20", "0", "entre douro e vouga" ], [ "aveiro", "199.9", "73626", "368", "14", "1", "baixo vouga" ], [ "castelo de paiva", "115.0", "17089", "149", "9", "0 / 2", "tmega" ], [ "espinho", "21.1", "31703", "1503", "5", "1 / 1", "grande porto" ], [ "estarreja", "108.4", "28279", "261", "7", "1 / 3", "baixo vouga" ], [ "ílhavo", "73.5", "39247", "534", "4", "2", "baixo vouga" ], [ "mealhada", "110.7", "20496", "194", "8", "1", "baixo vouga" ], [ "murtosa", "73.3", "9657", "132", "4", "0 / 1", "baixo vouga" ], [ "oliveira de azeméis", "163.5", "71243", "436", "19", "1 / 9", "entre douro e vouga" ], [ "oliveira do bairro", "87.3", "22365", "256", "6", "1", "baixo vouga" ], [ "ovar", "147.4", "56715", "385", "8", "2 / 3", "baixo vouga" ], [ "santa maria da feira", "215.1", "142295", "662", "31", "3 / 13", "entre douro e vouga" ], [ "são joão da madeira", "7.9", "21538", "2726", "1", "1 / 0", "entre douro e vouga" ], [ "sever do vouga", "129.6", "12940", "100", "9", "0", "baixo vouga" ], [ "vagos", "169.9", "23205", "137", "11", "0 / 2", "baixo vouga" ], [ "vale de cambra", "146.5", "22864", "169", "9", "1", "entre douro e vouga" ] ], "title": "", "original_id": "a44c1a6d08cd0dac4f0d91df912f222c" }, { "_id": "89c3633d9a64c946b122c1e3c7636bf0", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "soviet union", "7", "6", "0", "13" ], [ "2", "hungary", "2", "2", "1", "5" ], [ "3", "japan", "2", "0", "3", "5" ], [ "4", "romania", "1", "3", "1", "5" ], [ "5", "iran", "1", "0", "1", "2" ], [ "6", "turkey", "1", "0", "1", "2" ], [ "7", "finland", "1", "0", "0", "1" ], [ "7", "france", "1", "0", "0", "1" ], [ "9", "bulgaria", "0", "2", "2", "4" ], [ "10", "united states", "0", "1", "2", "3" ], [ "11", "east germany", "0", "1", "0", "1" ], [ "11", "india", "0", "1", "0", "1" ], [ "13", "czechoslovakia", "0", "0", "1", "1" ], [ "13", "mongolia", "0", "0", "1", "1" ], [ "13", "poland", "0", "0", "1", "1" ], [ "13", "south korea", "0", "0", "1", "1" ], [ "13", "sweden", "0", "0", "1", "1" ], [ "total", "total", "16", "16", "16", "48" ] ], "title": "", "original_id": "0d30032f9b5ffaf48989a02191dbb9c9" }, { "_id": "54299fbe01082a5cfda0ec468e6e8a0e", "header": [ "year", "births (000s)", "deaths", "natural growth", "total fertility rate" ], "rows": [ [ "1990", "0.7", "0.4", "0.3", "1.58" ], [ "1991", "2.4", "1.85", "0.55", "1.31" ], [ "1992", "3.4", "2.7", "0.7", "1.33" ], [ "1993", "4.6", "3.3", "1.3", "1.52" ], [ "1994", "5.8", "4.0", "1.8", "1.65" ], [ "1995", "6.75", "4.6", "2.15", "1.72" ], [ "1996", "7.5", "5.0", "2.5", "1.70" ], [ "1997", "8.2", "5.4", "2.8", "1.71" ], [ "1998", "8.9", "5.9", "3.0", "1.71" ], [ "1999", "9.3", "6.3", "3.0", "1.63" ], [ "2000", "10.1", "6.7", "3.4", "1.62" ], [ "2001", "10.3", "6.9", "3.4", "1.56" ], [ "2002", "10.6", "7.2", "3.4", "1.55" ], [ "2003", "11.1", "7.25", "3.85", "1.60" ], [ "2004", "10.9", "7.4", "3.5", "1.55" ], [ "2005", "11.0", "7.6", "3.4", "1.55" ], [ "2006", "11.2", "7.6", "3.6", "na" ], [ "2007", "10.3", "7.8", "2.5", "na" ], [ "2008", "11.6", "7.8", "3.8", "na" ], [ "2009", "11.7", "7.6", "4.1", "na" ], [ "1990 - 2009", "166.4", "113.3", "53.1", "na" ] ], "title": "", "original_id": "19f5fcd6b29df032293fab57a9cd5e91" }, { "_id": "8fb087e86ec0ff6a0d0b7626570853b8", "header": [ "year", "class", "team", "points", "rank", "wins" ], "rows": [ [ "1994", "125cc", "honda", "24", "20th", "0" ], [ "1995", "125cc", "honda", "102", "8th", "0" ], [ "1996", "125cc", "honda", "167", "3rd", "1" ], [ "1997", "125cc", "honda", "190", "3rd", "0" ], [ "1998", "125cc", "honda", "217", "2nd", "5" ], [ "1999", "250cc", "yamaha", "52", "15th", "0" ] ], "title": "", "original_id": "74a141ffb44ab78e143b3824b352eee2" }, { "_id": "2d589380fda1881f58d9052bba173d4c", "header": [ "year", "builder", "motors", "trailers", "control trailers" ], "rows": [ [ "1923", "brcw", "-", "1", "-" ], [ "1923", "clco", "-", "1", "-" ], [ "1923", "grcw", "-", "1", "1" ], [ "1923", "leeds", "-", "1", "-" ], [ "1923", "mcwf", "-", "1", "-" ], [ "1923", "brcw", "-", "35", "-" ], [ "1923", "clco", "41", "40", "-" ], [ "1923", "mcwf", "40", "-", "35" ], [ "1924", "brcw", "-", "50", "-" ], [ "1924", "clco", "-", "-", "25" ], [ "1924", "mcwf", "52", "-", "-" ], [ "1925", "clco", "48", "-", "-" ], [ "1925", "mcwf", "-", "5", "67" ], [ "1926", "mcwf", "64", "48", "-" ], [ "1927", "mcwf", "110", "160", "36" ], [ "1927", "ucc", "77", "37", "68" ], [ "1929", "ucc", "18", "17", "18" ], [ "1930", "mccw", "22", "20", "20" ], [ "1930", "ucc", "2", "4", "-" ], [ "1931", "brcw", "-", "90", "-" ], [ "1931", "grcw", "-", "40", "-" ], [ "1931", "mccw", "145", "-", "-" ], [ "1934", "mccw", "26", "-", "-" ], [ "totals", "1466", "645", "551", "270" ] ], "title": "", "original_id": "6ba14be153d5a11f0caeebe3e441125d" }, { "_id": "8256d79143780e5b70b0130485e9382f", "header": [ "year", "show", "season", "episode title", "episode" ], "rows": [ [ "2011", "treme", "2", "what is new orleans", "9" ], [ "2010", "treme", "1", "the foot of canal street", "4" ], [ "2010", "the pacific", "1", "part 3", "3" ], [ "2008", "the wire", "5", "late editions", "9" ], [ "2006", "the wire", "4", "that 's got his own", "12" ], [ "2004", "the wire", "3", "middle ground", "11" ], [ "2004", "the wire", "3", "slapstick", "9" ], [ "2004", "the wire", "3", "hamsterdam", "4" ], [ "2003", "the wire", "2", "bad dreams", "11" ], [ "2003", "the wire", "2", "duck and cover", "8" ], [ "2002", "the wire", "1", "cleaning up", "12" ] ], "title": "", "original_id": "d8ac38ac5b42068555d9ce6ab619d048" }, { "_id": "e083033db4d70a6fc045588c28b2a3c0", "header": [ "year", "theme", "artist", "mintage", "issue price" ], "rows": [ [ "2005", "fur traders", "john mardon", "4500", "489.95" ], [ "2006", "timber trade", "john mardon", "4500", "489.95" ], [ "2007", "fishing trade", "john mardon", "4000", "579.95" ], [ "2008", "agricultural commerce", "john mardon", "4000", "619.95" ], [ "2009", "coal mining trade", "john mardon", "4000", "697.95" ], [ "2010", "petroleum and oil trade", "john mardon", "4000", "999.95" ] ], "title": "", "original_id": "a6b444f9bff38624cc77a5eb368f41c2" }, { "_id": "585d94f6404375fcece657b7e3ef9155", "header": [ "rank", "country", "year", "males", "females", "total" ], "rows": [ [ "1", "south korea", "2011", "39.3", "19.7", "28.4" ], [ "2", "hungary", "2009", "33.8", "8.0", "19.8" ], [ "3", "japan", "2009", "29.2", "10.5", "19.7" ], [ "4", "finland", "2009", "26.0", "8.9", "17.3" ], [ "5", "slovenia", "2009", "28.2", "6.7", "17.2" ], [ "6", "estonia", "2009", "31.2", "4.8", "16.8" ], [ "7", "belgium", "2005", "24.6", "8.4", "16.2" ], [ "8", "switzerland", "2007", "20.6", "8.7", "14.3" ], [ "9", "france", "2008", "21.6", "6.8", "13.8" ], [ "10", "poland", "2008", "23.3", "3.5", "12.9" ], [ "11", "austria", "2009", "19.7", "5.2", "12.0" ], [ "12", "czech republic", "2009", "20.1", "3.4", "11.4" ], [ "13", "ireland", "2009", "18.0", "4.6", "11.3" ], [ "14", "new zealand", "2007", "17.8", "5.0", "11.2" ], [ "15", "sweden", "2008", "16.1", "6.0", "11.0" ], [ "16", "chile", "2007", "18.5", "4.1", "11.0" ], [ "17", "norway", "2009", "15.7", "6.2", "10.9" ], [ "18", "united states", "2007", "17.1", "4.3", "10.5" ], [ "19", "iceland", "2009", "16.6", "3.9", "10.3" ], [ "20", "canada", "2004", "15.7", "4.9", "10.2" ], [ "21", "denmark", "2006", "15.3", "5.3", "9.9" ], [ "22", "slovak republic", "2011", "17.4", "2.8", "9.9" ], [ "23", "germany", "2006", "14.5", "4.3", "9.1" ], [ "24", "netherlands", "2009", "11.2", "4.6", "7.8" ], [ "25", "luxembourg", "2008", "13.3", "2.7", "7.8" ], [ "26", "australia", "2006", "11.9", "3.3", "7.5" ], [ "27", "portugal", "2009", "12.5", "2.9", "7.3" ], [ "28", "united kingdom", "2009", "9.8", "2.6", "6.2" ], [ "29", "spain", "2008", "9.7", "2.6", "6.0" ], [ "30", "israel", "2008", "8.8", "1.6", "5.0" ], [ "31", "italy", "2007", "8.0", "2.1", "4.9" ], [ "32", "mexico", "2008", "7.5", "1.5", "4.4" ], [ "33", "turkey", "2008", "5.36", "2.5", "3.94" ], [ "34", "greece", "2009", "4.8", "0.8", "2.8" ] ], "title": "", "original_id": "f336acf7ae0825191c3faa000c143abc" }, { "_id": "45e90502f58e749f872585caa6d7235b", "header": [ "year", "competition", "location", "apparatus", "rank - final", "score - final", "rank - qualifying", "score - qualifying" ], "rows": [ [ "2011", "world cup", "ghent", "uneven bars", "3", "15.35", "1", "15.35" ], [ "2011", "world cup", "ghent", "balance beam", "1", "14.975", "2", "14.85" ], [ "2011", "world cup", "ghent", "floor exercise", "2", "13.65", "3", "13.475" ], [ "2010", "world cup", "ghent", "uneven bars", "1", "15.05", "2", "14.775" ], [ "2010", "world cup", "ghent", "balance beam", "3", "13.65", "2", "14.7" ], [ "2010", "world cup", "ghent", "floor", "6", "12.7", "5", "13.45" ], [ "2010", "world cup", "doha", "uneven bars", "2", "13.85", "2", "15.025" ], [ "2010", "world cup", "doha", "balance beam", "1", "14.7", "1", "14.525" ], [ "2010", "world cup", "doha", "floor", "1", "13.975", "6", "12.95" ] ], "title": "", "original_id": "8d2fb18ef60aa6895563b87a717d89e6" }, { "_id": "ac0ce6e91465a2bb5fcc9932128fb8eb", "header": [ "year", "theme", "artist", "composition", "mintage", "issue price" ], "rows": [ [ "2008", "newfoundland and labrador", "royal canadian mint engravers", "58.33% gold , 41.67% silver", "1000", "1541.95" ], [ "2008", "alberta", "royal canadian mint engravers", "58.33% gold , 41.67% silver", "1000", "1631.95" ], [ "2009", "yukon", "royal canadian mint engravers", "58.33% gold , 41.67% silver", "1000", "1659.95" ], [ "2009", "prince edward island", "royal canadian mint engravers", "58.33% gold , 41.67% silver", "1000", "1949.95" ], [ "2010", "british columbia", "royal canadian mint engravers", "58.33% gold , 41.67% silver", "500", "2249.95" ], [ "2010", "new brunswick", "royal canadian mint engravers", "58.33% gold , 41.67% silver", "500", "2249.95" ] ], "title": "", "original_id": "be503c55c3cf1fbec022f0311349e163" }, { "_id": "bd856a89b879944e2d52f507bfbb5d14", "header": [ "year", "district - wide", "high schools", "middle schools", "elementary schools", "other programs & adjustments" ], "rows": [ [ "2006 - 2007", "31221", "8808", "6405", "14369", "1639" ], [ "2005 - 2006", "31599", "8570", "6610", "14249", "2170" ], [ "2004 - 2005", "31851", "8620", "6876", "14384", "1971" ], [ "2003 - 2004", "32150", "8430", "7115", "14497", "2108" ], [ "2002 - 2003", "32464", "8696", "7103", "14733", "1932" ], [ "2001 - 2002", "35399", "10114", "5504", "19541", "240" ] ], "title": "", "original_id": "a9196b8ddb587ea972419f2fec183f52" }, { "_id": "8cd8feb4a60019a3f0cf3a992f7ab78f", "header": [ "Year", "Political Rights", "Civil Liberties", "Status", "President" ], "rows": [ [ "1972", "6", "6", "Not Free", "Hamani Diori" ], [ "1973", "6", "6", "Not Free", "Hamani Diori" ], [ "1974", "7", "6", "Not Free", "Hamani Diori" ], [ "1975", "7", "6", "Not Free", "Seyni Kountché" ], [ "1976", "7", "6", "Not Free", "Seyni Kountché" ], [ "1977", "7", "6", "Not Free", "Seyni Kountché" ], [ "1978", "7", "6", "Not Free", "Seyni Kountché" ], [ "1979", "7", "6", "Not Free", "Seyni Kountché" ], [ "1980", "7", "6", "Not Free", "Seyni Kountché" ], [ "1981", "7", "6", "Not Free", "Seyni Kountché" ], [ "1982", "7", "6", "Not Free", "Seyni Kountché" ], [ "1983", "7", "6", "Not Free", "Seyni Kountché" ], [ "1984", "7", "6", "Not Free", "Seyni Kountché" ], [ "1985", "7", "6", "Not Free", "Seyni Kountché" ], [ "1986", "7", "6", "Not Free", "Seyni Kountché" ], [ "1987", "7", "6", "Not Free", "Seyni Kountché" ], [ "1988", "6", "6", "Not Free", "Ali Saibou" ], [ "1989", "7", "6", "Not Free", "Ali Saibou" ], [ "1990", "6", "5", "Not Free", "Ali Saibou" ], [ "1991", "6", "5", "Partly Free", "Ali Saibou" ], [ "1992", "5", "4", "Partly Free", "Ali Saibou" ], [ "1993", "3", "4", "Partly Free", "Ali Saibou" ], [ "1994", "3", "5", "Partly Free", "Mahamane Ousmane" ], [ "1995", "3", "5", "Partly Free", "Mahamane Ousmane" ], [ "1996", "7", "5", "Not Free", "Mahamane Ousmane" ], [ "1997", "7", "5", "Not Free", "Ibrahim Baré Maïnassara" ], [ "1998", "7", "5", "Not Free", "Ibrahim Baré Maïnassara" ], [ "1999", "5", "5", "Partly Free", "Ibrahim Baré Maïnassara" ], [ "2000", "4", "4", "Partly Free", "Mamadou Tandja" ], [ "2001", "4", "4", "Partly Free", "Mamadou Tandja" ], [ "2002", "4", "4", "Partly Free", "Mamadou Tandja" ], [ "2003", "4", "4", "Partly Free", "Mamadou Tandja" ], [ "2004", "3", "3", "Partly Free", "Mamadou Tandja" ], [ "2005", "3", "3", "Partly Free", "Mamadou Tandja" ], [ "2006", "3", "3", "Partly Free", "Mamadou Tandja" ], [ "2007", "3", "4", "Partly Free", "Mamadou Tandja" ], [ "2008", "3", "4", "Partly Free", "Mamadou Tandja" ], [ "2009", "5", "4", "Partly Free", "Mamadou Tandja" ], [ "2010", "5", "4", "Partly Free", "Mamadou Tandja" ], [ "2011", "3", "4", "Partly Free", "Salou Djibo" ] ], "title": "", "original_id": "8fe93b8586be52209d3d522455a43430" }, { "_id": "c7015403129d26d253f368bc25d63ef1", "header": [ "year", "matches", "wins", "losses", "no result", "tied", "success rate" ], "rows": [ [ "2008", "16", "9", "7", "0", "0", "56.25%" ], [ "2009", "15", "8", "6", "1", "0", "53.33%" ], [ "2010", "16", "9", "7", "0", "0", "56.25%" ], [ "2011", "16", "11", "5", "0", "0", "68.75%" ], [ "2012", "19", "19", "11", "8", "0", "52.63%" ], [ "2013", "18", "12", "6", "0", "0", "66.67%" ], [ "total", "99", "59", "39", "1", "0", "60.2%" ] ], "title": "", "original_id": "3f6993cc9f6540e04eaba1d69d6d69b6" }, { "_id": "8c642fc37e80ca05e93d11c8d61727bf", "header": [ "year", "theme", "artist", "composition", "mintage", "issue price" ], "rows": [ [ "2007", "blue crystal - piedfort", "konrad wachelko", "92.5% silver , 7.5% copper", "5000", "94.95" ], [ "2007", "iridescent crystal - piedfort", "konrad wachelko", "92.5% silver , 7.5% copper", "5000", "94.95" ], [ "2008", "amethyst crystal", "konrad wachelko", "99.99% silver", "7500", "94.95" ], [ "2008", "sapphire crystal", "konrad wachelko", "99.99% silver", "7500", "94.95" ], [ "2009", "blue crystal", "konrad wachelko", "99.99% silver", "7500", "94.95" ], [ "2009", "pink crystal", "konrad wachelko", "99.99% silver", "7500", "94.95" ], [ "2010", "blue crystal", "konrad wachelko", "99.99% silver", "7500", "99.95" ], [ "2010", "tanzanite crystal", "konrad wachelko", "99.99% silver", "7500", "99.95" ], [ "2011", "emerald crystal", "konrad wachelko", "99.99% silver", "15000", "114.95" ], [ "2011", "topaz crystal", "konrad wachelko", "99.99% silver", "15000", "114.95" ], [ "2011", "hyacinth red small crystal", "konrad wachelko", "99.99% silver", "15000", "114.95" ], [ "2011", "montana blue small crystal", "konrad wachelko", "99.99% silver", "15000", "114.95" ] ], "title": "", "original_id": "56035c2708fa70250d3e771b00e74871" }, { "_id": "cf7f909b6e38ac615aafc6b5a55eeba4", "header": [ "Year", "Country", "City", "Number of Examinees by Level", "Number of Examinees by Level", "Number of Examinees by Level", "Number of Examinees by Level", "Number of Examinees by Level" ], "rows": [ [ "Year", "Country", "City", "L1", "L2", "L3", "L4", "Total" ], [ "2006", "Kazakhstan", "Almaty", "50", "98", "135", "91", "374" ], [ "2006", "Russia", "Khabarovsk", "18", "56", "89", "63", "226" ], [ "2006", "Russia", "Moscow", "64", "259", "465", "374", "1,162" ], [ "2006", "Russia", "Novosibirsk", "12", "61", "115", "82", "270" ], [ "2006", "Russia", "Vladivostok", "23", "92", "105", "85", "305" ], [ "2006", "Russia", "Yuzhno-Sakhalinsk", "5", "32", "78", "89", "204" ], [ "2006", "Ukraine", "Kiev", "29", "89", "127", "109", "354" ], [ "2006", "Uzbekistan", "Tashkent", "61", "111", "145", "88", "405" ], [ "2005", "Kazakhstan", "Almaty", "28", "43", "68", "25", "164" ], [ "2005", "Russia", "Moscow", "48", "197", "316", "287", "848" ], [ "2005", "Russia", "Vladivostok", "23", "56", "97", "55", "231" ], [ "2005", "Ukraine", "Kiev", "27", "63", "120", "54", "284" ], [ "2005", "Uzbekistan", "Tashkent", "41", "101", "122", "69", "333" ], [ "2004", "Kazakhstan", "Almaty", "34", "63", "61", "28", "186" ], [ "2004", "Russia", "Moscow", "33", "168", "265", "310", "776" ], [ "2004", "Russia", "Vladivostok", "23", "94", "58", "58", "233" ], [ "2003", "Kazakhstan", "Almaty", "41", "87", "42", "24", "194" ], [ "2003", "Russia", "Moscow", "34", "157", "224", "207", "622" ], [ "2003", "Russia", "Vladivostok", "20", "73", "61", "45", "199" ], [ "2002", "Data missing", "Data missing", "Data missing", "Data missing", "Data missing", "Data missing", "Data missing" ], [ "2001", "Russia", "Moscow", "34", "78", "173", "159", "444" ], [ "2001", "Russia", "Vladivostok", "17", "34", "84", "38", "173" ], [ "2000", "Russia", "Moscow", "26", "120", "122", "94", "362" ], [ "1999", "Russia", "Moscow", "24", "101", "135", "88", "348" ], [ "1998", "Russia", "Moscow", "-", "-", "-", "-", "278" ] ], "title": "", "original_id": "f523566ee3da17b344ecfb521835f84e" }, { "_id": "ebe77d6c0fb340e20ff13a536dc1ee42", "header": [ "Year", "R class in service at start of year", "R1 class in service at start of year", "Quantity withdrawn", "Locomotive numbers", "Notes" ], "rows": [ [ "1931", "11", "13", "1", "1342", "-" ], [ "1932", "10", "13", "1", "1077", "-" ], [ "1934", "9", "13", "3", "1126, 1152, 1338", "-" ], [ "1935", "6", "13", "1", "1153", "-" ], [ "1937", "5", "13", "1", "1125", "-" ], [ "1939", "4", "13", "1", "1155", "-" ], [ "1941", "3", "13", "1", "1336", "-" ], [ "1942", "2", "13", "1", "1070", "-" ], [ "1943", "1", "13", "1", "1124", "-" ], [ "1949", "0", "13", "1", "1127", "-" ], [ "1955", "—", "12", "2", "31154, 31335", "-" ], [ "1958", "—", "10", "2", "31069, 31147", "-" ], [ "1959", "—", "8", "6", "31010, 31107, 31128, 31174, 31339, 31340", "-" ], [ "1960", "—", "2", "2", "31047, 31337", "-" ] ], "title": "", "original_id": "8c08ad04ed79ae9165b5ae54d1c489bd" }, { "_id": "1cc44f2c87511ec69e681c8e0316e6f1", "header": [ "rank", "name", "height m ( ft )", "floors", "year" ], "rows": [ [ "1", "édifice marie - guyart", "-", "33", "1972" ], [ "2", "complexe jules dallaire ii", "-", "28", "2013" ], [ "3", "place hauteville", "-", "34", "1974" ], [ "4", "hôtel loews le concorde", "-", "31", "1974" ], [ "5", "hôtel hilton québec", "-", "28", "1974" ], [ "6", "édifice price", "-", "18", "1930" ], [ "7", "place de la capitale", "-", "21", "1974" ], [ "8", "le samuel - holland i", "-", "24", "1981" ], [ "9", "chteau frontenac", "-", "18", "1893" ], [ "10", "édifice d'youville", "-", "21", "1969" ], [ "11", "complexe jules - dallaire i", "-", "17", "2010" ] ], "title": "", "original_id": "64b77c1e7f30ca236e405528bdeac502" }, { "_id": "d5f1b39e37e774e5f5c281c7bf31c6bc", "header": [ "year", "team", "apps", "tries", "goals", "points" ], "rows": [ [ "2004", "castleford tigers", "3", "0", "0", "0" ], [ "2005", "castleford tigers", "29", "24", "0", "96" ], [ "2006", "castleford tigers", "27", "8", "0", "32" ], [ "2007", "castleford tigers", "20", "19", "0", "76" ], [ "2008", "castleford tigers", "22", "13", "0", "52" ], [ "2009", "castleford tigers", "30", "19", "0", "76" ], [ "2010", "castleford tigers", "22", "10", "0", "40" ], [ "total", "castleford tigers", "153", "93", "0", "372" ] ], "title": "", "original_id": "0c698f73ee431f8e473ef3bda75f5427" }, { "_id": "a58864d5ddde4a97fc43a0b3881b8915", "header": [ "Year", "Dates", "No. of shows", "No. of performances", "Attendance", "Venues", "References" ], "rows": [ [ "1994", "June 23 – July 2", "53", "315", "4,630", "6", "-" ], [ "1995", "June 22 – July 3", "≤50", "400", "5,500", "5", "-" ], [ "1996", "June 20–30", "46", "250", "4,464", "5", "-" ], [ "1997", "June 19–29", "35", "—", "4,300", "5", "-" ], [ "1998", "July 30 – August 9", "38", "~200", "6,573", "6", "-" ], [ "1999", "July 29 – August 8", "68", "—", "15,447", "10", "-" ], [ "2000", "July 28 – August 6", "100", "500", ">23,000", "19", "-" ], [ "2001", "August 3–12", "120", "—", "28,835", "21", "-" ], [ "2002", "August 2–11", "148", ">675", "32,000", "14", "-" ], [ "2003", "August 1–10", "162", "783", "40,500", "20", "-" ], [ "2004", "August 6–15", "176", "900", "43,836", "24", "-" ], [ "2005", "August 4–14", "168", "855", "44,630", "20", "-" ], [ "2006", "August 3–13", "165", "890", "44,814", "23", "-" ], [ "2007", "August 2–12", "162", "872", "37,752", "23", "-" ], [ "2008", "July 31 – August 10", "156", "808", "40,926", "18", "-" ], [ "2009", "July 30 – August 9", "162", "843", "46,189", "22", "-" ], [ "2010", "August 5–15", "169", "876", "50,256", "15", "-" ], [ "2011", "August 4–14", "168", "865", "48,350", "18", "-" ], [ "2012", "August 2–12", "164", "840", "48,432", "15", "-" ], [ "2013", "August 1–11", "177", "897", "50,007", "16", "-" ], [ "2014", "July 31 – August 10", "169", "878", "50,265", "15", "-" ], [ "2015", "July 30 – August 9", "174", "909", "50,338", "24", "-" ], [ "2016", "August 4–14", "168", "869", "47,882", "19", "-" ], [ "2017", "August 3–13", "167", "850", "46,076", "17", "-" ], [ "2018", "August 2–12", "138", "694", "~36,400", "16", "-" ] ], "title": "", "original_id": "9eb17e466a9ae8c241c276e69e368046" }, { "_id": "895e6b425a90c76c0bf257a792ddfc61", "header": [ "Year", "-", "Year", "-", "Year", "-" ], "rows": [ [ "1820", "8,385", "1885", "395,346", "1950", "249,187" ], [ "1825", "10,199", "1890", "455,302", "1955", "237,790" ], [ "1830", "23,322", "1895", "258,536", "1960", "265,398" ], [ "1835", "45,374", "1900", "448,572", "1965", "296,697" ], [ "1840", "84,066", "1905", "1,026,499", "1970", "373,326" ], [ "1845", "114,371", "1910", "1,041,570", "1975", "385,378" ], [ "1850", "369,980", "1915", "326,700", "1980", "524,295" ], [ "1855", "200,877", "1920", "430,001", "1985", "568,149" ], [ "1860", "153,640", "1925", "294,314", "1990", "1,535,872" ], [ "1865", "248,120", "1930", "241,700", "1995", "720,177" ], [ "1870", "387,203", "1935", "34,956", "2000", "841,002" ], [ "1875", "227,498", "1940", "70,756", "2005", "1,122,257" ], [ "1880", "457,257", "1945", "38,119", "2010", "1,042,625" ] ], "title": "", "original_id": "c3ce5811d8041e247d700aa708d16934" }, { "_id": "570dfe08a4a8b7e6dcae6ed255b11bcf", "header": [ "Year", "Order", "Quantity", "GER Nos." ], "rows": [ [ "1893", "N31", "1", "999" ], [ "1893", "H33", "10", "979–988" ], [ "1894", "L33", "10", "989–998" ], [ "1894", "E34", "10", "969–978" ], [ "1896", "N37", "10", "959–968" ], [ "1897", "H40", "10", "949–958" ], [ "1897", "O41", "10", "602–608, 946–948" ], [ "1898", "G42", "10", "542–551" ], [ "1898", "K43", "10", "562–571" ] ], "title": "", "original_id": "e22a374e087942766de36d3bd733f72a" }, { "_id": "7770ed4b9f9fe8778a7df5792600be01", "header": [ "Year", "Injuries (US $000)", "Deaths (age <15)", "CPSC toy safety funding\n(US$ Millions)", "Toy sales\n(US $ Billions)" ], "rows": [ [ "1994", "154", null, null, null ], [ "1995", "139", null, null, null ], [ "1996", "130", null, null, null ], [ "1997", "141", null, null, null ], [ "1998", "153", "14.0", null, null ], [ "1999", "152", "16.0", "13.6", null ], [ "2000", "191", "17.0", "12.0", null ], [ "2001", "255", "25.0", "12.4", null ], [ "2002", "212", "13.0", "12.2", "21.3" ], [ "2003", "206", "11.0", "12.8", "20.7" ], [ "2004", "210", "16.0", "11.5", "22.4" ], [ "2005", "202 (estimate)", "20.0", "11.0", "22.2" ], [ "2006", "no data", "22.0", "no data†", "22.3" ], [ "2007", "no data", "22.0", "no data", null ], [ "2008", "no data", "19.0", "no data", null ], [ "2009", "no data", "12.0", "no data", null ] ], "title": "", "original_id": "a5a2c7fb09f32d5546caa62d152930f8" }, { "_id": "ce49ed4ca041646fe740e766159e324f", "header": [ "ship name", "year", "length", "width", "passengers", "vessels", "speed" ], "rows": [ [ "mytilene", "1973", "138 , 3 m", "22 , 4 m", "1.73", "225", "20" ], [ "european express", "1974", "159 , 5 m", "21 , 5 m", "1.0", "350", "23" ], [ "ionian sky", "1974", "164 m", "24 m", "1.09", "600", "22" ], [ "theofilos", "1975", "149 , 4 m", "23 , 5 m", "1.66", "433", "18" ], [ "taxiarchis", "1976", "135 , 8 m", "20 , 6 m", "591.0", "392", "18" ], [ "aqua jewel", "2002", "108 m", "16 , 6 m", "1.675", "175", "18 , 5" ], [ "aqua maria", "1975", "101 , 3 m", "18 m", "592.0", "230", "17" ], [ "aqua spirit", "2000", "75 m", "15 m", "400.0", "60", "17" ] ], "title": "", "original_id": "21ed2d8a7cbb07a4ae880fc3fdbe5cbb" }, { "_id": "e30340bdb05532a8b1e7be1a7112c7a1", "header": [ "rank", "name", "height ft / m", "floors", "year" ], "rows": [ [ "1", "xerox tower", "443 / 135", "30", "1968" ], [ "2", "bausch & lomb place", "401 / 122", "20", "1995" ], [ "3", "chase tower", "392 / 119", "27", "1973" ], [ "4", "kodak tower", "360 / 110", "19", "1914" ], [ "5", "first federal plaza", "309 / 94", "21", "1976" ], [ "6", "one hsbc plaza", "284 / 87", "21", "1970" ], [ "7", "hyatt regency hotel", "271 / 83", "25", "1990" ], [ "8", "times square building", "260 / 79", "14", "1930" ], [ "9", "midtown tower", "251 / 77", "18", "1962" ], [ "10", "saint michael 's church", "246 / 75", "1", "1890" ], [ "11", "temple building", "218 / 66", "14", "1925" ], [ "12", "crossroads building", "215 / 66", "15", "1969" ], [ "13", "eastman school of music student living center", "213 / 65", "14", "1990" ], [ "14", "seneca towers apartments", "212 / 65", "22", "1968" ], [ "15", "sibley center", "203 / 62", "12", "1926" ], [ "16", "clinton square building", "200 / 61", "14", "1990" ] ], "title": "", "original_id": "2cc3663accdc89ab60ba15c630072e4b" }, { "_id": "3191f66bb2ff3ecc44bcb6bc45433904", "header": [ "Builder", "Year", "Works No.", "CSAR No.", "SAR No.", "Class" ], "rows": [ [ "NBL", "1910", "18976", "670", "752", "10B" ], [ "NBL", "1910", "18977", "671", "753", "10BR" ], [ "NBL", "1910", "18978", "672", "754", "10BR" ], [ "NBL", "1910", "18979", "673", "755", "10B" ], [ "NBL", "1910", "18980", "674", "756", "10BR" ], [ "BP", "1911", "5483", "-", "757", "10B" ], [ "BP", "1911", "5484", "-", "758", "10BR" ], [ "BP", "1911", "5486", "-", "759", "10BR" ], [ "BP", "1911", "5487", "-", "760", "10B" ], [ "BP", "1911", "5485", "-", "761", "10B" ] ], "title": "", "original_id": "8d8faa04091d6652a0503ea81462de9f" }, { "_id": "ba346c7c40dc3c2f96db76ccd3bd7a4c", "header": [ "name", "rank", "out of", "source", "year" ], "rows": [ [ "number of agricultural machinery : tractors", "22", "190", "world bank", "2003" ], [ "irrigated land per capita", "14", "173", "cia world factbook", "2003" ], [ "total agricultural land", "15", "199", "world bank", "2005" ], [ "total agricultural land per capita", "57", "199", "world bank", "2005" ], [ "area of permanent crops", "18", "181", "food and agriculture organization", "2000" ], [ "arable land as % of total land area", "109", "199", "world bank", "2005" ], [ "permanent cropland area as % of total land area", "110", "187", "world bank", "2005" ], [ "index of agricultural production", "13", "149", "united nations", "1996 - 98" ], [ "annual diesel consumption in agriculture", "7", "107", "united nations", "2005" ], [ "agricultural electricity consumption per capita", "18", "110", "united nations", "2005" ], [ "cereal production", "13", "149", "world resources institute", "2001" ], [ "meat production per capita", "73", "149", "united nations", "1998" ] ], "title": "", "original_id": "1d89eced1aa8f63f0c2c2cce640a2209" }, { "_id": "7a5f2515e383101b3c6803f34c71070d", "header": [ "year", "total support and revenue", "total expenses", "increase in net assets", "net assets at end of year" ], "rows": [ [ "2003 / 2004", "80129", "23463", "56666", "56666" ], [ "2004 / 2005", "379088", "177670", "211418", "268084" ], [ "2005 / 2006", "1508039", "791907", "736132", "1004216" ], [ "2006 / 2007", "2734909", "2077843", "654066", "1658282" ], [ "2007 / 2008", "5032981", "3540724", "3519886", "5178168" ], [ "2008 / 2009", "8658006", "5617236", "3053599", "8231767" ], [ "2009 / 2010", "17979312", "10266793", "6310964", "14542731" ], [ "2010 / 2011", "24785092", "17889794", "9649413", "24192144" ], [ "2011 / 2012", "38479665", "29260652", "10736914", "34929058" ] ], "title": "", "original_id": "85f02843832ba639726c2aed89720e35" }, { "_id": "4283e79d0b55d6c7c14b1002f504151c", "header": [ "length (feet)", "year", "make and model", "floor type", "number of seats", "bicycle capacity", "fuel propulsion", "quantity" ], "rows": [ [ "30", "2001", "novabus rts", "high", "27", "2", "diesel", "4" ], [ "35", "2010", "new flyer de35lf", "low", "29", "3", "diesel - electric hybrid", "7" ], [ "40", "2000", "novabus rts", "high", "39", "3", "diesel", "14" ], [ "40", "2003", "orion bus industries v", "high", "41", "3", "diesel", "80" ], [ "45", "1999", "mci 102dl3", "high", "57", "2", "diesel", "14" ], [ "45", "2003", "mci d4500", "high", "57", "2", "diesel", "6" ], [ "45", "2010 , 2012", "mci d4500ct", "high", "57", "2", "diesel", "55" ], [ "60 ( articulated )", "2007", "new flyer d60lf", "low", "58", "3", "diesel", "10" ] ], "title": "", "original_id": "0cb2dc3734b6343b4e1c97761f1fbb03" }, { "_id": "b9105262c20c78f35126500b512867e2", "header": [ "year", "bötzow", "schwante", "vehlefanz", "neu - vehlefanz", "marwitz", "bärenklau", "eichstädt" ], "rows": [ [ "2004", "2.785", "1.983", "1.771", "340", "1.407", "1.291", "942" ], [ "2005", "2.904", "1.997", "1.777", "348", "1.4", "1.294", "939" ], [ "2006", "2.973", "2.061", "1.814", "391", "1.432", "1.33", "926" ], [ "2007", "2.947", "2.061", "1.821", "379", "1.435", "1.313", "929" ], [ "2008", "2.937", "2.043", "1.8", "355", "1.398", "1.294", "876" ], [ "2009", "2.967", "2.039", "1.759", "365", "1.417", "1.27", "848" ], [ "2010", "2.981", "2.089", "1.765", "385", "1.429", "1.288", "850" ] ], "title": "", "original_id": "8dcdb337eb9607dcb80c77dae5ac6e20" }, { "_id": "aabfb55d8826ca4b53e6cd0ed0720557", "header": [ "year", "political rights", "civil liberties", "status", "president" ], "rows": [ [ "1972", "7", "7", "not free", "idi amin" ], [ "1973", "7", "7", "not free", "idi amin" ], [ "1974", "7", "7", "not free", "idi amin" ], [ "1975", "7", "7", "not free", "idi amin" ], [ "1976", "7", "7", "not free", "idi amin" ], [ "1977", "7", "7", "not free", "idi amin" ], [ "1978", "7", "7", "not free", "idi amin" ], [ "1979", "6", "6", "not free", "idi amin" ], [ "1980", "4", "4", "not free", "godfrey binaisa" ], [ "1981", "5", "5", "partly free", "milton obote" ], [ "1982", "5", "5", "partly free", "milton obote" ], [ "1983", "4", "5", "partly free", "milton obote" ], [ "1984", "4", "5", "partly free", "milton obote" ], [ "1985", "5", "4", "partly free", "milton obote" ], [ "1986", "5", "4", "partly free", "tito okello" ], [ "1987", "5", "4", "partly free", "yoweri museveni" ], [ "1988", "5", "5", "partly free", "yoweri museveni" ], [ "1989", "6", "4", "partly free", "yoweri museveni" ], [ "1990", "6", "5", "partly free", "yoweri museveni" ], [ "1991", "6", "6", "not free", "yoweri museveni" ], [ "1992", "6", "5", "not free", "yoweri museveni" ], [ "1993", "6", "5", "not free", "yoweri museveni" ], [ "1994", "5", "5", "partly free", "yoweri museveni" ], [ "1995", "5", "4", "partly free", "yoweri museveni" ], [ "1996", "4", "4", "partly free", "yoweri museveni" ], [ "1997", "4", "4", "partly free", "yoweri museveni" ], [ "1998", "4", "4", "partly free", "yoweri museveni" ], [ "1999", "5", "5", "partly free", "yoweri museveni" ], [ "2000", "6", "5", "partly free", "yoweri museveni" ], [ "2001", "6", "5", "partly free", "yoweri museveni" ], [ "2002", "6", "4", "partly free", "yoweri museveni" ], [ "2003", "5", "4", "partly free", "yoweri museveni" ], [ "2004", "5", "4", "partly free", "yoweri museveni" ], [ "2005", "5", "4", "partly free", "yoweri museveni" ], [ "2006", "5", "4", "partly free", "yoweri museveni" ], [ "2007", "5", "4", "partly free", "yoweri museveni" ], [ "2008", "5", "4", "partly free", "yoweri museveni" ], [ "2009", "5", "4", "partly free", "yoweri museveni" ], [ "2010", "5", "4", "partly free", "yoweri museveni" ], [ "2011", "5", "4", "free", "yoweri museveni" ] ], "title": "", "original_id": "912908fb008a8e1d4fd9e79bfc7abd07" }, { "_id": "196ea85a358308f31e5d67fb98bf0996", "header": [ "year", "population", "Catholics (based on registration by the church itself)", "Percentage (based on registration by the church itself)" ], "rows": [ [ "1970", "12,957,621", "5,320,000", "40.5" ], [ "1980", "14,091,014", "5,620,000", "39.5" ], [ "1990", "14,892,574", "5,560,000", "37.0" ], [ "1995", "15,424,122", "5,385,258", "34.8" ], [ "2000", "15,863,950", "5,060,413", "31.6" ], [ "2005", "16,305,526", "4,406,000", "27.0" ], [ "2010", "16,574,989", "4,166,000", "25.0" ], [ "2015", "16,900,726", "3,882,000", "22.9" ], [ "2016", "16,979,120", "3,832,000", "22.4" ], [ "2017", "17,081,057", "3,769,000", "21.9" ] ], "title": "", "original_id": "a9c67600eb25ab046e30bae4b5075d92" }, { "_id": "fa29b9ee33f4d3ff21810d4eac2ead5e", "header": [ "Player", "Games Played", "Field Goals", "Free Throws", "Points" ], "rows": [ [ "Ralf Woods", "16", "54", "70", "178" ], [ "Clyde Alwood", "15", "57", "0", "114" ], [ "Ernest McKay", "15", "39", "3", "81" ], [ "Ray Woods", "16", "19", "0", "38" ], [ "John Felmley", "6", "7", "4", "18" ], [ "George Halas", "11", "5", "0", "10" ], [ "R.C. Haas", "3", "1", "0", "2" ], [ "Gordon Otto", "4", "1", "0", "2" ] ], "title": "", "original_id": "9ab870fb9dbf99e35b45ed0809178a22" }, { "_id": "ce6f1cac5d0cd168295fb75929a16268", "header": [ "ship", "13.5 - inch / 1400lb", "13.5 - inch / 1250lb", "12 - inch", "total" ], "rows": [ [ "lützow", "0", "2", "8", "10" ], [ "derfflinger", "0", "0", "3", "3" ], [ "seydlitz", "0", "0", "1", "1" ], [ "könig", "7", "1", "0", "8" ], [ "markgraf", "0", "1", "0", "1" ], [ "total", "7", "4", "12", "23" ] ], "title": "", "original_id": "c1636b31680a83b5463cbc8c13e26500" }, { "_id": "87962ab7674090dea6153e95e6e31ad0", "header": [ "rank", "company", "revenues (us billion)", "profit (us billion)", "assets (us billion)", "market value (us billion)" ], "rows": [ [ "1", "national bank of greece", "10.4", "- 16", "137.0", "1.0" ], [ "2", "bank of greece", "5.4", "0.3", "210.7", "0.4" ], [ "3", "coca cola hbc", "9.3", "0.3", "9.5", "10.2" ], [ "4", "hellenic telecom", "6.2", "0.6", "10.7", "3.7" ], [ "5", "alpha bank", "4.6", "- 1.4", "76.9", "0.5" ], [ "6", "public power corporation", "7.7", "0", "21.2", "2.0" ], [ "7", "piraeus bank", "3.9", "- 8.6", "62.5", "0.3" ], [ "8", "hellenic petroleum", "13.8", "0.1", "9.7", "3.3" ], [ "9", "opap", "5.2", "0.7", "2.3", "2.8" ], [ "10", "motor oil", "12.8", "0.1", "3.4", "1.2" ] ], "title": "", "original_id": "839734f9a3d8150f3099c50c3280af75" }, { "_id": "4e006f87d4ba1c4e072f2a36fbc1daee", "header": [ "no in series", "no in season", "title", "directed by", "written by", "original air date", "prod no", "viewers (millions)" ], "rows": [ [ "25", "1", "human traffic", "james whitmore , jr", "shane brennan", "september 21 , 2010", "201", "15.76" ], [ "26", "2", "black widow", "kate woods", "dave kalstein", "september 21 , 2010", "202", "13.6" ], [ "27", "3", "borderline", "terrence o'hara", "r scott gemmill", "september 28 , 2010", "203", "16.51" ], [ "28", "4", "special delivery", "tony wharmby", "gil grant", "october 5 , 2010", "204", "16.15" ], [ "29", "5", "little angels", "steven depaul", "frank military", "october 12 , 2010", "205", "16.05" ], [ "30", "6", "standoff", "dennis smith", "joseph c wilson", "october 19 , 2010", "206", "16.0" ], [ "31", "7", "anonymous", "norberto barba", "christina m kim", "october 26 , 2010", "207", "15.99" ], [ "32", "8", "bounty", "felix alcala", "dave kalstein", "november 9 , 2010", "208", "15.61" ], [ "33", "9", "absolution", "steven depaul", "r scott gemmill", "november 16 , 2010", "209", "15.81" ], [ "34", "10", "deliverance", "tony wharmby", "frank military and shane brennan", "november 23 , 2010", "210", "14.96" ], [ "35", "11", "disorder", "jonathan frakes", "gil grant and david kalstien", "december 14 , 2010", "211", "16.82" ], [ "36", "12", "overwatch", "karen gaviola", "lindsay jewett sturman", "january 11 , 2011", "212", "18.13" ], [ "37", "13", "archangel", "tony wharmby", "r scott gemmill and shane brennan", "january 18 , 2011", "213", "17.29" ], [ "38", "14", "lockup", "jan eliasberg", "christina m kim and frank military", "february 1 , 2011", "214", "17.7" ], [ "39", "15", "tin soldiers", "terrence o'hara", "r scott gemmill", "february 8 , 2011", "215", "17.16" ], [ "40", "16", "empty quiver", "james whitmore", "dave kalstein", "february 15 , 2011", "216", "16.8" ], [ "41", "17", "personal", "kate woods", "joseph c wilson", "february 22 , 2011", "217", "18.69" ], [ "42", "18", "harm 's way", "tony wharmby", "shane brennan", "march 1 , 2011", "218", "15.67" ], [ "43", "19", "enemy within", "steven depaul", "lindsay jewett sturman", "march 22 , 2011", "219", "16.56" ], [ "44", "20", "the job", "terrence o'hara", "frank military and christina m kim", "march 29 , 2011", "220", "15.34" ], [ "45", "21", "rocket man", "dennis smith", "roger director", "april 12 , 2011", "221", "15.46" ], [ "46", "22", "plan b", "james whitmore , jr", "dave kalstein and joseph c wilson", "may 3 , 2011", "222", "14.16" ], [ "47", "23", "imposters", "john p kousakis", "r scott gemmill", "may 10 , 2011", "223", "14.74" ] ], "title": "", "original_id": "80ec47226c5b0cbb341420c031fe2f81" }, { "_id": "bc53deb312ade503dbcde4645100d5c5", "header": [ "rating", "share", "rating / share (18 - 49)", "viewers (millions)", "rank (overall)" ], "rows": [ [ "5.4", "9", "2.6 / 7", "9.2", "27" ], [ "4.4", "7", "2.6 / 6", "7.81", "34" ], [ "6.6", "11", "3.0 / 8", "10.6", "18" ], [ "6.1", "10", "3.1 / 8", "10.13", "28" ], [ "5.9", "10", "3.1 / 8", "10.33", "26" ], [ "7.2", "11", "3.2 / 8", "12.42", "15" ], [ "7.1", "11", "3.8 / 10", "11.97", "12" ], [ "6.2", "10", "2.9 / 8", "10.58", "18" ], [ "6.1", "10", "n / a", "10.31", "20" ], [ "6.0", "10", "n / a", "10.27", "17" ], [ "6.8", "9", "2.0 / 7", "10.84", "20" ], [ "7.6", "10", "n / a", "12.49", "19" ] ], "title": "", "original_id": "07ff0047fb0924e84ec62261007e0902" }, { "_id": "50ad0c344fa2b715c5a07c25263de0a3", "header": [ "rank", "airport", "total passengers", "% change 2006 / 2007", "international passengers", "domestic passengers", "transit passengers", "aircraft movements", "freight (metric tonnes)" ], "rows": [ [ "1", "london heathrow", "68066028", "0.8%", "62098911", "5753476", "213641", "481476", "1310987" ], [ "2", "london gatwick", "35216113", "3.1%", "31142002", "4023402", "50709", "266550", "171078" ], [ "3", "london stansted", "23779697", "0.4%", "21204946", "2554304", "20447", "208462", "203747" ], [ "4", "manchester", "22112625", "1.5%", "18662468", "3229255", "220902", "222703", "165366" ], [ "5", "london luton", "9927321", "5.3%", "8427894", "1491467", "7960", "120238", "38095" ], [ "6", "birmingham airport", "9226340", "0.9%", "7592240", "1541815", "92285", "114679", "13585" ], [ "7", "edinburgh", "9047558", "5.1%", "3417891", "5619309", "10358", "128172", "19292" ], [ "8", "glasgow international", "8795727", "0.6%", "4131512", "4594575", "69640", "108305", "4276" ], [ "9", "bristol", "5926774", "2.9%", "4608290", "1275566", "42918", "76428", "20" ], [ "10", "newcastle", "5650716", "4.0%", "3948594", "1675013", "27109", "79200", "785" ], [ "11", "liverpool", "5468510", "10.2%", "4636149", "827085", "5276", "86668", "3709" ], [ "12", "east midlands", "5413360", "14.5%", "4709855", "696649", "6856", "93989", "274753" ], [ "13", "belfast international", "5272664", "4.6%", "1788807", "3447248", "36609", "77395", "38429" ], [ "14", "aberdeen", "3412257", "7.8%", "1475988", "1935152", "1117", "121927", "3434" ], [ "15", "london city", "2912123", "23.5%", "2214884", "697239", "0", "91177", "0" ], [ "16", "leeds bradford", "2881539", "3.2%", "2229283", "630575", "21681", "65249", "109" ], [ "17", "glasgow prestwick", "2422332", "1.0%", "1827592", "593117", "1623", "47910", "31517" ], [ "18", "belfast city", "2186993", "3.9%", "93547", "2093320", "126", "43022", "1057" ], [ "19", "cardiff", "2111148", "4.3%", "1665247", "428260", "17641", "43963", "2391" ] ], "title": "", "original_id": "aa9a653502bd85c8923c87279499a902" }, { "_id": "4887619ae03885c4cac73e9bb74be126", "header": [ "School", "2007", "2008", "2009", "2010", "2011" ], "rows": [ [ "Francisco Bravo Medical Magnet High School", "807.0", "818", "815", "820", "832.0" ], [ "Marc and Eva Stern Math and Science School", "718.0", "792", "788", "788", "809.0" ], [ "Oscar De La Hoya Animo Charter High School", "662.0", "726", "709", "710", "744.0" ], [ "James A. Garfield High School", "553.0", "597", "593", "632", "705.0" ], [ "Abraham Lincoln High School", "594.0", "609", "588", "616", "643.0" ], [ "Woodrow Wilson High School", "582.0", "585", "600", "615", "636.0" ], [ "Theodore Roosevelt High School", "557.0", "551", "576", "608", null ], [ "Thomas Jefferson High School", "457.0", "516", "514", "546", "546.0" ], [ "Santee Education Complex", null, "502", "521", "552", "565.0" ] ], "title": "", "original_id": "63778f1c58e40f5f1d126bdcb4c30665" }, { "_id": "ab434520f842c54970bd5f9b04bea54c", "header": [ "class", "wheel arrangement", "railway", "number at doncaster", "number at pyewipe", "number at march" ], "rows": [ [ "d13", "4 - 4 - 0", "ger", "3", "3", "6" ], [ "d14", "4 - 4 - 0", "ger", "0", "0", "1" ], [ "d15", "4 - 4 - 0", "ger", "1", "0", "4" ], [ "e4", "2 - 4 - 0", "ger", "1", "0", "4" ], [ "j14", "0 - 6 - 0", "ger", "0", "0", "1" ], [ "j15", "0 - 6 - 0", "ger", "0", "3", "17" ], [ "j16", "0 - 6 - 0", "ger", "0", "1", "7" ], [ "j17", "0 - 6 - 0", "ger", "0", "2", "15" ], [ "j18", "0 - 6 - 0", "ger", "0", "0", "7" ], [ "j19", "0 - 6 - 0", "ger", "0", "0", "8" ], [ "j20", "0 - 6 - 0", "ger", "0", "0", "14" ], [ "j66", "0 - 6 - 0t", "ger", "0", "3", "10" ], [ "j67", "0 - 6 - 0t", "ger", "0", "0", "1" ], [ "j68", "0 - 6 - 0t", "ger", "0", "0", "1" ] ], "title": "", "original_id": "5fff0c0fb4be0e28ec40c3b1dcbcd84b" }, { "_id": "044e4cdbedef55274d201e851cd65c00", "header": [ "university", "established as a university", "first establishment", "student population ( fte , 2009)", "research grants (2009 , in billion sek )" ], "rows": [ [ "uppsala university", "1477", "1477", "20450", "3.265" ], [ "lund university", "1666", "1666", "28554", "3.975" ], [ "university of gothenburg", "1954", "1891", "24900", "2.999" ], [ "stockholm university", "1960", "1878", "28200", "2.203" ], [ "karolinska institutet", "1965", "1810", "5500", "4.027" ], [ "umeå university", "1965", "1965", "15850", "1.977" ], [ "royal institute of technology", "1970", "1827", "11950", "2.033" ], [ "linköping university", "1975", "1969", "17200", "1.516" ], [ "swedish university of agricultural sciences", "1977", "1775", "3600", "1.812" ], [ "luleå university of technology", "1997", "1971", "6350", "0.711" ], [ "karlstad university", "1999", "1977", "7750", "0.303" ], [ "örebro university", "1999", "1977", "8600", "0.342" ], [ "mid sweden university", "2005", "1993", "7600", "0.333" ] ], "title": "", "original_id": "7b2b22eab80f669caa57a1b8887c6684" }, { "_id": "a4b6cb83a76c0fe81b0776753047195a", "header": [ "Pump type and source", "Typical use", "35 °C\n(e.g. heated screed floor)", "45 °C\n(e.g. heated screed floor)", "55 °C\n(e.g. heated timber floor)", "65 °C\n(e.g. radiator or DHW)", "75 °C\n(e.g. radiator and DHW)", "85 °C\n(e.g. radiator and DHW)" ], "rows": [ [ "High-efficiency air source heat pump (ASHP), air at −20 °C", null, "2.2", "2.0", "‐", "‐", "‐", "‐" ], [ "Two-stage ASHP, air at −20 °C", "Low source temperature", "2.4", "2.2", "1.9", "‐", "‐", "‐" ], [ "High efficiency ASHP, air at 0 °C", "Low output temperature", "3.8", "2.8", "2.2", "2.0", "‐", "‐" ], [ "Prototype transcritical CO\n2 (R744) heat pump with tripartite gas cooler, source at 0 °C", "High output temperature", "3.3", "‐", "‐", "4.2", "‐", "3.0" ], [ "Ground source heat pump (GSHP), water at 0 °C", null, "5.0", "3.7", "2.9", "2.4", "‐", "‐" ], [ "GSHP, ground at 10 °C", "Low output temperature", "7.2", "5.0", "3.7", "2.9", "2.4", "‐" ], [ "Theoretical Carnot cycle limit, source −20 °C", null, "5.6", "4.9", "4.4", "4.0", "3.7", "3.4" ], [ "Theoretical Carnot cycle limit, source 0 °C", null, "8.8", "7.1", "6.0", "5.2", "4.6", "4.2" ], [ "Theoretical Lorentzen cycle limit (CO\n2 pump), return fluid 25 °C, source 0 °C", null, "10.1", "8.8", "7.9", "7.1", "6.5", "6.1" ], [ "Theoretical Carnot cycle limit, source 10 °C", null, "12.3", "9.1", "7.3", "6.1", "5.4", "4.8" ] ], "title": "", "original_id": "269d45d8e00d4b4d76981406ea14ce69" }, { "_id": "bfec566a18b0c68147fc42f739b56161", "header": [ "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "Measure unit", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)" ], "rows": [ [ "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "Measure unit", "TOTAL", "0–9", "10–19", "20–29", "30–39", "40–49", "50–59", "60–69", "70–79", "80 +" ], [ "I.", "TOTAL", "TOTAL", "TOTAL", "TOTAL", "person", "156", "21", "38", "17", "17", "22", "15", "10", "10", "6" ], [ "I.", "—", "of which in", "of which in", "of which in", "%", "100", "13.5", "24.4", "10.9", "10.9", "14.1", "9.6", "6.4", "6.4", "3.8" ], [ "I.", "1.", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX" ], [ "I.", "1.", "A.", "Males", "Males", "person", "74", "13", "16", "10", "8", "10", "9", "4", "3", "1" ], [ "I.", "1.", "A.", "—", "of which in", "%", "47.4", "8.3", "10.3", "6.4", "5.1", "6.4", "5.8", "2.6", "1.9", "0.6" ], [ "I.", "1.", "B.", "Females", "Females", "person", "82", "8", "22", "7", "9", "12", "6", "6", "7", "5" ], [ "I.", "1.", "B.", "—", "of which in", "%", "52.6", "5.1", "14.1", "4.5", "5.8", "7.7", "3.8", "3.8", "4.5", "3.2" ] ], "title": "", "original_id": "0e6bfa743fe904ddbfc8db43b39bfb3d" }, { "_id": "cf3bbeaa045a608bc774f241d7e856c4", "header": [ "province", "population (2004 estimate)", "area (km square)", "density", "gdp (2003 , pps in mil )", "gdp per cap (2003 , in )" ], "rows": [ [ "south holland", "3453000", "2860", "1207.3", "95868", "27825" ], [ "north holland", "2583900", "2660", "971.4", "65295", "27169" ], [ "utrecht", "1159200", "1356", "854.9", "38355", "33148" ], [ "limburg", "1143000", "2167", "527.5", "28038", "24585" ], [ "north brabant", "2406900", "4938", "487.4", "65295", "27169" ], [ "gelderland", "1967600", "4995", "393.9", "45043", "22942" ], [ "overijssel", "1105800", "3337", "331.4", "25854", "23441" ], [ "flevoland", "356400", "1426", "249.9", "6915", "19439" ], [ "groningen", "575900", "2344", "245.7", "18496", "32245" ], [ "zeeland", "378300", "1792", "211.1", "9354", "24706" ], [ "friesland", "642500", "3361", "191.2", "13989", "21830" ], [ "drenthe", "482300", "2652", "181.9", "10323", "21427" ] ], "title": "", "original_id": "020c4e86f2a942c2b0dbebb4919584d2" }, { "_id": "2ff576acb49ed4b97f8ed3921a6d169b", "header": [ "rank", "peak", "country", "island", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "1", "finisterre range high point", "papua new guinea", "new guinea", "4175", "3734", "441" ], [ "2", "mount suckling", "papua new guinea", "new guinea", "3676", "2976", "700" ], [ "3", "mount wilhelm", "papua new guinea", "new guinea", "4509", "2969", "1540" ], [ "4", "mount victoria", "papua new guinea", "new guinea", "4038", "2738", "1300" ], [ "5", "mount balbi", "papua new guinea", "bougainville island", "2715", "2715", "0" ], [ "6", "mount oiautukekea", "papua new guinea", "goodenough island", "2536", "2536", "0" ], [ "7", "mount giluwe", "papua new guinea", "new guinea", "4367", "2507", "1860" ], [ "8", "new ireland high point", "papua new guinea", "new ireland", "2340", "2340", "0" ], [ "9", "mount ulawun", "papua new guinea", "new britain", "2334", "2334", "0" ], [ "10", "mount kabangama", "papua new guinea", "new guinea", "4104", "2284", "1820" ], [ "11", "nakanai mountains high point", "papua new guinea", "new britain", "2316", "2056", "260" ], [ "12", "mount kilkerran", "papua new guinea", "fergusson island", "1947", "1947", "0" ], [ "13", "mount piora", "papua new guinea", "new guinea", "3557", "1897", "1660" ], [ "14", "mount bosavi", "papua new guinea", "new guinea", "2507", "1887", "620" ], [ "15", "mount karoma", "papua new guinea", "new guinea", "3623", "1883", "1740" ], [ "16", "mount simpson", "papua new guinea", "new guinea", "2883", "1863", "1020" ], [ "17", "mount kunugui", "papua new guinea", "karkar island", "1833", "1833", "0" ], [ "18", "mount victory", "papua new guinea", "new guinea", "1891", "1831", "60" ], [ "19", "manam high point", "papua new guinea", "manam", "1807", "1807", "0" ], [ "20", "mount michael", "papua new guinea", "new guinea", "3647", "1787", "1860" ], [ "21", "mount talawe", "papua new guinea", "new britain", "1824", "1773", "51" ], [ "22", "barurumea ridge", "papua new guinea", "new britain", "2063", "1723", "340" ], [ "23", "mount sarawaget", "papua new guinea", "new guinea", "4121", "1701", "2420" ], [ "24", "bewani mountains high point", "papua new guinea", "new guinea", "1980", "1664", "316" ], [ "25", "mount bel", "papua new guinea", "umboi island", "1658", "1658", "0" ], [ "26", "unnamed summit", "papua new guinea", "new britain", "1951", "1651", "300" ], [ "27", "mount maybole", "papua new guinea", "fergusson island", "1665", "1597", "68" ], [ "28", "adelbert range high point", "papua new guinea", "new guinea", "1716", "1576", "140" ], [ "29", "sibium mountains high point", "papua new guinea", "new guinea", "2295", "1555", "740" ], [ "30", "mount shungol", "papua new guinea", "new guinea", "2752", "1518", "1234" ], [ "31", "mount taraka", "papua new guinea", "bougainville island", "2251", "1511", "740" ] ], "title": "", "original_id": "f70dbcddfad0dc93b70e326d3001cb0c" }, { "_id": "119237f299f70f62a6aaa9fd1082bcee", "header": [ "rd", "pick", "player", "team (league)", "reg gp", "pl gp" ], "rows": [ [ "2", "23", "ron sedlbauer", "kitchener rangers ( oha )", "325", "10" ], [ "3", "41", "john hughes", "toronto marlboros ( oha )", "52", "4" ], [ "4", "59", "harold snepsts", "edmonton oil kings ( wchl )", "781", "44" ], [ "5", "77", "mike rogers", "calgary centennials ( wchl )", "0", "0" ], [ "6", "95", "andy spruce", "london knights ( oha )", "51", "0" ], [ "7", "113", "jim clarke", "toronto marlboros ( oha )", "0", "0" ], [ "8", "130", "robbie watt", "flin flon bombers ( wchl )", "0", "0" ], [ "9", "147", "marc gaudreault", "lake superior state university ( ncaa )", "0", "0" ] ], "title": "", "original_id": "ac040e9638b60682e8102d7bcfc4a8f7" }, { "_id": "94646de7ec23696f96ff5d0a1b42598f", "header": [ "institution", "location", "established", "gained university status", "vice - chancellor", "total number of students", "research funding (000)" ], "rows": [ [ "birkbeck , university of london", "london", "1823", "1920", "professor david latchman", "19020", "9985" ], [ "university of east anglia", "norwich", "1963", "1963", "professor edward acton", "19585", "16482" ], [ "university of essex", "colchester", "1964", "1964", "professor anthony forster", "11690", "9967" ], [ "goldsmiths , university of london", "london", "1891", "1904", "dr pat loughrey", "7615", "8539" ], [ "institute of education , university of london", "london", "1902", "1932", "professor chris husbands", "7215", "7734" ], [ "university of lancaster", "lancaster", "1964", "1964", "professor mark smith", "12695", "18640" ], [ "university of leicester", "leicester", "1921", "1957", "professor robert burgess", "16160", "22225" ], [ "loughborough university", "loughborough", "1909", "1966", "professor robert allison", "17825", "22398" ], [ "royal holloway , university of london", "egham", "1849", "1900", "professor paul layzell (principal)", "7620", "13699" ], [ "soas , university of london", "london", "1916", "1916", "professor paul webley", "4525", "7238" ], [ "university of sussex", "brighton", "1961", "1961", "professor michael farthing", "12415", "16196" ] ], "title": "", "original_id": "426ece7cddb74096a231a636656e3cd3" }, { "_id": "134c03580363d22107186bac746ce31a", "header": [ "rank", "english title", "chinese title", "average", "peak", "premiere", "finale", "hk viewers" ], "rows": [ [ "1", "the family link", "師奶兵團", "33", "42", "31", "33", "2.12 million" ], [ "2", "fathers and sons", "爸爸閉翳", "32", "40", "31", "37", "2.11 million" ], [ "3", "heart of greed", "溏心風暴", "32", "48", "29", "40", "2.08 million" ], [ "4", "ten brothers", "十兄弟", "32", "39", "29", "36", "2.05 million" ], [ "5", "on the first beat", "學警出更", "31", "38", "30", "35", "2.03 million" ], [ "6", "the green grass of home", "緣來自有機", "31", "36", "29", "33", "2.01 million" ], [ "7", "dicey business", "賭場風雲", "31", "37", "30", "34", "1.99 million" ], [ "8", "steps", "舞動全城", "31", "36", "31", "32", "1.98 million" ], [ "9", "the drive of life", "歲月風雲", "30", "39", "31", "33", "1.97 million" ] ], "title": "", "original_id": "9c3b3255f540891cedc76da5e251d40f" }, { "_id": "3ab7010a2a513395340a022ed743300e", "header": [ "rank", "company", "country", "industry", "sales (billion )", "profits (billion )", "assets (billion )", "market value (billion )" ], "rows": [ [ "1", "citigroup", "usa", "banking", "108.28", "17.05", "1 , 4.10", "247.66" ], [ "2", "general electric", "usa", "conglomerates", "152.36", "16.59", "750.33", "372.14" ], [ "3", "american international group", "usa", "insurance", "95.04", "10.91", "776.42", "173.99" ], [ "4", "bank of america", "usa", "banking", "65.45", "14.14", "1110.46", "188.77" ], [ "5", "hsbc", "uk", "banking", "62.97", "9.52", "1031.29", "186.74" ], [ "6", "exxonmobil", "usa", "oil & gas", "263.99", "25.33", "195.26", "405.25" ], [ "7", "royal dutch shell", "netherlands", "oil & gas", "265.19", "18.54", "193.83", "221.49" ], [ "8", "bp", "uk", "oil & gas", "285.06", "15.73", "191.11", "231.88" ], [ "9", "ing group", "netherlands", "diversified financials", "92.01", "8.1", "1175.16", "68.04" ], [ "10", "toyota", "japan", "automotive", "165.68", "11.13", "211.15", "140.89" ] ], "title": "", "original_id": "394939e9fa1967642597a49620069b78" }, { "_id": "537498b50c6bb2fc2ce88ed8b27fea2a", "header": [ "Rank", "Magnitude", "Death toll", "Location", "Depth (km)", "Date" ], "rows": [ [ "1", "7.6", "0", "Peru Madre de Dios Region, Peru", "612.2", "August 19" ], [ "2", "7.5", "2", "Japan Miyazaki Prefecture, Kyushu, Japan", "35.0", "February 26" ], [ "2", "7.5", "0", "Peru Ucayali Region, Peru", "619.9", "August 31" ], [ "3", "7.4", "0", "New Zealand Kermadec Islands, New Zealand", "421.1", "June 18" ], [ "4", "7.3", "0", "Indonesia Gulf of Tomini, Indonesia", "144.8", "March 28" ], [ "4", "7.3", "0", "Vanuatu Vanuatu", "25.0", "July 23" ], [ "4", "7.3", "0", "United Kingdom South Sandwich Islands", "129.2", "September 1" ], [ "5", "7.2", "0", "Japan off the east coast of Honshu, Japan", "30.0", "January 16" ], [ "5", "7.2", "0", "Peru Madre de Dios Region, Peru", "597.5", "August 31" ], [ "6", "7.1", "0", "Japan eastern Hokkaido, Japan", "43.9", "August 11" ], [ "6", "7.1", "0", "United Kingdom South Sandwich Islands", "100.9", "September 8" ], [ "7", "7.0", "0", "Japan off the east coast of Honshu, Japan", "30.0", "January 16" ], [ "7", "7.0", "0", "New Zealand Kermadec Islands, New Zealand", "30.0", "March 7" ], [ "7", "7.0", "0", "China southern Xinjiang Province, China", "35.0", "April 13" ], [ "7", "7.0", "0", "Japan Ryukyu Islands, Japan", "30.6", "July 18" ] ], "title": "", "original_id": "7bec36f08c73ba8d7e122f15b4736e19" }, { "_id": "f5ac5bd722018815de00b67f8be02c79", "header": [ "government", "federal excise tax ( cad / l )", "total excise tax (cad / l)", "minimum tax incl sales taxes (cad / l)", "min tax (cad / us gal)" ], "rows": [ [ "canada (average)", "10", "24.5", "25.3", "95.8" ], [ "newfoundland and labrador", "10", "26.5", "29.9", "113.2" ], [ "prince edward island", "10", "25.8", "27.0", "102.2" ], [ "nova scotia", "10", "25.5", "29.3", "110.9" ], [ "new brunswick", "10", "23.6", "26.7", "101.1" ], [ "québec excluding montréal", "10", "30.2", "46.5", "175.8" ], [ "ontario", "10", "24.7", "27.9", "105.7" ], [ "manitoba", "10", "24.0", "22.6", "85.6" ], [ "saskatchewan", "10", "25.0", "26.2", "99.2" ], [ "alberta", "10", "19.0", "20.0", "75.7" ], [ "british columbia excluding vancouver and victoria", "10", "30.06", "31.56", "119.5" ], [ "yukon", "10", "16.2", "17.0", "64.4" ], [ "northwest territories", "10", "20.7", "21.7", "82.1" ], [ "nunavut", "10", "20.7", "21.7", "82.1" ], [ "montréal , qc", "10", "33.2", "49.7", "187.8" ], [ "vancouver , bc", "10", "39.06", "41.01", "155.2" ], [ "victoria , bc", "10", "33.56", "35.24", "133.4" ] ], "title": "", "original_id": "04cf2b8af2cc55d95cbf6e7103be20ae" }, { "_id": "dcbc9152782e320444b9eea6cc2d4953", "header": [ "rank ( wjc )", "rank (arda)", "metro area", "number of jews (wjc)", "number of jews (asarb)" ], "rows": [ [ "1", "1", "new york city", "1750000", "2028200" ], [ "2", "3", "miami", "535000", "337000" ], [ "3", "2", "los angeles", "490000", "662450" ], [ "4", "4", "philadelphia", "254000", "285950" ], [ "5", "6", "chicago", "248000", "265400" ], [ "6", "8", "san francisco", "210000", "218700" ], [ "7", "7", "boston", "208000", "261100" ] ], "title": "", "original_id": "2c2b2f4c7e4731dc5f241888ad978878" }, { "_id": "13d54233d58129944e88b34bd38e2a31", "header": [ "Works no.", "Year built", "NGR no.", "SAR no.", "SAR Class" ], "rows": [ [ "18829", "1909", "330", "1446", "3R" ], [ "18830", "1909", "331", "1447", "3R" ], [ "18831", "1909", "332", "1448", "3R" ], [ "18832", "1909", "333", "1449", "3R" ], [ "18833", "1909", "334", "1450", "3R" ], [ "19217", "1910", "345", "1451", "3R" ], [ "19218", "1910", "346", "1452", "3R" ], [ "19219", "1910", "347", "1453", "3R" ], [ "19220", "1910", "348", "1454", "3R" ], [ "19221", "1910", "349", "1455", "3R" ], [ "19222", "1910", "350", "1456", "3R" ], [ "19223", "1910", "351", "1457", "3" ], [ "19224", "1910", "352", "1458", "3R" ], [ "19225", "1910", "353", "1459", "3R" ], [ "19226", "1910", "354", "1460", "3R" ], [ "19227", "1910", "355", "1461", "3R" ], [ "19228", "1910", "356", "1462", "3R" ], [ "19229", "1910", "357", "1463", "3R" ], [ "19230", "1910", "358", "1464", "3R" ], [ "19231", "1910", "359", "1465", "3R" ], [ "19232", "1910", "360", "1466", "3R" ], [ "19233", "1910", "361", "1467", "3R" ], [ "19234", "1910", "362", "1468", "3R" ], [ "19235", "1910", "363", "1469", "3R" ], [ "19236", "1910", "364", "1470", "3R" ], [ "19237", "1910", "365", "1471", "3R" ], [ "19238", "1910", "366", "1472", "3R" ], [ "19239", "1910", "367", "1473", "3R" ], [ "19240", "1910", "368", "1474", "3R" ], [ "19241", "1910", "369", "1475", "3R" ] ], "title": "", "original_id": "cc21a2e2ee8475bf4f2f7e6bc0021832" }, { "_id": "5b83217da3b11fc221d63e9f48789c29", "header": [ "hand", "1 credit", "2 credits", "3 credits", "4 credits", "5 credits" ], "rows": [ [ "natural royal flush", "300", "600", "900", "1200", "4000" ], [ "four deuces", "200", "400", "600", "800", "1000" ], [ "wild royal flush", "25", "50", "75", "100", "125" ], [ "five of a kind", "15", "30", "45", "60", "75" ], [ "straight flush", "9", "18", "27", "36", "45" ], [ "four of a kind", "5", "10", "15", "20", "25" ], [ "full house", "3", "6", "9", "12", "15" ], [ "flush", "2", "4", "6", "8", "10" ], [ "straight", "2", "4", "6", "8", "10" ], [ "three of a kind", "1", "2", "3", "4", "5" ] ], "title": "", "original_id": "94a9383e2a483fdd061810759e892812" }, { "_id": "ad19dcf559c03b4f9a979cb0c7117bdb", "header": [ "position", "album title", "artist", "highest position", "sales" ], "rows": [ [ "1", "scissor sisters", "scissor sisters", "1", "1594259" ], [ "2", "hopes and fears", "keane", "1", "1593677" ], [ "3", "greatest hits", "robbie williams", "1", "1530000" ], [ "4", "songs about jane", "maroon 5", "1", "1495000" ], [ "5", "call off the search", "katie melua", "1", "1350000" ], [ "6", "anastacia", "anastacia", "1", "1110000" ], [ "7", "confessions", "usher", "1", "1095000" ], [ "8", "encore", "eminem", "1", "1077000" ], [ "9", "feels like home", "norah jones", "1", "1000000" ], [ "10", "final straw", "snow patrol", "3", "980000" ], [ "11", "il divo", "il divo", "1", "960000" ], [ "12", "greatest hits", "guns n' roses", "1", "920000" ], [ "13", "10 years of hits", "ronan keating", "1", "870000" ], [ "14", "a grand don't come for free", "the streets", "1", "869000" ], [ "15", "how to dismantle an atomic bomb", "u2", "1", "855000" ], [ "16", "the soul sessions", "joss stone", "4", "775000" ], [ "17", "franz ferdinand", "franz ferdinand", "3", "770000" ], [ "18", "american idiot", "green day", "1", "746364" ], [ "19", "unwritten", "natasha bedingfield", "1", "680000" ], [ "20", "patience", "george michael", "1", "660000" ], [ "21", "friday 's child", "will young", "1", "640000" ], [ "22", "ultimate kylie", "kylie minogue", "4", "595000" ], [ "23", "speakerboxxx / the love below", "outkast", "8", "590000" ], [ "24", "allow us to be frank", "westlife", "3", "585000" ], [ "25", "greatest hits : my prerogative", "britney spears", "2", "585000" ], [ "26", "elephunk", "the black eyed peas", "3", "580000" ], [ "27", "twentysomething", "jamie cullum", "3", "565000" ], [ "28", "greatest hits", "shania twain", "6", "545000" ], [ "29", "room on the third floor", "mcfly", "1", "540000" ], [ "30", "life for rent", "dido", "1", "520000" ], [ "31", "under my skin", "avril lavigne", "1", "510000" ], [ "32", "o", "damien rice", "8", "495000" ], [ "33", "mind body & soul", "joss stone", "1", "490000" ], [ "34", "the college dropout", "kanye west", "12", "455000" ], [ "35", "thank you", "jamelia", "4", "425000" ], [ "36", "destiny fulfilled", "destiny 's child", "5", "420000" ], [ "37", "best of", "blue", "6", "415000" ], [ "38", "the best of", "leann rimes", "2", "410000" ], [ "39", "love songs : a compilation old and new", "phil collins", "10", "408000" ], [ "40", "the singles 1992 - 2003", "no doubt", "5", "406000" ] ], "title": "", "original_id": "eb0fb4b94b11893ab0deabdb1ea670e5" }, { "_id": "e350284db05bf4fa34a054f714490463", "header": [ "institution", "location", "founded", "enrollment", "nickname", "varsity sports", "joined" ], "rows": [ [ "college of idaho", "caldwell , idaho (31041)", "1891", "1042", "coyotes", "17", "1988" ], [ "concordia university", "portland , oregon (538554)", "1905", "3111", "cavaliers", "13", "1988" ], [ "corban university", "salem , oregon (142914)", "1935", "1160", "warriors", "13", "1988" ], [ "eastern oregon university", "la grande , oregon (12282)", "1929", "3743", "mountaineers", "10", "1988" ], [ "the evergreen state college", "olympia , washington (44114)", "1967", "4509", "geoducks", "8", "1999" ], [ "northwest university", "kirkland , washington (45814)", "1934", "1280", "eagles", "9", "1997" ], [ "northwest christian university", "eugene , oregon (142185)", "1895", "1290", "beacons", "12", "2007" ], [ "oregon institute of technology", "klamath falls , oregon (20840)", "1947", "3927", "owls", "9", "1988" ], [ "southern oregon university", "ashland , oregon (20406)", "1882", "6744", "raiders", "12", "1988" ], [ "warner pacific college", "portland , oregon (538554)", "1937", "1333", "knights", "9", "1999" ] ], "title": "", "original_id": "447813cef258e268820b0788458283ad" }, { "_id": "39d35fcf27eb50a51972d7af4a75605d", "header": [ "rank", "building", "height", "floors", "completed" ], "rows": [ [ "1", "fenwick tower (residential)", "98 m (322ft)", "32", "1971" ], [ "2", "purdy 's wharf tower 2 (office)", "88 m (289ft)", "22", "1990" ], [ "3", "1801 hollis street (office)", "87 m (285ft)", "22", "1985" ], [ "4", "barrington tower (office)", "84 m (276ft)", "20", "1975" ], [ "5", "cogswell tower (office)", "79 m (259ft)", "20", "1975" ], [ "6", "maritime centre (office)", "78 m (256ft)", "21", "1974" ], [ "7", "queen square (office)", "75 m (246ft)", "19", "1975" ], [ "8", "purdy 's wharf tower 1 (office)", "74 m (243ft)", "18", "1985" ], [ "9", "bank of montreal building (office)", "73 m (240ft)", "18", "1971" ], [ "10", "td tower (office)", "73 m (240ft)", "18", "1974" ], [ "11", "duke tower (office)", "71 m (233ft)", "16", "1970" ], [ "12", "founders square (office)", "71 m (233ft)", "15", "1970" ], [ "13", "tupper building (educational)", "70 m (233ft)", "16", "1967" ], [ "14", "park victoria (residential)", "70 m (233ft)", "21", "1969" ], [ "15", "summer gardens (residential)", "70 m (233ft)", "21", "1990" ], [ "16", "loyola residence tower (residential)", "67 m (220ft)", "22", "1971" ], [ "17", "metropolitan place (office)", "67 m (218ft)", "16", "1987" ], [ "18", "bank of commerce (office)", "66 m (217ft)", "16", "1977" ], [ "19", "the trillium (residential)", "65 m (213ft)", "19", "2011" ] ], "title": "", "original_id": "234c6edbcd38217533fb4463d944bf90" }, { "_id": "18f0d71414bfc141d91a3fbde18d3a33", "header": [ "no", "episode", "air date", "timeslot", "rating", "share", "1849 (rating / share)", "viewers (m)", "rank " ], "rows": [ [ "1", "pilot", "2007 - 09 - 25 september 25 , 2007", "tuesday 9 / 8c", "2.1", "3", "1.5 / 3", "3.28", "85" ], [ "2", "charged", "2007 - 10 - 02 october 2 , 2007", "tuesday 9 / 8c", "1.8", "3", "1.3 / 3", "2.86", "93" ], [ "3", "all mine", "2007 - 10 - 09 october 9 , 2007", "tuesday 9 / 8c", "1.8", "3", "1.3 / 3", "2.65", "90" ], [ "4", "magic", "2007 - 10 - 16 october 16 , 2007", "tuesday 9 / 8c", "2.2", "3", "1.5 / 3", "3.27", "86" ], [ "5", "what about blob", "2007 - 10 - 23 october 23 , 2007", "tuesday 9 / 8c", "1.8", "3", "1.2 / 3", "2.61", "88" ], [ "6", "leon", "2007 - 10 - 30 october 30 , 2007", "tuesday 9 / 8c", "1.7", "3", "1.1 / 3", "2.6", "89" ], [ "7", "love , bullets and blacktop", "2007 - 11 - 06 november 6 , 2007", "tuesday 9 / 8c", "1.6", "2", "1.0 / 2", "2.42", "94" ], [ "8", "the cop", "2007 - 11 - 13 november 13 , 2007", "tuesday 9 / 8c", "1.6", "2", "1.2 / 2", "2.46", "93" ], [ "9", "ashes to ashes", "2007 - 11 - 27 november 27 , 2007", "tuesday 9 / 8c", "1.5", "2", "1.1 / 2", "2.26", "91" ], [ "10", "cash out", "2007 - 12 - 04 december 4 , 2007", "tuesday 9 / 8c", "1.7", "3", "1.3 / 3", "2.64", "89" ], [ "11", "hungry for fame", "2008 - 03 - 13 march 13 , 2008", "thursday 9 / 8c", "1.7", "3", "1.2 / 3", "2.81", "88" ], [ "12", "unseen", "2008 - 03 - 20 march 20 , 2008", "thursday 9 / 8c", "1.9", "3", "1.2 / 3", "2.94", "79" ], [ "13", "acid queen", "2008 - 03 - 27 march 27 , 2008", "thursday 9 / 8c", "1.8", "3", "1.2 / 2", "2.76", "81" ], [ "14", "rebellion", "2008 - 04 - 22 april 22 , 2008", "tuesday 9 / 8c", "1.6", "2", "1.1 / 3", "2.6", "93" ], [ "15", "coming to grips", "2008 - 04 - 29 april 29 , 2008", "tuesday 9 / 8c", "1.7", "3", "1.1 / 3", "2.51", "86" ], [ "16", "greg schmeg", "2008 - 05 - 06 may 6 , 2008", "tuesday 9 / 8c", "1.6", "2", "1.0 / 3", "2.47", "tba" ], [ "17", "the leak", "2008 - 05 - 13 may 13 , 2008", "tuesday 9 / 8c", "1.5", "2", "0.9 / 2", "1.99", "tba" ] ], "title": "", "original_id": "7fe4b8c7bbb482bd28dc3cf9a6f7e023" }, { "_id": "b3107f0cc60c803743d2d017ba87f193", "header": [ "interval name", "size (steps)", "size (cents)", "just ratio", "just (cents)", "error" ], "rows": [ [ "perfect fifth", "24", "702.44", "3:2", "701.96", "+ 0.48" ], [ "septimal tritone", "20", "585.37", "7:5", "582.51", "+ 2.85" ], [ "11:8 wide fourth", "19", "556.1", "11:8", "551.32", "+ 4.78" ], [ "15:11 wide fourth", "18", "526.83", "15:11", "536.95", "10.12" ], [ "27:20 wide fourth", "18", "526.83", "27:20", "519.55", "+ 7.28" ], [ "perfect fourth", "17", "497.56", "4:3", "498.04", "0.48" ], [ "septimal narrow fourth", "16", "468.29", "21:16", "470.78", "2.48" ], [ "septimal major third", "15", "439.02", "9:7", "435.08", "+ 3.94" ], [ "undecimal major third", "14", "409.76", "14:11", "417.51", "7.75" ], [ "pythagorean major third", "14", "409.76", "81:64", "407.82", "+ 1.94" ], [ "major third", "13", "380.49", "5:4", "386.31", "5.83" ], [ "inverted 13th harmonic", "12", "351.22", "16:13", "359.47", "8.25" ], [ "undecimal neutral third", "12", "351.22", "11:9", "347.41", "+ 3.81" ], [ "minor third", "11", "321.95", "6:5", "315.64", "+ 6.31" ], [ "pythagorean minor third", "10", "292.68", "32:27", "294.13", "1.45" ], [ "tridecimal minor third", "10", "292.68", "13:11", "289.21", "+ 3.47" ], [ "septimal minor third", "9", "263.41", "7:6", "266.87", "3.46" ], [ "septimal whole tone", "8", "234.15", "8:7", "231.17", "+ 2.97" ], [ "whole tone , major tone", "7", "204.88", "9:8", "203.91", "+ 0.97" ], [ "whole tone , minor tone", "6", "175.61", "10:9", "182.4", "6.79" ], [ "lesser undecimal neutral second", "5", "146.34", "12:11", "150.64", "4.30" ], [ "septimal diatonic semitone", "4", "117.07", "15:14", "119.44", "2.37" ], [ "diatonic semitone", "4", "117.07", "16:15", "111.73", "+ 5.34" ], [ "pythagorean diatonic semitone", "3", "87.8", "256:243", "90.22", "2.42" ], [ "septimal chromatic semitone", "3", "87.8", "21:20", "84.47", "+ 3.34" ], [ "chromatic semitone", "2", "58.54", "25:24", "70.67", "12.14" ], [ "28:27 semitone", "2", "58.54", "28:27", "62.96", "4.42" ], [ "septimal comma", "1", "29.27", "64:63", "27.26", "+ 2.00" ] ], "title": "", "original_id": "0b5b037022d36184f582c1aaf15969ad" }, { "_id": "3107194634e19e06bfaf0e06efa36ab1", "header": [ "peak", "country", "elevation (m)", "prominence (m)", "col (m)" ], "rows": [ [ "mount ida", "greece ( crete )", "2456", "2456", "0" ], [ "taygetus", "greece", "2404", "2344", "60" ], [ "lefka ori", "greece ( crete )", "2453", "2038", "415" ], [ "mount olympus", "cyprus", "1952", "1952", "0" ], [ "mount kyllini", "greece", "2376", "1870", "506" ], [ "dikti", "greece ( crete )", "2148", "1798", "350" ], [ "dirfi", "greece ( euboea )", "1743", "1743", "0" ], [ "mount ainos", "greece ( kefalonia )", "1628", "1628", "0" ], [ "fengari", "greece ( samothrace )", "1611", "1611", "0" ] ], "title": "", "original_id": "6ebaaae261c6b9d895458c5ebe3795a3" }, { "_id": "ed5e3196aad6e9a982d31fa94497fbe6", "header": [ "physical property", "helium", "neon", "argon", "krypton", "xenon" ], "rows": [ [ "boiling point (degree)", "268.8", "245.9", "185.8", "151.7", "106.6" ], [ "melting point (degree)", "-", "248.5", "189.6", "157.4", "111.5" ], [ "critical temperature (k)", "5.25", "44.5", "150.85", "209.35", "289.74" ], [ "critical pressure (atm)", "2.26", "26.9", "48.3", "54.3", "57.64" ], [ "critical density (g / ml)", "0.0693", "0.484", "0.536", "0.908", "1.1" ], [ "triple point temperature (k)", "24.562", "83.8", "115.76", "161.37", "202.0" ], [ "triple point pressure (kpa)", "5.1", "43.37", "68.9", "73.15", "81.66" ] ], "title": "", "original_id": "c7bc350bc9bde43c892968a9664344be" }, { "_id": "413d4285f40fcf65977a578eebc23c92", "header": [ "rank in nyagatare sectors , 2012", "sector", "area in sqkm", "population august 15 , 2012", "population , august 15 , 2002", "population change 2002 - 2012 (%)", "population density 2012 (km 2 )" ], "rows": [ [ "8", "gatunda", "52", "27879", "19716", "41.4", "535" ], [ "10", "karama", "53", "26727", "19727", "35.5", "499" ], [ "2", "karangazi", "563", "56871", "21234", "167.8", "101" ], [ "4", "katabagemu", "98", "34651", "22101", "56.8", "354" ], [ "14", "kiyombe", "69", "17061", "16483", "3.5", "247" ], [ "11", "matimba", "79", "24168", "13476", "79.3", "307" ], [ "9", "mimuli", "48", "27366", "22452", "21.9", "573" ], [ "12", "mukama", "64", "21819", "17970", "21.4", "339" ], [ "7", "musheli", "96", "32403", "14742", "119.8", "338" ], [ "3", "nyagatare", "164", "52125", "19475", "167.7", "317" ], [ "5", "rukomo", "58", "34377", "20945", "64.1", "588" ], [ "13", "rwempasha", "169", "19328", "11428", "69.1", "115" ], [ "1", "rwimiyaga", "309", "58847", "16802", "250.2", "190" ], [ "6", "tabagwe", "106", "33322", "18533", "79.6", "313" ] ], "title": "", "original_id": "be0a8690532485156b570f11e933f6fe" }, { "_id": "9e462fba4252b3dd3a6f738215996072", "header": [ "peak", "elevation (m)", "prominence (m)", "isolation (km)", "municipality", "county" ], "rows": [ [ "galdhøpiggen", "2469", "2372", "1570", "lom", "oppland" ], [ "jiehkkevárri", "1833", "1741", "140", "lyngen , tromsø", "troms" ], [ "snøhetta", "2286", "1675", "83", "dovre", "oppland" ], [ "store lenangstind", "1625", "1576", "47", "lyngen", "troms" ], [ "gjegnen / blånibba", "1670", "1460", "47", "bremanger", "sogn og fjordane" ], [ "hamperokken", "1404", "1396", "18", "tromsø", "troms" ], [ "skårasalen", "1542", "1385", "7", "ørsta", "møre og romsdal" ], [ "oksskolten", "1916", "1384", "185", "hemnes", "nordland" ], [ "botnafjellet", "1572", "1339", "15", "gloppen", "sogn og fjordane" ], [ "kvitegga", "1717", "1324", "23", "stranda , ørsta", "møre og romsdal" ], [ "fresvikbreen", "1660", "1310", "17", "vik", "sogn og fjordane" ], [ "smørskredtindane", "1630", "1306", "12", "stranda , ørsta", "møre og romsdal" ], [ "njunis", "1717", "1305", "53", "målselv", "troms" ], [ "store trolla", "1850", "1292", "11", "sunndal", "møre og romsdal" ], [ "langlitinden", "1276", "1276", "26", "ibestad", "troms" ], [ "indre russetind", "1527", "1268", "9", "balsfjord", "troms" ], [ "møysalen", "1262", "1262", "60", "hinnøya", "nordland" ], [ "stortind", "1320", "1242", "14", "tromsø", "troms" ], [ "folgefonna", "1660", "1233", "29", "kvinnherad , odda", "hordaland" ], [ "daurmål", "1446", "1230", "4", "gloppen , jølster", "sogn og fjordane" ] ], "title": "", "original_id": "2d3e281b34b0a331871518a8fee622e3" }, { "_id": "3e5084fd782edcb2201af7704704e3c1", "header": [ "Player", "G", "IP", "W", "L", "ERA", "SO" ], "rows": [ [ "Noodles Hahn", "35", "297.2", "16", "18", "2.06", "98" ], [ "Jack Harper", "34", "293.2", "23", "9", "2.30", "125" ], [ "Win Kellum", "31", "224.2", "15", "10", "2.60", "70" ], [ "Tom Walker", "24", "217", "15", "8", "2.24", "64" ], [ "Bob Ewing", "26", "212", "11", "13", "2.46", "99" ], [ "Jack Sutthoff", "12", "90", "5", "6", "2.30", "27" ] ], "title": "", "original_id": "2962b6f7f7a0902cee3063e870704e24" }, { "_id": "021bd35badd26b928ee88a7777319153", "header": [ "chambering", "p1 diameter (mm)", "a external (cm 2 )", "p max ( bar )", "f bolt ( kgf )", "f bolt" ], "rows": [ [ ".22 long rifle", "5.74", "0.2587", "1650", "435", "n (lbf)" ], [ "9x19 mm parabellum", "9.93", "0.7744", "2350", "1820", "n ( lbf )" ], [ ".357 sig", "10.77", "0.911", "3050", "2779", "n (lbf)" ], [ ".380 acp", "9.7", "0.739", "1500", "1130", "n (lbf)" ], [ ".40 s&w", "10.77", "0.911", "2250", "2050", "n (lbf)" ], [ "10 mm auto", "10.81", "0.9178", "2300", "2111", "n (lbf)" ], [ ".45 acp", "12.09", "1.1671", "1300", "1517", "n (lbf)" ], [ ".454 casull", "12.13", "1.1556", "3900", "4507", "n (lbf)" ] ], "title": "", "original_id": "e81397add1c0790a16461b55739e62f0" }, { "_id": "ee515e26294b20dc47d6b95e2b7185cb", "header": [ "country", "number of troops", "% of total troops", "troops per one million population", "troops per 1 billion ( usd ) gdp" ], "rows": [ [ "united states", "74400", "68.216%", "291.3", "6.06" ], [ "united kingdom", "9500", "7.201%", "153.5", "4.21" ], [ "germany", "4318", "3.721%", "59.8", "1.44" ], [ "italy", "4000", "3.016%", "63.5", "1.81" ], [ "france", "2453", "2.892%", "61.4", "1.49" ], [ "poland", "2432", "1.915%", "66.5", "5.41" ], [ "romania", "1808", "1.308%", "81.4", "10.52" ], [ "georgia", "1561", "1.218%", "219.0", "85.95" ], [ "australia", "1550", "1.175%", "72.1", "1.35" ], [ "spain", "1500", "1.136%", "33.1", "1.02" ], [ "turkey", "1271", "1.364%", "23.8", "2.76" ], [ "canada", "950", "2.198%", "27.7", "1.85" ], [ "denmark", "624", "0.565%", "136.4", "2.35" ], [ "bulgaria", "563", "0.584%", "81.1", "12.66" ], [ "norway", "538", "0.313%", "85.0", "1.01" ], [ "belgium", "520", "0.400%", "49.3", "1.13" ], [ "netherlands", "500", "0.149%", "11.8", "0.24" ], [ "sweden", "500", "0.671%", "53.8", "1.14" ], [ "czech republic", "423", "0.351%", "44.5", "2.35" ], [ "hungary", "563", "0.584%", "48.4", "3.57" ], [ "republic of korea", "350", "0.323%", "8.8", "0.47" ], [ "slovakia", "343", "0.224%", "54.7", "3.01" ], [ "croatia", "320", "0.227%", "67.8", "4.66" ], [ "lithuania", "241", "0.142%", "57.7", "4.99" ], [ "albania", "211", "0.195%", "81.1", "19.59" ], [ "finland", "181", "0.125%", "30.8", "0.71" ], [ "latvia", "180", "0.103%", "60.7", "5.38" ], [ "macedonia", "177", "0.124%", "79.9", "17.12" ], [ "estonia", "154", "0.120%", "117.8", "8.21" ], [ "new zealand", "152", "0.179%", "54.9", "2.00" ], [ "portugal", "137", "0.086%", "10.7", "0.49" ], [ "armenia", "127", "0.030%", "42.8", "3.36" ], [ "mongolia", "101", "0.047%", "23.0", "11.79" ], [ "azerbaijan", "94", "0.071%", "10.5", "2.04" ], [ "slovenia", "80", "0.060%", "38.9", "1.60" ], [ "bosnia and herzegovina", "59", "0.034%", "12.0", "2.45" ], [ "tonga", "55", "0.047%", "528.8", "183.70" ], [ "malaysia", "42", "0.023%", "1.1", "0.16" ], [ "montenegro", "41", "0.027%", "57.5", "7.47" ], [ "united arab emirates", "35", "0.027%", "7.4", "0.12" ], [ "ukraine", "24", "0.015%", "0.4", "0.17" ], [ "greece", "12", "0.100%", "11.8", "0.40" ], [ "luxembourg", "10", "0.007%", "18.3", "0.17" ], [ "ireland", "6", "0.005%", "1.5", "0.03" ], [ "austria", "3", "0.002%", "0.4", "0.01" ], [ "iceland", "3", "0.002%", "6.1", "0.17" ], [ "isaf exact total", "112579", "100.000%", "117.1 (average)", "3.49 (average)" ] ], "title": "", "original_id": "7c6e7784308c8ce8f52b80e50368bc49" }, { "_id": "0858a8ee1ba85b8c3ece21966158f385", "header": [ "no", "name", "mi from kingston", "km from kingston", "parish", "length feet", "length meters" ], "rows": [ [ "1", "scotts pass", "44.25", "71.2", "clarendon", "70", "21.3" ], [ "2", "scotts pass", "44.5", "71.6", "clarendon", "170", "51.8" ], [ "3", "comfort hall", "65.5", "105.4", "st elizabeth", "688", "209.1" ], [ "4", "balaclava", "70.0", "112.6", "st elizabeth", "348", "106.1" ], [ "5", "highworth", "84.0", "135.2", "st elizabeth", "182", "55.5" ], [ "6", "y s", "84.5", "136.0", "st elizabeth", "218", "66.4" ], [ "7", "ipswich", "86.25", "138.8", "st elizabeth", "855", "260.6" ], [ "8", "unnamed", "87.75", "141.2", "st james", "555", "164.6" ], [ "9", "merrywood", "88.5", "142.4", "st james", "362", "115.8" ], [ "10", "anchovy", "104.5", "168.2", "st james", "102", "31.1" ], [ "11", "ramble", "108.0", "173.8", "st james", "182", "55.5" ], [ "12", "bogue hill", "108.5", "174.6", "st james", "1276", "388.9" ] ], "title": "", "original_id": "979a0eff0ecb9837c0a9c7968160830e" }, { "_id": "a5e2cdf14939e184e0bb158e2cd57812", "header": [ "ecozone", "area (km square) territorial waters", "area (km square) exclusive economic zone", "percentage of total area (foreez)", "percentage of marine area (foreez)" ], "rows": [ [ "pacific marine", "102920", "457646", "3.1", "8.3" ], [ "arctic basin marine", "24997", "704849", "4.8", "12.7" ], [ "arctic archipelago marine", "2051393", "2178998", "14.8", "39.3" ], [ "northwest atlantic marine", "536895", "1205981", "8.2", "21.8" ], [ "atlantic marine", "72144", "996439", "6.8", "17.9" ], [ "total", "2788349", "5543913", "37.7", "100.0" ] ], "title": "", "original_id": "db1f2cac2692f10d66aee19c3bc2ae6c" }, { "_id": "d697fcf2541d0982d00d1a13cae21838", "header": [ "line", "operator", "line length (kilometres)", "number of stations", "annual ridership (1998)", "annual ridership (2008)" ], "rows": [ [ "mitre", "ugoms", "185 , 5", "55", "84081493", "73207048" ], [ "belgrano norte", "ferrovías", "54 , 3", "22", "35931801", "45830200" ], [ "belgrano sur", "ugofe", "66 , 3", "30", "16219806", "11472416" ], [ "roca", "ugofe", "237 , 2", "70", "152082063", "125556026" ], [ "san martín", "ugofe", "56 , 3", "19", "25581310", "46647676" ], [ "sarmiento", "ugoms", "184 , 1", "40", "113218819", "118143006" ], [ "urquiza", "metrovías", "29 , 9", "23", "25581310", "24212133" ], [ "totals :", "-", "813", "259", "451971849", "445068505" ] ], "title": "", "original_id": "8854b91e5e00c20c99e6434d90887fe5" }, { "_id": "c58bba82dbd1dee481d4cd0c8e9d7598", "header": [ "rank", "location", "total passengers", "annual change", "capacity", "capacity in use" ], "rows": [ [ "1", "são paulo", "26849185", "23.57%", "20500000", "130.97%" ], [ "2", "são paulo", "15499462", "13.14%", "12000000", "129.16%" ], [ "3", "brasília", "14347061", "17.46%", "10000000", "143.47%" ], [ "4", "rio de janeiro", "12337944", "4.3%", "18000000", "68.54%" ], [ "5", "rio de janeiro", "7822848", "53.4%", "5000000", "156.45%" ], [ "6", "salvador", "7696307", "9.13%", "6000000", "128.27%" ], [ "7", "belo horizonte", "7261064", "29.26%", "5000000", "145.22%" ], [ "8", "porto alegre", "6676216", "19.1%", "4000000", "166.9%" ], [ "9", "recife", "5958982", "13.49%", "9000000", "66.21%" ], [ "10", "curitiba", "5774615", "18.97%", "6000000", "96.16%" ], [ "11", "campinas", "5430066", "61.39%", "3500000", "155.14%" ], [ "12", "fortaleza", "5072721", "20.44%", "3000000", "169.09%" ], [ "13", "manaus", "2705131", "17.6%", "1800000", "150.28%" ], [ "14", "florianópolis", "2672250", "26.7%", "1100000", "242.93%" ], [ "15", "vitória", "2644729", "12.9%", "560000", "472.27%" ], [ "16", "belém", "2570899", "16.7%", "2700000", "95.21%" ], [ "17", "natal", "2413416", "27.4%", "1500000", "160.89%" ], [ "18", "goinia", "2348648", "32.5%", "600000", "391.44%" ], [ "19", "cuiabá", "2134267", "27.7%", "1600000", "133.39%" ], [ "20", "maceió", "1431781", "28.15%", "1200000", "119 , 31%" ] ], "title": "", "original_id": "4a7f8f5b7fe1a05ef29d8a979b8f013f" }, { "_id": "f857987537701367e36338ecf97cd902", "header": [ "name", "2011 census", "2006 census", "% change", "land area (km square)", "density (pop / km square)", "population rank" ], "rows": [ [ "algoma district", "115870", "117461", "- 1.4", "48840.68", "2.4", "21" ], [ "brant county", "136035", "125099", "8.7", "1093.16", "124.4", "17" ], [ "bruce county", "66102", "65349", "1.2", "4087.76", "16.2", "36" ], [ "chatham - kent , municipality of", "104075", "108589", "- 4.2", "2470.69", "42.1", "25" ], [ "cochrane district", "81122", "82503", "- 1.7", "141270.41", "0.6", "33" ], [ "dufferin county", "56881", "54436", "4.5", "1486.31", "38.3", "41" ], [ "durham regional municipality", "608124", "561258", "8.4", "2523.62", "241.0", "5" ], [ "elgin county", "87461", "85351", "2.5", "1880.9", "46.5", "29" ], [ "essex county", "388782", "393402", "- 1.2", "1850.78", "210.1", "12" ], [ "frontenac county", "149738", "143865", "4.1", "3787.79", "39.5", "15" ], [ "greater sudbury , city of", "160376", "157909", "1.6", "3238.01", "49.5", "14" ], [ "grey county", "92568", "92411", "0.2", "4513.21", "20.5", "28" ], [ "haldimand - norfolk", "109118", "107812", "1.2", "2894.82", "37.7", "23" ], [ "haliburton county", "17026", "16147", "5.4", "4071.86", "4.2", "48" ], [ "halton regional municipality", "501669", "439206", "14.2", "964.01", "520.4", "8" ], [ "hamilton , city of", "519949", "504559", "3.1", "1117.23", "465.4", "6" ], [ "hastings county", "134934", "130474", "3.4", "6103.48", "22.1", "18" ], [ "huron county", "59100", "59325", "- 0.4", "3399.63", "17.4", "38" ], [ "kawartha lakes , city of", "73214", "74561", "- 1.8", "3083.06", "23.7", "35" ], [ "kenora district", "57607", "64419", "- 10.6", "407213.01", "0.1", "40" ], [ "lambton county", "126199", "128204", "- 1.6", "3002.07", "42.0", "20" ], [ "lanark county", "65867", "63785", "3.0", "3003.82", "21.6", "37" ], [ "leeds and grenville , united counties of", "99306", "99206", "0.1", "3383.92", "29.3", "27" ], [ "lennox and addington county", "41824", "40542", "3.2", "2841.1", "14.7", "43" ], [ "manitoulin district", "13048", "12631", "3.3", "3107.11", "4.2", "49" ], [ "middlesex county", "439151", "422333", "4.0", "3317.54", "132.4", "10" ], [ "muskoka district municipality", "58047", "57563", "0.8", "3937.76", "14.7", "39" ], [ "niagara regional municipality", "431346", "427421", "0.9", "1854.25", "232.6", "11" ], [ "nipissing district", "84736", "84688", "0.1", "17103.52", "5.0", "31" ], [ "northumberland county", "82126", "80963", "1.4", "1905.34", "43.1", "32" ], [ "ottawa , city of", "883391", "812129", "8.8", "2790.22", "316.6", "4" ], [ "oxford county", "105719", "102756", "2.9", "2039.56", "51.8", "24" ], [ "parry sound district", "42162", "40918", "3.0", "9322.8", "4.5", "42" ], [ "peel regional municipality", "1296814", "1159455", "11.8", "1246.89", "1040.0", "2" ], [ "perth county", "75112", "74344", "1.0", "2218.46", "33.9", "34" ], [ "peterborough county", "134933", "133080", "1.4", "3847.77", "35.1", "19" ], [ "prescott and russell , united counties of", "85381", "80184", "6.5", "2004.44", "42.6", "30" ], [ "prince edward county", "25258", "25496", "- 0.9", "1050.45", "24.0", "45" ], [ "rainy river district", "20370", "21564", "- 5.5", "15484.83", "1.3", "47" ], [ "renfrew county", "101326", "97545", "3.9", "7440.81", "13.6", "26" ], [ "simcoe county", "446063", "422204", "5.7", "4859.16", "91.8", "9" ], [ "stormont , dundas and glengarry , united counties of", "111164", "110399", "0.7", "3308.84", "33.6", "22" ], [ "sudbury district", "21196", "21851", "- 3.0", "40205.41", "0.5", "46" ], [ "thunder bay district", "146057", "149063", "- 2.0", "103719.51", "1.4", "16" ], [ "timiskaming district", "32634", "33283", "- 1.9", "13299.92", "2.5", "44" ], [ "toronto , city of", "2615060", "2503281", "4.5", "630.21", "4149.5", "1" ], [ "waterloo regional municipality", "507096", "478121", "6.1", "1368.94", "370.4", "7" ], [ "wellington county", "208360", "200425", "4.0", "2660.46", "78.3", "13" ] ], "title": "", "original_id": "ce760118539d5455482744e3607aaf15" }, { "_id": "5f1422ed3f70e5d6d5b5ecc5c5b3af14", "header": [ "country", "carbon dioxide emissions per year (10 6 tons) (2006)", "percentage of global total", "avg emission per km 2 of its land (tons)", "carbon dioxide emissions per year (tons per person) (2007)" ], "rows": [ [ "china", "6103", "21.5%", "636", "4.9" ], [ "united states", "5752", "20.2%", "597", "19.3" ], [ "russia", "1564", "5.5%", "91", "11.6" ], [ "india", "1510", "5.3%", "459", "1.4" ], [ "japan", "1293", "4.6%", "3421", "9.8" ], [ "germany", "805", "2.8%", "2254", "9.6" ], [ "united kingdom", "568", "2.0%", "2338", "8.9" ], [ "canada", "544", "1.9%", "54", "16.5" ], [ "south korea", "475", "1.7%", "4758", "10.5" ] ], "title": "", "original_id": "f743425041cec393cf99fb42233b61e8" }, { "_id": "144912303d7d7500de30616ba1df3386", "header": [ "manager", "years", "games", "wins", "losses" ], "rows": [ [ "chuck goggin", "1978", "141", "64", "77" ], [ "george scherger", "1979", "144", "83", "61" ], [ "stump merrill", "1980 - 1981", "286", "178", "108" ], [ "johnny oates", "1982", "144", "77", "67" ], [ "doug holmquist", "1983", "146", "88", "58" ], [ "jim marshall", "1984", "147", "74", "73" ], [ "lee walls", "1985", "7", "3", "4" ], [ "leon roberts", "1985", "7", "2", "5" ], [ "gordon mackenzie", "1985", "127", "66", "61" ], [ "leon roberts", "1986", "142", "68", "74" ], [ "jack lind", "1987 - 1988", "217", "102", "115" ], [ "wayne garland", "1988", "3", "1", "2" ], [ "george scherger", "1988", "1", "0", "1" ], [ "jim hoff", "1988", "22", "12", "10" ], [ "frank lucchesi", "1988 - 1989", "185", "96", "89" ], [ "pete mackanin", "1990 - 1992", "366", "186", "180" ], [ "dave miley", "1992", "68", "32", "36" ], [ "rick renick", "1993 - 1996", "575", "309", "266" ], [ "tom spencer", "1997", "143", "74", "69" ], [ "trent jewett", "1998 - 2000", "339", "176", "163" ], [ "richie hebner", "2000", "85", "34", "51" ], [ "marty brown", "2001 - 2002", "284", "136", "148" ], [ "trent jewett", "2003 - 2004", "285", "144", "141" ], [ "frank kremblas", "2005 - 2008", "572", "299", "273" ], [ "don money", "2009 - 2011", "432", "223", "209" ], [ "mike guerrero", "2012 - 2013", "288", "124", "164" ], [ "darnell coles", "2014 - beyond", "0", "0", "0" ], [ "totals", "totals", "5157", "2651", "2506" ] ], "title": "", "original_id": "f2b0448d8f1a65a43b44bd17198bf0ea" }, { "_id": "551c13f917a07d79ef6925adb08cd070", "header": [ "episode", "rating", "share", "viewers (millions)", "weekly rank" ], "rows": [ [ "slay everyone , trust no one", "8.1", "13", "14.15", "14" ], [ "it 's getting the best of me", "6.9", "11", "11.94", "11" ], [ "that girl is like a virus", "6.7", "10", "11.6", "14" ], [ "tonight , we make our move", "7.2", "12", "12.72", "17" ], [ "knights of the round table", "7.0", "11", "12.17", "14" ], [ "banana etiquette", "6.6", "11", "11.15", "15" ], [ "i'm not a good villain", "6.7", "12", "11.26", "11" ], [ "expectations", "7.3", "12", "12.38", "13" ], [ "survivor history", "7.1", "13", "12.31", "12" ], [ "going down in flames", "7.0", "12", "11.89", "8" ], [ "jumping ship", "7.6", "13", "12.74", "9" ], [ "a sinking ship", "7.7", "14", "13.06", "8" ], [ "loose lips sink ships", "7.7", "13", "13.28", "11" ], [ "anything could happen", "7.2", "12", "13.46", "9" ], [ "the reunion", "5.9", "10", "10.65", "22" ] ], "title": "", "original_id": "86e19cb374ce7c6940e9a9d467303067" }, { "_id": "4ab0e3804d5f49ed8d082dd24a29ffc0", "header": [ "Animal", "Sex", "Metabolic rate", "Mean", "Difference from mean", "Squared difference from mean" ], "rows": [ [ "1", "Female", "727.7", "1285.5", "557.8", "311140.84" ], [ "2", "Female", "1086.5", "1285.5", "199.0", "39601.00" ], [ "3", "Female", "1091.0", "1285.5", "194.5", "37830.25" ], [ "4", "Female", "1361.3", "1285.5", "75.8", "5745.64" ], [ "5", "Female", "1490.5", "1285.5", "205.0", "42025.00" ], [ "6", "Female", "1956.1", "1285.5", "670.6", "449704.36" ], [ "-", "-", "-", "-", "-", "-" ], [ "Mean of metabolic rates", "Mean of metabolic rates", "Mean of metabolic rates", "1285.5", "Sum of squared differences", "886047.09" ] ], "title": "", "original_id": "f51a77d4ffba1aedfe3cc6743ed3e054" }, { "_id": "0fc5392270225864dd6577bb60a64160", "header": [ "language", "sorata municipality", "guanay municipality", "tacacoma municipality", "quiabaya municipality", "combaya municipality", "tipuani municipality", "mapiri municipality", "teoponte municipality" ], "rows": [ [ "quechua", "363.0", "1.653", "1.058", "33.0", "20.0", "1.587", "3.649", "756.0" ], [ "aymara", "16.029", "3.405", "4.389", "2.269", "2.522", "2.534", "1.767", "2.837" ], [ "guaranã­", "7.0", "5.0", "1.0", "0.0", "0.0", "20.0", "6.0", "6.0" ], [ "another native", "8.0", "94.0", "17.0", "2.0", "1.0", "18.0", "7.0", "22.0" ], [ "spanish", "11.223", "10.064", "4.321", "1.391", "1.214", "8.594", "8.567", "6.211" ], [ "foreign", "70.0", "86.0", "6.0", "6.0", "1.0", "61.0", "17.0", "33.0" ], [ "only native", "6.68", "737.0", "1.599", "1.023", "1.363", "190.0", "363.0", "472.0" ], [ "native and spanish", "9.54", "4.123", "3.389", "1.256", "1.162", "3.499", "4.653", "2.925" ] ], "title": "", "original_id": "2f5bd1470c21eed07d5d123b6aaa1c04" }, { "_id": "dc6738fe051c24488e626105096ec08e", "header": [ "solution", "other name", "(mmol / l)", "(mmol / l).1", "(mmol / l).2", "(mg / dl)" ], "rows": [ [ "d5w", "5% dextrose", "0", "0", "278", "5000" ], [ "2 / 3d & 1 / 3s", "3.3% dextrose / 0.3% saline", "51", "51", "185", "3333" ], [ "half - normal saline", "0.45% nacl", "77", "77", "0", "0" ], [ "normal saline", "0.9% nacl", "154", "154", "0", "0" ], [ "ringer 's lactate", "lactated ringer", "130", "109", "0", "0" ], [ "d5ns", "5% dextrose , normal saline", "154", "154", "278", "5000" ] ], "title": "", "original_id": "f26088bc16a0ad142dc69de97dfd6227" }, { "_id": "f56cf963775848f377b639e3241e07fc", "header": [ "Election year", "# of\nconstituency votes", "% of\nconstituency votes", "+/–", "# of\nparty list votes", "% of\nparty list votes", "+/–.1", "# of\noverall seats won" ], "rows": [ [ "1965", "587,216", "1.8", "1.8", "664,193", "2.0", "2.0", "0 / 518" ], [ "1969", "1,189,375", "3.6", "1.8", "1,422,010", "4.3", "2.3", "0 / 518" ], [ "1972", "194,389", "0.5", "3.1", "207,465", "0.6", "3.7", "0 / 518" ], [ "1976", "136.023", "0.4", "0.1", "122,661", "0.3", "0.3", "0 / 518" ], [ "1980", null, null, null, "68,096", "0.2", "0.1", "0 / 497" ], [ "1983", "57,112", "0.1", "0.3", "91,095", "0.2", "0.0", "0 / 498" ], [ "1987", "182,880", "0.5", "0.4", "227,054", "0.6", "0.4", "0 / 497" ], [ "1990", "190,105", "0.4", "0.1", "145,776", "0.3", "0.3", "0 / 662" ], [ "1998", "45,043", "0.1", "0.3", "126,571", "0.3", "0.0", "0 / 669" ], [ "2002", "103,209", "0.1", "0.1", "215,232", "0.4", "0.1", "0 / 603" ], [ "2005", "857.777", "1.8", "1.6", "748,568", "1.6", "1.2", "0 / 614" ], [ "2009", "768,442", "1.8", "0.0", "635,525", "1.5", "0.1", "0 / 620" ], [ "2013", "634,842", "1.5", "0.3", "560,660", "1.3", "0.2", "0 / 630" ] ], "title": "", "original_id": "b878f1ad3f7646fcd7ede1bc02533f33" }, { "_id": "7797cade115b7f4f92672a141f64829a", "header": [ "party", "administrative panel", "agricultural panel", "cultural and educational panel", "industrial and commercial panel", "labour panel", "national university of ireland", "university of dublin", "nominated by the taoiseach", "total" ], "rows": [ [ "fianna fáil", "2", "3", "2", "2", "2", "1", "0", "0", "12" ], [ "fine gael", "1", "2", "2", "3", "0", "1", "0", "2", "11" ], [ "labour party", "0", "2", "1", "1", "3", "0", "0", "2", "9" ], [ "clann na talmhan", "1", "1", "0", "0", "1", "0", "0", "0", "3" ], [ "clann na poblachta", "0", "0", "0", "0", "0", "0", "0", "2", "1" ], [ "independent", "1", "1", "0", "1", "1", "1", "3", "5", "14" ], [ "total", "7", "11", "5", "9", "11", "3", "3", "11", "60" ] ], "title": "", "original_id": "cb0e9191e00b1c14c4245fa8c0a04efd" }, { "_id": "cd26f3cb592f9097cccd9415f0eb486f", "header": [ "Unnamed: 0", "no", "title", "directed by", "written by", "viewers", "original airdate", "prod code" ], "rows": [ [ "13", "1", "live and let doyle", "james allodi", "allan hawco", "1038000", "january 12 , 2011", "201" ], [ "14", "2", "popeye doyle", "steve scaini", "allan hawco", "944000", "january 19 , 2011", "202" ], [ "15", "3", "a stand up guy", "steve scaini", "perry chafe", "776000", "january 26 , 2011", "203" ], [ "16", "4", "the son also rises", "steve dimarco", "jesse mckeown", "899000", "february 2 , 2011", "204" ], [ "17", "5", "something old , someone blue", "james allodi", "adam higgs & jackie may", "854000", "february 9 , 2011", "205" ], [ "18", "6", "the ryans and the pittmans", "steve dimarco", "greg nelson", "843000", "february 16 , 2011", "206" ], [ "19", "7", "crashing on the couch", "keith samples", "jackie may", "760000", "february 23 , 2011", "207" ], [ "20", "8", "sympathy for the devil", "stacey curtis", "john callaghan", "834400", "march 2 , 2011", "208" ], [ "21", "9", "will the real des courtney please stand up", "keith samples", "greg nelson", "1026000", "march 9 , 2011", "209" ], [ "22", "10", "the special detective", "steve scaini", "adam higgs", "836000", "march 16 , 2011", "210" ], [ "23", "11", "don't gamble with city hall", "john vatcher", "jackie may", "1021000", "march 23 , 2011", "211" ], [ "24", "12", "st john 's town", "keith samples", "perry chafe", "730000", "march 30 , 2011", "212" ] ], "title": "", "original_id": "7648f00905c0673b773a2bf6ad1d8223" }, { "_id": "f0dd1998cb99899404804827ca2d73b5", "header": [ "economy", "1980", "gap from thailand as of 1980 (times)", "1985", "1990", "1995", "2000", "2005", "2010", "2012", "gap from thailand as of 2012 (times)", "gdp as of 2012 after purchasing power parity (ppp) calculations (usd billions)", "gdp per capita as of 2012 (ppp)" ], "rows": [ [ "china", "205", "0.29", "290", "341", "601", "945", "1726", "4422", "6076", "1.07", "12405.67", "9162" ], [ "hong kong", "5679", "8.16", "6442", "13330", "22939", "25128", "25748", "32429", "36667", "6.46", "369.38", "51494" ], [ "japan", "9309", "13.38", "11461", "25144", "42523", "37303", "35787", "42916", "46735", "8.23", "4627.89", "36265" ], [ "korea", "1689", "2.43", "2414", "6308", "11779", "11347", "17551", "20540", "23113", "4.07", "1613.92", "32272" ], [ "malaysia", "1812", "2.6", "2026", "2432", "4358", "4030", "5211", "8633", "10304", "1.81", "498.48", "16922" ], [ "singapore", "4756", "6.83", "6754", "12387", "23718", "22791", "28498", "44697", "51162", "9.01", "326.51", "60410" ], [ "taiwan", "2363", "3.4", "3271", "8086", "12865", "14641", "16023", "18488", "20328", "3.58", "903.47", "38749" ] ], "title": "", "original_id": "fa409ae64ba45abe8542615ebf93a304" }, { "_id": "7535753b7be4b68dbeb99231582de934", "header": [ "Model", "8A", "8Aa", "8Ab", "8B", "8F" ], "rows": [ [ "Bore (mm)", "120", "120", "120", "120", "140" ], [ "Stroke (mm)", "130", "130", "130", "130", "150" ], [ "Displacement (l)", "11.76", "11.76", "11.76", "18.47", "-" ], [ "Compression ratio", "4.7", "4.7", "5.3", "5.3", "5.3" ], [ "Length (m)", "1.19", "1.25", "1.31", "1.36", "1.32" ], [ "Width (m)", "0.81", "0.83", "0.85", "0.86", "0.89" ], [ "Height (m)", "0.77", "0.81", "0.87", "0.90", "0.88" ], [ "Weight(kg)", "195", "215", "230", "236", "256" ], [ "Power output (hp)", "140", "150", "180", "200/235", "300" ], [ "at (rpm)", "1900", "2000", "2100", "2300", "2100" ] ], "title": "", "original_id": "4af852836dd997ea05b065d0c530910b" }, { "_id": "726f2b956788f88a91cc2b95c0fa2957", "header": [ "Place", "PoW", "Tanks", "Guns" ], "rows": [ [ "Sidi Barrani", "38,289", "73", "297" ], [ "Sidi Omar", "900", "0", "8" ], [ "Bardia", "42,000", "130", "275" ], [ "Tobruk", "25,000", "87", "208" ], [ "Mechili", "100", "13", "0" ], [ "Derna Benghazi", "2,000", "10", "24" ], [ "Benghazi Agedabia", "25,000", "107", "93" ], [ "Total", "133,298", "420", "845" ] ], "title": "", "original_id": "38f99d0e172d93c9772406669a71d12e" }, { "_id": "af6ffd09f502735be86c261fd9de3e5d", "header": [ "no in series", "no in season", "title", "directed by", "written by", "original air date", "production code", "us viewers (millions)" ], "rows": [ [ "67", "1", "charmed again (part 1)", "michael schultz", "brad kern", "october 4 , 2001", "4301801", "6.0" ], [ "68", "2", "charmed again (part 2)", "michael schultz", "brad kern", "october 4 , 2001", "4301801", "6.0" ], [ "69", "3", "hell hath no fury", "chris long", "krista vernoff", "october 11 , 2001", "4301069", "5.0" ], [ "70", "4", "enter the demon", "joel j feigenbaum", "daniel cerone", "october 18 , 2001", "4301071", "5.7" ], [ "71", "5", "size matters", "noel nosseck", "nell scovell", "october 25 , 2001", "4301070", "5.3" ], [ "72", "6", "a knight to remember", "david straiton", "alison schapker & monica breen", "november 1 , 2001", "4301072", "4.7" ], [ "73", "7", "brain drain", "john behring", "curtis kheel", "november 8 , 2001", "4301073", "4.7" ], [ "74", "8", "black as cole", "les landau", "abbey campbell , brad kern & nell scovell", "november 15 , 2001", "4301074", "5.1" ], [ "75", "9", "muse to my ears", "joel j feigenbaum", "krista vernoff", "december 13 , 2001", "4301075", "4.5" ], [ "76", "10", "a paige from the past", "james l conway", "daniel cerone", "january 17 , 2002", "4301076", "3.4" ], [ "77", "11", "trial by magic", "chip scott laughlin", "michael gleason", "january 24 , 2002", "4301077", "4.1" ], [ "78", "12", "lost and bound", "noel nosseck", "nell scovell", "january 31 , 2002", "4301078", "3.9" ], [ "79", "13", "charmed and dangerous", "jon pare", "alison schapker & monica breen", "february 7 , 2002", "4301079", "4.7" ], [ "80", "14", "the three faces of phoebe", "joel j feigenbaum", "curtis kheel", "february 14 , 2002", "4301080", "4.7" ], [ "81", "15", "marry - go - round", "chris long", "daniel cerone", "march 14 , 2002", "4301081", "4.5" ], [ "82", "16", "the fifth halliwheel", "david straiton", "krista vernoff", "march 21 , 2002", "4301082", "4.8" ], [ "83", "17", "saving private leo", "john behring", "daniel cerone & doug e jones", "march 28 , 2002", "4301083", "3.9" ], [ "84", "18", "bite me", "john t kretchmer", "curtis kheel", "april 18 , 2002", "4301084", "3.6" ], [ "85", "19", "we 're off to see the wizard", "timothy lonsdale", "alison schapker & monica breen", "april 25 , 2002", "4301085", "4.2" ], [ "86", "20", "long live the queen", "jon parã", "krista vernoff", "may 2 , 2002", "4301086", "2.8" ], [ "87", "21", "womb raider", "mel damski", "daniel cerone", "may 9 , 2002", "4301087", "5.0" ] ], "title": "", "original_id": "0a593de4b82e18d255d786e3fee0d85f" }, { "_id": "4f698906355b19f5079285735455ee3e", "header": [ "date", "origin time", "epicentre (lat , s)", "epicentre (long , e)", "local magnitude", "location" ], "rows": [ [ "8 february 1920", "05:24", "35.0", "111.0", "6.2", "260 km south west of cape leeuwin" ], [ "18 december 1940", "21:45", "32.2", "117.2", "4.2", "beverley , brookton" ], [ "19 april 1946", "21:13", "38.5", "114.5", "5.7", "west of yallingup" ], [ "17 september 1946", "15:12", "32.5", "116.9", "4.5", "pingelly" ], [ "2 may 1949", "10:00", "30.9", "116.4", "5.1", "yerecoin" ], [ "7 may 1949", "17:09", "30.9", "116.4", "4.1", "yerecoin" ], [ "11 march 1952", "06:09", "31.3", "116.5", "5.1", "bolgart" ], [ "27 november 1954", "08:36", "32.0", "116.7", "3.9", "talbot brook" ], [ "29 april 1955", "09:14", "30.9", "116.4", "4.7", "yerecoin" ], [ "29 april 1955", "19:49", "30.9", "116.4", "4.4", "yerecoin" ], [ "29 august 1955", "06:09", "30.7", "116.4", "5.3", "gabalong" ], [ "30 august 1955", "13:52", "30.7", "116.4", "5.8", "gabalong" ], [ "30 august 1955", "14:07", "30.7", "116.4", "4.7", "gabalong" ], [ "30 august 1955", "16:46", "30.7", "116.4", "4.6", "gabalong" ], [ "24 february 1956", "06:27", "30.9", "116.4", "4.5", "yerecoin" ], [ "5 april 1956", "23:13", "30.9", "116.4", "4.5", "yerecoin" ], [ "20 march 1958", "03:03", "32.2", "117.2", "4.8", "beverley , brookton" ], [ "3 october 1959", "12:07:22.0", "34.5", "114.5", "4.2", "55 km sw cape leeuwin" ] ], "title": "", "original_id": "1ff37e4c567cfe5f66c6db366400f737" }, { "_id": "9bb93eb5e9526c7ef1d06da58e3d5e7c", "header": [ "place", "code", "area (km 2 )", "population", "most spoken language" ], "rows": [ [ "alldays", "90901", "11.75", "385", "northern sotho" ], [ "bahanawa", "90902", "390.17", "19068", "northern sotho" ], [ "bahanawa - ba - kibi", "90903", "163.78", "7763", "northern sotho" ], [ "bochum part 1", "90912", "4.33", "8501", "northern sotho" ], [ "bochum part 2", "90905", "182.33", "15911", "northern sotho" ], [ "dichoeng", "90906", "58.29", "17347", "northern sotho" ], [ "manthata", "90907", "1335.47", "72175", "northern sotho" ], [ "matlala", "90908", "180.83", "8697", "northern sotho" ], [ "pietersburg", "90909", "1.33", "3818", "northern sotho" ], [ "ramutla", "90910", "7.81", "1047", "northern sotho" ], [ "seshego", "90911", "6.0", "1058", "northern sotho" ], [ "remainder of the municipality", "90904", "2198.72", "5539", "northern sotho" ] ], "title": "", "original_id": "3122e367beb2513ff31cd9040b8f9547" }, { "_id": "4b7c3c65256b11060492de20ffced89e", "header": [ "Particulars", "Total", "Male", "Female" ], "rows": [ [ "Total No. of Houses", "122", "-", "-" ], [ "Population", "524", "261", "263" ], [ "Child (0-6)", "95", "46", "49" ], [ "Schedule Caste", "275", "137", "138" ], [ "Schedule Tribe", "0", "0", "0" ], [ "Literacy", "60.14 %", "65.12 %", "55.14 %" ], [ "Total Workers", "194", "143", "51" ], [ "Main Worker", "194", "0", "0" ], [ "Marginal Worker", "0", "0", "0" ] ], "title": "", "original_id": "910bce6a7c6d7346fb3efa20a9469d9f" }, { "_id": "29dfe4db57b858d34423da705c61406a", "header": [ "s dam and gnis query link", "s lake and gnis query link", "s reservoir and gnis query link", "borough or census area", "comment" ], "rows": [ [ "5", "27", "0", "aleutians east", "lakes in table , reservoirs done" ], [ "15", "134", "0", "aleutians west (ca)", "lakes , reservoirs done" ], [ "8", "58", "6", "anchorage", "lakes and reservoirs in table" ], [ "0", "81", "0", "bethel (ca)", "lakes , reservoirs done" ], [ "0", "0", "0", "bristol bay", "lakes and reservoirs done" ], [ "0", "50", "0", "denali", "lakes in table , reservoirs done" ], [ "0", "55", "0", "dillingham (ca)", "lakes , reservoirs done" ], [ "3", "19", "1", "fairbanks north star", "lakes and reservoirs in table" ], [ "3", "10", "0", "haines", "lakes in table , reservoirs done" ], [ "6", "55", "3", "hoonah - angoon (ca)", "lakes and reservoirs in table" ], [ "8", "31", "5", "juneau", "lakes and reservoirs in table" ], [ "10", "440", "4", "kenai peninsula", "lakes , reservoirs in table" ], [ "12", "57", "8", "ketchikan gateway", "lakes , reservoirs in table" ], [ "31", "82", "11", "kodiak island", "lakes , reservoirs in table" ], [ "3", "83", "0", "lake and peninsula", "lakes , reservoirs done" ], [ "5", "451", "1", "matanuska - susitna", "lakes , reservoirs in table" ], [ "1", "36", "0", "nome (ca)", "lakes in table , reservoirs done" ], [ "2", "142", "2", "north slope", "lakes , reservoirs in table" ], [ "1", "80", "1", "northwest arctic", "lakes , reservoirs in table" ], [ "9", "163", "4", "p of wales - o ketchikan (ca)", "lakes , reservoirs in table" ], [ "9", "90", "3", "sitka", "lakes , reservoirs in table" ], [ "3", "9", "3", "skagway", "lakes and reservoirs in table" ], [ "0", "130", "0", "southeast fairbanks (ca)", "lakes , reservoirs in table" ], [ "22", "293", "10", "valdez - cordova (ca)", "lakes , reservoirs in table" ], [ "1", "21", "0", "wade hampton (ca)", "lakes in table , reservoirs done" ], [ "8", "60", "5", "wrangell - petersburg (ca)", "lakes , reservoirs in table" ], [ "0", "26", "0", "yakutat", "lakes in table , reservoirs done" ], [ "2", "513", "0", "yukon - koyukuk (ca)", "lakes , reservoirs done" ] ], "title": "", "original_id": "f6ecd642029c0d49a2548e984de32a34" }, { "_id": "4588b3ba19a40ac9efd316250836b8ee", "header": [ "rank", "city", "state", "gdp in id b", "population m (luz)", "gdp per capita id k", "eurozone" ], "rows": [ [ "1", "paris", "france", "731", "11.5", "62.4", "y" ], [ "2", "london", "united kingdom", "565", "11.9", "49.4", "n" ], [ "3", "moscow", "russia", "321", "10.5", "30.6", "n" ], [ "4", "madrid", "spain", "230", "5.8", "39.7", "y" ], [ "5", "istanbul", "turkey", "187", "13.2", "14.2", "n" ], [ "6", "barcelona", "spain", "177", "4.97", "35.6", "y" ], [ "7", "rome", "italy", "144", "3.46", "41.6", "y" ], [ "8", "milan", "italy", "136", "3.08", "44.2", "y" ], [ "9", "vienna", "austria", "122", "2.18", "56.0", "y" ], [ "10", "lisbon", "portugal", "98", "2.44", "40.2", "y" ], [ "11", "athens", "greece", "96", "4.01", "23.9", "y" ], [ "12", "berlin", "germany", "95", "4.97", "19.1", "y" ] ], "title": "", "original_id": "9bd2405b2c4d9af26013351147098518" }, { "_id": "327d0e569caa09f3398bc0f02f9a8ae1", "header": [ "year", "class", "team", "points", "wins" ], "rows": [ [ "1961", "125cc", "suzuki", "0", "0" ], [ "1961", "250cc", "suzuki", "0", "0" ], [ "1962", "50cc", "suzuki", "23", "0" ], [ "1962", "125cc", "suzuki", "4", "0" ], [ "1963", "50cc", "suzuki", "20", "1" ], [ "1963", "125cc", "suzuki", "1", "0" ], [ "1964", "50cc", "suzuki", "19", "0" ], [ "1964", "125cc", "suzuki", "6", "0" ], [ "1965", "50cc", "suzuki", "16", "0" ], [ "1966", "50cc", "suzuki", "3", "0" ], [ "1966", "125cc", "suzuki", "4", "0" ], [ "1967", "50cc", "suzuki", "8", "1" ] ], "title": "", "original_id": "682fdc552a15e3f41d082db3957a5870" }, { "_id": "18b921623ebacc8b6dd80cd388208bf0", "header": [ "no for season", "no for series", "episode", "airdate", "viewers (in millions)" ], "rows": [ [ "1", "43", "coast to coast", "september 3 , 2013", "2.01" ], [ "2", "44", "alaskan adventure", "september 10 , 2013", "1.45" ], [ "3", "45", "off road racing", "september 17 , 2013", "1.54" ], [ "4", "46", "america 's biggest cars", "september 24 , 2013", "1.88" ], [ "5", "47", "sturgis", "october 22 , 2013", "1.73" ], [ "6", "48", "can cars float", "october 29 , 2013", "1.58" ] ], "title": "", "original_id": "b361d02410aacce63a84d3f811844411" }, { "_id": "768cdea36e378e70188f4394d9825acf", "header": [ "year", "region total", "goondiwindi", "waggamba", "inglewood" ], "rows": [ [ "1933", "8696", "1931", "2468", "4297" ], [ "1947", "9114", "2467", "2590", "4057" ], [ "1954", "10359", "2950", "2968", "4441" ], [ "1961", "11265", "3274", "3123", "4868" ], [ "1966", "10608", "3529", "2895", "4184" ], [ "1971", "10253", "3695", "2913", "3645" ], [ "1976", "9509", "3741", "2539", "3229" ], [ "1981", "9334", "3576", "2732", "3026" ], [ "1986", "9859", "4103", "2757", "2999" ], [ "1991", "10181", "4331", "2898", "2952" ], [ "1996", "9857", "4374", "2712", "2771" ], [ "2001", "10348", "4760", "2975", "2613" ], [ "2006", "10399", "4873", "2951", "2575" ], [ "2011", "10628", "4821", "3221", "2586" ] ], "title": "", "original_id": "3580eb2f494c1cd03a70cb2a1d754ee9" }, { "_id": "b049032b5ce25cafb874cabb19fd44a1", "header": [ "episode no", "airdate", "viewers", "bbc three weekly ranking", "cable rank" ], "rows": [ [ "1", "21 october 2010", "956000", "3", "10" ], [ "2", "28 october 2010", "959000", "4", "14" ], [ "3", "4 november 2010", "1277000", "2", "6" ], [ "4", "11 november 2010", "817000", "6", "18" ], [ "5", "18 november 2010", "1019000", "3", "11" ], [ "6", "25 november 2010", "869000", "3", "23" ], [ "7", "2 december 2010", "982000", "2", "19" ], [ "8", "9 december 2010", "953000", "3", "12" ] ], "title": "", "original_id": "813394653021785aae4edf6109618202" }, { "_id": "daacbb11b8f51ed92cf7f2550044c7d5", "header": [ "Year of election", "Candidates elected", "# of seats available", "# of votes", "% of popular vote" ], "rows": [ [ "1963", "7", "108", "n.a.", "15.5%" ], [ "1967", "20", "117", "n.a.", "25.9%" ], [ "1971", "19", "117", "n.a.", "27.1%" ], [ "1975", "38", "125", "n.a.", "28.9%" ], [ "1977", "33", "125", "n.a.", "28.0%" ], [ "1981", "21", "125", "n.a.", "21.2%" ], [ "1985", "25", "125", "865,507", "23.8%" ], [ "1987", "19", "130", "970,813", "25.7%" ], [ "1990", "74", "130", "1,509,506", "37.6%" ], [ "1995", "17", "129", "854,163", "20.6%" ], [ "1999", "9", "103", "551,009", "12.6%" ], [ "2003", "7", "103", "660,730", "14.7%" ], [ "2007", "10", "107", "741,043", "16.8%" ], [ "2011", "17", "107", "980,204", "22.73%" ] ], "title": "", "original_id": "a7d1be3dbb4f336774ab56d00253e5c4" }, { "_id": "3310dbdb157351ccc5fd4da05f93c178", "header": [ "season", "timeslot (edt)", "season premiere", "season finale", "tv season", "rank", "viewers (in millions)", "18 - 49 average" ], "rows": [ [ "1", "sunday 9:00 pm", "october 3 , 2004", "may 22 , 2005", "2004 - 2005", "4", "23.69", "10.66" ], [ "2", "sunday 9:00 pm", "september 25 , 2005", "may 21 , 2006", "2005 - 2006", "4", "21.7", "10.09" ], [ "3", "sunday 9:00 pm", "september 24 , 2006", "may 20 , 2007", "2006 - 2007", "12", "16.7", "7.57" ], [ "4", "sunday 9:00 pm", "september 30 , 2007", "may 18 , 2008", "2007 - 2008", "8", "17.52", "6.71" ], [ "5", "sunday 9:00 pm", "september 28 , 2008", "may 17 , 2009", "2008 - 2009", "9", "15.66", "5.29" ], [ "6", "sunday 9:00 pm", "september 27 , 2009", "may 16 , 2010", "2009 - 2010", "20", "12.83", "4.25" ], [ "7", "sunday 9:00 pm", "september 26 , 2010", "may 15 , 2011", "2010 - 2011", "26", "11.86", "3.46" ], [ "8", "sunday 9:00 pm", "september 25 , 2011", "may 13 , 2012", "2011 - 2012", "37", "10.6", "2.74" ] ], "title": "", "original_id": "c9cdf1b4641dd95e6109b788dd0f8c95" }, { "_id": "017c025a22ddc76c0621c7638cda2326", "header": [ "election", "candidates fielded", "of seats won", "total votes", "% of popular vote", "place" ], "rows": [ [ "1983", "4", "0", "3078", "0.19%", "7th" ], [ "1986", "9", "0", "4660", "0.24%", "5th" ], [ "1991", "42", "0", "12650", "0.86%", "4th" ], [ "1996", "71", "0", "31511", "1.99%", "5th" ], [ "2001", "72", "0", "197231", "12.39%", "3rd" ], [ "2005", "79", "0", "161842", "9.17%", "3rd" ], [ "2009", "85", "0", "134570", "8.21%", "3rd" ] ], "title": "", "original_id": "a3e33d0126a25007ebd7c38e3805f251" }, { "_id": "652ac846352224bb50044a015196f36d", "header": [ "year", "starts", "wins", "top 5", "top 10", "poles", "avg start", "avg finish", "winnings", "position", "team (s)" ], "rows": [ [ "1990", "4", "0", "0", "0", "0", "27.8", "31.0", "17190", "49th", "50 ted musgrave racing 2 us motorsports inc" ], [ "1991", "29", "0", "0", "0", "0", "29.6", "22.0", "200910", "23rd", "55 us motorsports inc" ], [ "1992", "29", "0", "1", "7", "0", "24.3", "16.7", "449121", "18th", "55 radius motorsports" ], [ "1993", "29", "0", "2", "5", "0", "21.7", "22.0", "458615", "25th", "55 radius motorsports" ], [ "1994", "31", "0", "1", "8", "3", "20.0", "17.4", "656187", "13th", "16 roush racing" ], [ "1995", "31", "0", "7", "13", "1", "17.6", "13.2", "1147445", "7th", "16 roush racing" ], [ "1996", "31", "0", "2", "7", "1", "21.2", "17.6", "961512", "16th", "16 roush racing" ], [ "1997", "32", "0", "5", "8", "0", "22.5", "18.3", "1256680", "12th", "16 roush racing" ], [ "1999", "32", "0", "0", "2", "0", "27.2", "26.5", "1162403", "33rd", "75 butch mock motorsports" ], [ "2001", "1", "0", "0", "0", "0", "15.0", "29.0", "73287", "64th", "7 ultra motorsports" ], [ "2002", "5", "0", "0", "0", "0", "33.0", "24.2", "283770", "50th", "07 ultra motorsports 44 petty enterprises" ] ], "title": "", "original_id": "25b95d634bfc9a85d37e8e502149baae" }, { "_id": "1a450c8ff4e316e2c06a06f213fde03c", "header": [ "year", "start", "qual", "rank", "finish", "laps" ], "rows": [ [ "1951", "31", "132.226", "26", "4", "200" ], [ "1952", "2", "137.002", "4", "33", "20" ], [ "1953", "5", "136.06", "19", "33", "3" ], [ "1954", "23", "137.82", "28", "25", "165" ], [ "1955", "8", "139.098", "22", "6", "200" ], [ "1956", "9", "143.056", "11", "27", "90" ], [ "1957", "12", "143.244", "5", "5", "200" ] ], "title": "", "original_id": "18d386e63b6b9369923115e348b965e7" }, { "_id": "0a10af99b5cd4be438fd71cada5de4a9", "header": [ "episode", "broadcast date", "bbc one presenter (s)", "starring", "radio 1 presenter", "viewers (millions)" ], "rows": [ [ "1", "2005", "clare balding", "doug segal", "n / a", "6.43" ], [ "2", "2006", "myleene klass", "gethin jones , natasha kaplinsky & alesha dixon", "n / a", "6.06" ], [ "3", "2007", "myleene klass", "gethin jones , natasha kaplinsky & nick knowles", "n / a", "5.35" ], [ "5", "2009", "myleene klass", "n / a", "nihal", "7.65" ], [ "6", "2010", "jake humphrey", "n / a", "nihal", "9.37" ], [ "7", "2011", "jake humphrey", "n / a", "nihal", "10.67" ], [ "8", "2012", "gabby logan", "n / a", "nihal", "9.73" ] ], "title": "", "original_id": "ff185bf6ffc9bfde288ad3299663fdff" }, { "_id": "f05ec81210c8bb76ee23479bcee3dd69", "header": [ "year", "starts", "wins", "top 5", "top 10", "poles", "avg start", "avg finish", "winnings", "position", "team (s)" ], "rows": [ [ "1985", "1", "0", "0", "0", "0", "16.0", "14.0", "2925", "101st", "07 bob johnson racing" ], [ "1986", "1", "0", "0", "0", "0", "20.0", "29.0", "1815", "107th", "07 bob johnson racing" ], [ "1988", "1", "0", "0", "0", "0", "29.0", "37.0", "1460", "97th", "74 wawak racing" ], [ "1989", "1", "0", "0", "0", "0", "32.0", "28.0", "2725", "83rd", "63 linro motorsports" ], [ "1990", "2", "0", "0", "0", "0", "33.0", "35.5", "6675", "73rd", "13 linro motorsports" ], [ "1994", "3", "0", "0", "0", "0", "20.3", "19.7", "30565", "48th", "20 moroso racing 02 tw taylor" ], [ "1995", "14", "0", "0", "0", "0", "29.4", "27.4", "281945", "40th", "22 bill davis racing 40 brooks / sabco racing" ], [ "1998", "9", "0", "1", "3", "0", "25.3", "26.2", "336905", "49th", "50 hendrick motorsports" ], [ "1999", "2", "0", "0", "0", "0", "19.0", "38.5", "71200", "61st", "14 no fear racing" ], [ "2004", "3", "0", "0", "0", "0", "41.0", "40.3", "160261", "68th", "80 hover motorsports 98 mach 1 motorsports" ] ], "title": "", "original_id": "55f3914d42075dcde9c9c77774156a6c" }, { "_id": "88c95446b1ace3ad63e52861f4323da0", "header": [ "year", "edmonton hundred", "elthorne hundred", "gore hundred", "isleworth hundred", "holborn division", "finsbury division", "kensington division", "tower division", "spelthorne hundred", "within the walls", "without the walls", "inns of court and chancery", "westminster city and liberty", "total" ], "rows": [ [ "1801", "16885", "16853", "6968", "9266", "171202", "73268", "40642", "215382", "12743", "63832", "70676", "1907", "157890", "818129" ], [ "1811", "20577", "19929", "8738", "10669", "214946", "92538", "54550", "272966", "14409", "55484", "70489", "1796", "166438", "953774" ], [ "1821", "24771", "23479", "9806", "12285", "272131", "119802", "70808", "339075", "16966", "56174", "74765", "1546", "186584", "1144531" ], [ "1831", "26930", "26976", "11315", "13568", "341981", "151409", "87961", "427090", "19204", "55778", "73442", "1271", "206116", "1358130" ], [ "1841", "30683", "34943", "12487", "15893", "399218", "185174", "122795", "513501", "21298", "54626", "74758", "1708", "226241", "1574416" ], [ "1851", "32109", "35828", "12956", "18463", "480942", "239788", "169317", "641918", "22107", "54702", "79096", "1398", "241450", "1886576" ], [ "1861", "40885", "42274", "15341", "23610", "551487", "312553", "223305", "773621", "24795", "44400", "73125", "1272", "254463", "2206485" ], [ "1871", "57332", "46996", "21291", "30463", "604891", "381702", "350688", "902056", "33069", "28093", "50733", "1138", "246592", "2539765" ] ], "title": "", "original_id": "8f34be2fd33561d93c5f2053baa58892" }, { "_id": "eb1a8a3c13be9f6344be596109a91143", "header": [ "year", "start", "qual", "rank", "finish", "laps" ], "rows": [ [ "1960", "28", "142.354", "29", "9", "200" ], [ "1962", "10", "147.753", "10", "15", "200" ], [ "1963", "25", "148.227", "27", "28", "46" ], [ "1964", "19", "151.21", "26", "6", "198" ], [ "1965", "24", "154.672", "23", "16", "115" ], [ "1966", "27", "159.144", "26", "21", "16" ], [ "1967", "25", "163.228", "22", "14", "182" ], [ "1968", "18", "164.444", "17", "16", "158" ], [ "1969", "18", "166.597", "18", "15", "155" ], [ "1971", "17", "170.156", "24", "7", "198" ] ], "title": "", "original_id": "12015a78608d814a680338824e98cc15" }, { "_id": "0537440273cd388fe748df164fd1937c", "header": [ "year", "total region", "biggenden", "eidsvold", "gayndah", "monto", "mundubbera", "perry" ], "rows": [ [ "1933", "14322", "2476", "1475", "3760", "3514", "2302", "795" ], [ "1947", "13861", "2179", "1313", "3407", "4270", "2064", "628" ], [ "1954", "13917", "1974", "1311", "3352", "4458", "2326", "496" ], [ "1961", "13993", "1882", "1242", "3400", "4397", "2617", "455" ], [ "1966", "13715", "1722", "1702", "3182", "4155", "2580", "374" ], [ "1971", "12230", "1639", "1222", "3107", "3495", "2391", "376" ], [ "1976", "11504", "1532", "1231", "2814", "3228", "2395", "304" ], [ "1981", "11565", "1411", "1256", "2859", "3249", "2481", "309" ], [ "1986", "11583", "1553", "1212", "2887", "3266", "2355", "310" ], [ "1991", "11230", "1574", "1028", "2856", "3058", "2340", "374" ], [ "1996", "11243", "1570", "970", "2916", "2922", "2514", "351" ], [ "2001", "10782", "1486", "933", "2894", "2592", "2451", "426" ] ], "title": "", "original_id": "b9d8ed898f79c1447bf6ca63051b60e9" }, { "_id": "5211d299fe4fa4b60f2bcc502c555d6c", "header": [ "electoral district", "registered voters", "seats in congress", "candidates per party", "participating parties", "total candidates" ], "rows": [ [ "amazonas", "179331", "2", "3", "17", "47" ], [ "ancash", "611881", "5", "5", "21", "99" ], [ "apurímac", "195954", "2", "3", "21", "55" ], [ "arequipa", "770535", "5", "5", "21", "101" ], [ "ayacucho", "306662", "3", "3", "20", "58" ], [ "cajamarca", "721239", "5", "5", "23", "109" ], [ "callao", "541730", "4", "4", "24", "92" ], [ "cusco", "643629", "5", "5", "22", "98" ], [ "huancavelica", "203844", "2", "3", "15", "39" ], [ "huánuco", "354416", "3", "3", "22", "65" ], [ "ica", "451197", "4", "5", "22", "88" ], [ "junín", "701190", "5", "5", "22", "99" ], [ "la libertad", "942656", "7", "7", "22", "145" ], [ "lambayeque", "676735", "5", "5", "22", "101" ], [ "lima", "6063109", "35", "35", "24", "738" ], [ "loreto", "416419", "3", "3", "22", "60" ], [ "madre de dios", "47742", "1", "3", "14", "35" ], [ "moquegua", "99962", "2", "3", "18", "44" ], [ "pasco", "135670", "2", "3", "17", "51" ], [ "piura", "914912", "6", "6", "23", "136" ], [ "puno", "674865", "5", "5", "23", "106" ], [ "san martín", "357124", "3", "3", "17", "47" ], [ "tacna", "172427", "2", "3", "18", "57" ], [ "tumbes", "110335", "2", "3", "19", "57" ], [ "ucayali", "201342", "2", "3", "22", "60" ] ], "title": "", "original_id": "8375929c803567a8bb59bb0470b615ab" }, { "_id": "ff84765ce496a977dff04689e3037e12", "header": [ "series", "season", "title", "directed by", "written by", "original air date", "prod code", "us viewers (millions)" ], "rows": [ [ "22", "1", "out of control", "gerren keith", "sarah jane cunningham & suzie v freeman", "october 3 , 2003", "203", "2.9" ], [ "23", "2", "don't have a cow", "rich correll", "michael carrington", "october 17 , 2003", "204", "4.5" ], [ "24", "3", "run , raven , run", "rich correll", "marc warren", "november 7 , 2003", "202", "4.1" ], [ "25", "4", "clothes minded", "sean mcnamara", "edward c evans", "january 1 , 2004", "207", "3.6" ], [ "26", "5", "four 's a crowd", "rich correll", "michael feldman", "january 30 , 2004", "206", "5.5" ], [ "27", "6", "hearts and minds", "rich correll", "michael feldman", "february 6 , 2004", "212", "3.8" ], [ "28", "7", "close encounters of the nerd kind", "john tracy", "josh lynn & danny warren", "march 26 , 2004", "211", "2.4" ], [ "29", "8", "that 's so not raven", "sean mcnamara", "dennis rinsler", "april 9 , 2004", "201", "7.1" ], [ "30", "9", "blue in the face", "sean mcnamara", "maisha closson", "april 16 , 2004", "208", "1.9" ], [ "31", "10", "spa day afternoon", "carl lauten", "dava savel", "may 21 , 2004", "209", "2.4" ], [ "32", "11", "leave it to diva", "donna pescow", "marc warren", "may 28 , 2004", "213", "2.9" ], [ "33", "12", "there goes the bride", "erma elzy - jones", "sarah jane cunningham & suzie v freeman", "june 11 , 2004", "216", "2.7" ], [ "34", "13", "radio heads", "rich correll", "dennis rinsler", "june 25 , 2004", "215", "3.7" ], [ "35", "14", "a goat 's tale", "debbie allen", "edward c evans", "july 2 , 2004", "217", "4.3" ], [ "36", "15", "he 's got the power", "john tracy", "dava savel", "july 9 , 2004", "205", "4.9" ], [ "37", "16", "skunk'd", "christopher b pearman", "sarah jane cunningham & suzie v freeman", "july 16 , 2004", "219", "5.0" ], [ "38", "17", "the dating shame", "sean mcnamara", "edward c evans & michael feldman", "july 23 , 2004", "218", "4.6" ], [ "39", "18", "the road to audition", "debbie allen", "beth seriff & geoff tarson", "july 30 , 2004", "214", "4.3" ], [ "40", "19", "the lying game", "rich correll", "dennis rinsler & marc warren", "august 6 , 2004", "220", "4.27" ], [ "41", "20", "numb and number", "rondell sheridan", "michael feldman & dava savel", "september 10 , 2004", "221", "3.65" ] ], "title": "", "original_id": "68c1029fd30571a6e389a3a683fb73a2" }, { "_id": "b471331ca8ea674c1535d52039bf7783", "header": [ "no", "-", "title", "directed by", "written by", "original air date", "production code", "us viewers (million)" ], "rows": [ [ "89", "1", "revival", "steward lee", "chris collins", "september 29 , 2012", "4.26", "1.94" ], [ "90", "2", "a war on two fronts", "dave filoni", "chris collins", "october 6 , 2012", "4.15", "1.71" ], [ "91", "3", "front runners", "steward lee", "chris collins", "october 13 , 2012", "4.16", "1.75" ], [ "92", "4", "the soft war", "kyle dunlevy", "chris collins", "october 20 , 2012", "4.17", "1.57" ], [ "93", "5", "tipping points", "bosco ng", "chris collins", "october 27 , 2012", "4.18", "1.42" ], [ "94", "6", "the gathering", "kyle dunlevy", "christian taylor", "november 3 , 2012", "4.22", "1.66" ], [ "95", "7", "a test of strength", "bosco ng", "christian taylor", "november 10 , 2012", "4.23", "1.74" ], [ "96", "8", "bound for rescue", "brian kalin o'connell", "christian taylor", "november 17 , 2012", "4.24", "1.96" ], [ "97", "9", "a necessary bond", "danny keller", "christian taylor", "november 24 , 2012", "4.25", "1.39" ], [ "98", "10", "secret weapons", "danny keller", "brent friedman", "december 1 , 2012", "5.04", "1.46" ], [ "99", "11", "a sunny day in the void", "kyle dunlevy", "brent friedman", "december 8 , 2012", "5.05", "1.43" ], [ "100", "12", "missing in action", "steward lee", "brent friedman", "january 5 , 2013", "5.06", "1.74" ], [ "101", "13", "point of no return", "bosco ng", "brent friedman", "january 12 , 2013", "5.07", "1.47" ], [ "102", "14", "eminence", "kyle dunlevy", "chris collins", "january 19 , 2013", "5.01", "1.85" ], [ "103", "15", "shades of reason", "bosco ng", "chris collins", "january 26 , 2013", "5.02", "1.83" ], [ "104", "16", "the lawless", "brian kalin o'connell", "chris collins", "february 2 , 2013", "5.03", "1.86" ], [ "105", "17", "sabotage", "brian kalin o'connell", "charles murray", "february 9 , 2013", "5.08", "2.02" ], [ "106", "18", "the jedi who knew too much", "danny keller", "charles murray", "february 16 , 2013", "5.09", "1.64" ], [ "107", "19", "to catch a jedi", "kyle dunlevy", "charles murray", "february 23 , 2013", "5.1", "2.06" ] ], "title": "", "original_id": "0116e7d6e612aa460deb91c8cd6ffe15" }, { "_id": "a3d18431128b35b72e04eedd68faf64e", "header": [ "rank", "city", "province", "date of official foundation of municipality", "2006", "1996", "1986", "1976", "1966", "1956" ], "rows": [ [ "1", "tehran", "tehran", "1885", "7705036", "6758845", "6042584", "4530223", "2719730", "1512082" ], [ "2", "mashhad", "razavi khorasan", "1918", "2410800", "1887405", "1463508", "667770", "409616", "241984" ], [ "3", "esfahān", "esfahān", "1928", "1602110", "1266072", "986753", "661510", "424045", "254708" ], [ "4", "tabriz", "east azarbaijan", "1917", "1398060", "1191043", "971482", "597976", "403413", "289996" ], [ "5", "karaj", "alborz", "1934", "1377450", "940968", "611510", "137926", "44243", "14526" ], [ "6", "shiraz", "fars", "1950", "1227311", "1053025", "848289", "425813", "269865", "170659" ] ], "title": "", "original_id": "f08b94c7f4b830fd8c090b2ef668f701" }, { "_id": "a0f50b6d629f6a507815c685d85a4bc8", "header": [ "2006", "2007", "2008", "2009", "2010" ], "rows": [ [ "20.0", "19.9", "20.4", "20.0", "20.7" ], [ "17.5", "17.6", "17.2", "16.9", "16.4" ], [ "6.9", "7.1", "6.9", "6.9", "6.9" ], [ "8.2", "7.5", "6.8", "6.5", "6.4" ], [ "4.9", "4.6", "4.7", "4.7", "4.6" ], [ "2.0", "2.0", "1.9", "2.1", "1.9" ], [ "1.4", "1.3", "1.6", "1.7", "2.0" ], [ "1.7", "1.7", "1.4", "1.4", "1.1" ], [ "1.2", "1.3", "1.3", "1.3", "1.2" ], [ "1.0", "1.1", "1.2", "1.3", "1.4" ], [ "1.7", "1.1", "1.0", "1.2", "0.9" ], [ "1.4", "1.3", "1.2", "1.2", "1.2" ], [ "0.6", "0.7", "0.9", "1.1", "1.0" ], [ "0.4", "0.6", "1.1", "1.0", "0.9" ], [ "0.4", "0.7", "0.9", "0.9", "1.0" ], [ "0.6", "0.7", "0.8", "0.8", "1.0" ], [ "0.8", "0.6", "0.5", "0.6", "0.5" ], [ "1.0", "0.7", "0.6", "0.5", "0.5" ], [ "0.4", "0.5", "0.5", "0.5", "0.4" ], [ "0.5", "0.5", "0.4", "0.5", "0.6" ], [ "0.5", "0.5", "0.4", "0.5", "0.4" ], [ "0.3", "0.3", "0.2", "0.2", "0.2" ], [ "0.3", "0.3", "0.3", "0.2", "0.2" ], [ "0.3", "0.2", "0.2", "0.2", "0.2" ], [ "0.4", "0.2", "0.2", "0.1", "0.1" ], [ "0.3", "0.2", "0.1", "0.1", "0.1" ], [ "0.2", "0.2", "0.2", "0.1", "0.1" ], [ "0.2", "0.2", "0.1", "0.1", "0.1" ] ], "title": "", "original_id": "0203d48d1ea51d76ce1d8867c8b9843a" }, { "_id": "85eb2e15a52bd11da2dc66260fea82a2", "header": [ "rank", "airport", "passengers", "aircraft movements", "carriers" ], "rows": [ [ "1", "shanghai , china", "192701", "1465", "china eastern airlines , jin air" ], [ "2", "osaka , japan", "131338", "1157", "jeju air , korean air" ], [ "3", "tokyo , japan", "124296", "734", "korean air" ], [ "4", "beijing , china", "97055", "768", "china eastern airlines , korean air" ], [ "5", "taipei , republic of china (taiwan)", "73754", "585", "jin air , transasia airways" ], [ "6", "ningbo , china", "44067", "303", "china eastern airlines , eastar jet" ], [ "7", "nagoya , japan", "41460", "416", "korean air" ], [ "8", "harbin , china", "31574", "201", "china southern airlines , jin air" ], [ "9", "changchun , china", "29129", "214", "china southern airlines" ], [ "10", "fukuoka , japan", "27592", "306", "asiana airlines" ], [ "11", "shenyang , china", "26168", "238", "china southern airlines" ], [ "12", "dalian , china", "25359", "204", "china southern airlines" ], [ "13", "hong kong", "24940", "208", "dragonair" ], [ "14", "hangzhou , china", "22191", "165", "china eastern airlines" ], [ "15", "macau", "21278", "178", "eastar jet" ], [ "16", "nanning , china", "17114", "122", "eastar jet" ], [ "17", "xi'an , china", "15022", "107", "jin air" ], [ "18", "guangzhou , china", "14983", "95", "korean air" ], [ "19", "hefei , china", "14226", "105", "eastar jet" ], [ "20", "changsha , china", "12947", "105", "eastar jet" ] ], "title": "", "original_id": "f557ff1c99aaf41e253a7295f416c91a" }, { "_id": "1c79d8afc74cc1ee275f284b9f5a3bfc", "header": [ "Works No.", "IMR No.", "PPR No.", "CSAR No.", "BMR or RRM No.", "NGR No.", "SAR No." ], "rows": [ [ "5677", "-", "-", "-", "RRM 63", "-", "949" ], [ "5835", "128", "-", "373", "-", "-", "1032" ], [ "5836", "129", "-", "374", "-", "-", "1033" ], [ "5837", "130", "-", "375", "-", "-", "1034" ], [ "5813", "106", "-", "376", "Pauling", "-", "1035" ], [ "5814", "107", "-", "377", "-", "-", "1036" ], [ "5815", "108", "-", "378", "-", "-", "1037" ], [ "5816", "109", "-", "379", "-", "-", "1038" ], [ "5817", "110", "-", "-", "MR 19", "-", "1355 (7D)" ], [ "5818", "111", "-", "381", "-", "-", "1058" ], [ "5819", "112", "-", "382", "-", "-", "1039" ], [ "5820", "113", "-", "383", "Pauling", "-", "1040" ], [ "5826", "119", "-", "384", "-", "327", "1055" ], [ "5822", "115", "-", "385", "-", "-", "1041" ], [ "5823", "116", "-", "386", "-", "-", "1042" ], [ "5824", "117", "-", "387", "-", "-", "1043" ], [ "5825", "118", "-", "388", "-", "-", "1044" ], [ "5830", "123", "-", "389", "-", "328", "1056" ], [ "5827", "120", "-", "390", "-", "-", "1045" ], [ "5828", "121", "-", "391", "-", "-", "1046" ], [ "5829", "122", "-", "392", "-", "-", "1047" ], [ "5821", "114", "-", "393", "-", "329", "1057" ], [ "5831", "124", "-", "394", "-", "-", "1048" ], [ "5832", "125", "-", "395", "-", "-", "1049" ], [ "5833", "126", "-", "396", "-", "-", "1050" ], [ "5834", "127", "-", "397", "-", "-", "1051" ], [ "5904", "-", "7", "398", "-", "-", "1052" ], [ "5905", "-", "8", "399", "-", "-", "1053" ], [ "5906", "-", "9", "400", "-", "-", "1054" ] ], "title": "", "original_id": "7c1ab41b76a1e613f892adbb60910e26" }, { "_id": "7ffc5416643e949c76bce588f1337bb3", "header": [ "name", "team", "qual 1", "qual 2", "best" ], "rows": [ [ "sãbastien bourdais", "n / h / l racing", "58.783", "58.288", "58.288" ], [ "justin wilson", "rsports", "59.099", "58.299", "58.299" ], [ "oriol servia", "forsythe racing", "58.801", "58.661", "58.661" ], [ "simon pagenaud", "team australia", "59.341", "58.664", "58.664" ], [ "bruno junqueira", "dale coyne racing", "59.547", "58.675", "58.675" ], [ "alex tagliani", "rsports", "59.737", "58.779", "58.779" ], [ "will power", "team australia", "1:01.040", "58.79", "58.79" ], [ "jan heylen", "conquest racing", "59.813", "58.816", "58.816" ], [ "neel jani", "pkv racing", "1:00.123", "58.834", "58.834" ], [ "paul tracy", "forsythe racing", "59.368", "58.882", "58.882" ], [ "ryan dalziel", "pacific coast motorsports", "59.880", "58.912", "58.912" ], [ "robert doornbos", "minardi team usa", "59.132", "59.024", "59.024" ], [ "dan clarke", "minardi team usa", "59.288", "59.263", "59.263" ], [ "tristan gommendy", "pkv racing", "59.624", "59.265", "59.265" ], [ "graham rahal", "n / h / l racing", "59.456", "59.384", "59.384" ], [ "katherine legge", "dale coyne racing", "59.520", "59.562", "59.52" ], [ "alex figge", "pacific coast motorsports", "1:00.880", "59.973", "59.973" ] ], "title": "", "original_id": "5a118654a5c97985b6778b93673e8ba0" }, { "_id": "ade331139ebb44240fcbc58dd32aa24d", "header": [ "draw", "language", "artist", "english translation", "place", "points" ], "rows": [ [ "1", "finnish", "marion rung", "chirpy chirp", "7", "4" ], [ "2", "french", "fud leclerc", "your name", "13", "0" ], [ "3", "spanish", "victor balaguer", "call me", "13", "0" ], [ "4", "german", "eleonore schwarz", "only in the vienna air", "13", "0" ], [ "5", "danish", "ellen winther", "lullaby", "10", "2" ], [ "6", "swedish", "inger berggren", "sun and spring", "7", "4" ], [ "7", "german", "conny froboess", "two little italians", "6", "9" ], [ "8", "dutch", "de spelbrekers", "-", "13", "0" ], [ "9", "french", "isabelle aubret", "a first love", "1", "26" ], [ "10", "norwegian", "inger jacobsen", "come sun , come rain", "10", "2" ], [ "11", "french", "jean philippe", "the return", "10", "2" ], [ "12", "serbian", "lola novaković", "don't turn the lights on at twilight", "4", "10" ], [ "13", "english", "ronnie carroll", "-", "4", "10" ], [ "14", "french", "camillo felgen", "little chap", "3", "11" ], [ "15", "italian", "claudio villa", "goodbye , goodbye", "9", "3" ], [ "16", "french", "françois deguelt", "say nothing", "2", "13" ] ], "title": "", "original_id": "fb02efe3a1c329c715cb8d0644dcbc02" }, { "_id": "a493b2bb599437530a09529d99a0104a", "header": [ "draw", "song", "performer", "televotes", "rank" ], "rows": [ [ "1", "preku moreto", "tanja carovska", "1339", "12" ], [ "2", "ne zaboravaj", "kaliopi", "3834", "9" ], [ "3", "son", "monika sokolovska", "862", "15" ], [ "4", "ostani do kraj", "toše proeski & megatim plus", "4210", "8" ], [ "5", "daj mi pricina da se razbudam", "tanja , lidija & zorica pancic", "2459", "11" ], [ "6", "samovilska svadba", "sašo gigov - giš", "34774", "2" ], [ "7", "ne baraj me", "iskra trpeva & granit", "681", "20" ], [ "8", "ne veruvam", "risto samardziev", "8866", "5" ], [ "9", "daj mi šansa", "dule & koki", "23615", "3" ], [ "10", "koj si ti", "biljana dodeva", "828", "16" ], [ "11", "te sakam beskrajno", "pece ognenov and adrijana janevska", "1100", "13" ], [ "12", "bez tebe", "duo maratov", "764", "17" ], [ "13", "ljubovta nema granici", "intervali", "694", "19" ], [ "14", "kameleon", "maja grozdanovska & bumerang", "3319", "10" ], [ "15", "andrea", "marjan necak", "725", "18" ], [ "16", "opomena", "suzana spasovska", "5441", "6" ], [ "17", "broj do deset", "maja vukicevic", "908", "14" ], [ "18", "ne zori , zoro", "vlado janevski", "38642", "1" ], [ "19", "ukradeni nokji", "karolina gočeva", "10454", "4" ], [ "20", "pari pari", "mico atanasiu", "4453", "7" ] ], "title": "", "original_id": "531afa6132809309425cb9afae455a06" }, { "_id": "9403efcd20619260970d390f949a26aa", "header": [ "P", "T", "PC", "Composition" ], "rows": [ [ "Musicalische Ergötzung (1691)", "Musicalische Ergötzung (1691)", "Musicalische Ergötzung (1691)", "Musicalische Ergötzung (1691)" ], [ "370a", "331", "348", "Suite in F major, 2vn, b.c." ], [ "371", "332", "349", "Suite in C minor, 2vn, b.c." ], [ "372", "333", "350", "Suite in E-flat major, 2vn, b.c." ], [ "373", "334", "351", "Suite in E minor, 2vn, b.c." ], [ "374", "335", "352", "Suite in C major, 2vn, b.c." ], [ "375", "336", "353", "Suite in B-flat major, 2vn, b.c." ], [ "-", "-", "-", "-" ], [ "28", "341", "-", "Aria with 9 variations in A major, vn, 2vg" ], [ "37", "337", "358", "Canon and gigue in D major, 3vn, b.c." ], [ "427*", "-", "359", "Sonata in G major, vn, k.i." ], [ "449", "340", "354", "Suite in F-sharp minor, vn, 2va, b.c." ], [ "450", "339", "355b?", "Suite in G major (no. 1), vn, 2va, vle (Perrault writes: The lack of figuration for the lower part means that it was not a b.c., so that this work may well count as the first true string quartet, at least within the Germanophone domain.)" ], [ "451", "338", "355a?", "Suite in G major (no. 2), 2vn, 2va, b.c." ], [ "453", "-", "-", "Suite [tonality unspecified], vn, 2va, k.i., (?)b.c." ] ], "title": "", "original_id": "7160d3342f1a91cd79b02642e8702aa1" }, { "_id": "e81f9af66841e45aef11da48c5c876c0", "header": [ "club", "played", "won", "drawn", "lost", "points for", "points against", "tries for", "tries against", "try bonus", "losing bonus", "points" ], "rows": [ [ "club", "played", "won", "drawn", "lost", "points for", "points against", "tries for", "tries against", "try bonus", "losing bonus", "points" ], [ "bryncoch rfc", "22", "21", "0", "1", "743", "403", "106", "58", "13", "0", "93 1" ], [ "ystalyfera rfc", "22", "15", "0", "7", "563", "379", "67", "47", "5", "4", "69" ], [ "taibach rfc", "22", "14", "1", "7", "514", "340", "75", "42", "8", "2", "68" ], [ "glyncorrwg rfc", "22", "13", "1", "8", "468", "311", "61", "38", "5", "6", "65" ], [ "resolven rfc", "22", "12", "0", "10", "460", "439", "61", "62", "7", "6", "61" ], [ "pontycymmer rfc", "22", "10", "0", "12", "384", "405", "52", "49", "5", "5", "50" ], [ "aberavon green stars rfc", "22", "10", "0", "12", "342", "598", "49", "85", "5", "3", "48" ], [ "ystradgynlais rfc", "22", "9", "0", "13", "366", "451", "44", "59", "4", "3", "43" ], [ "porthcawl rfc", "22", "7", "1", "14", "490", "517", "64", "72", "6", "6", "42" ], [ "vardre rfc", "22", "8", "1", "13", "343", "381", "44", "46", "1", "6", "41" ], [ "neath athletic rfc", "22", "7", "0", "15", "352", "521", "48", "75", "5", "8", "41" ], [ "birchgrove rfc", "22", "4", "0", "18", "286", "566", "38", "76", "1", "4", "21" ] ], "title": "", "original_id": "d4b8c6cc2e2a7c529cf0fcb18b7849ef" }, { "_id": "5e0dae69fc69a685ddd49f61e2661783", "header": [ "tribunal", "number of autos da fé with known sentences", "executions in persona", "executions in effigie", "penanced", "total" ], "rows": [ [ "lisbon", "248 (1540 - 1794)", "461", "181", "7024", "7666" ], [ "évora", "164 (1536 - 1781)", "344", "163", "9466", "9973" ], [ "coimbra", "277 (1541 - 1781)", "313", "234", "9000", "9547" ], [ "goa", "71 (1600 - 1773)", "57", "64", "4046", "4167" ], [ "tomar", "2 (1543 - 1544)", "4", "0", "17", "21" ], [ "porto", "1 (1543)", "4", "21", "58", "83" ], [ "lamego", "0", "0", "0", "0", "0" ], [ "total", "763", "1183 (3.76%)", "663 (2.11%)", "29611 (94.13%)", "31457 (100%)" ] ], "title": "", "original_id": "075477a3410897b75dcf401975444271" }, { "_id": "46dcaa686ff3c3fcc27beb9de8b35b5a", "header": [ "artist", "jaanu någisto", "iiris vesik", "erik morna", "veronika portsmuth", "chalice", "kristo rajasaare", "hannaliisa uusmaa", "siim nestor", "peeter vã¤hi", "helen sildna", "ott lepland", "total", "points" ], "rows": [ [ "ithaka maria", "4", "4", "3", "9", "6", "2", "3", "5", "6", "5", "5", "52", "3" ], [ "rolf junior", "8", "7", "7", "1", "2", "4", "8", "9", "5", "8", "8", "67", "6" ], [ "orelipoiss", "1", "5", "10", "10", "10", "9", "9", "10", "1", "9", "7", "81", "10" ], [ "getter jaani", "9", "9", "6", "5", "3", "5", "4", "8", "10", "3", "6", "68", "7" ], [ "jana kask", "6", "6", "5", "6", "9", "3", "10", "7", "9", "4", "9", "74", "8" ], [ "mid", "3", "1", "9", "7", "8", "10", "7", "4", "2", "7", "4", "62", "5" ], [ "outloudz", "10", "10", "8", "8", "7", "7", "5", "6", "4", "6", "10", "81", "9" ], [ "mimicry", "5", "3", "1", "4", "4", "6", "2", "2", "3", "1", "1", "32", "2" ], [ "noorkuu", "7", "2", "2", "3", "1", "1", "1", "3", "7", "2", "2", "31", "1" ] ], "title": "", "original_id": "90003a11af0ec6e41c63642cc190c8ad" }, { "_id": "7c9f16108cf02bfa416f02aaf9cface3", "header": [ "State/Region Hluttaws", "MPs", "Military MPs", "Ethnic Minister", "Total" ], "rows": [ [ "State Hluttaws", "State Hluttaws", "State Hluttaws", "State Hluttaws", "State Hluttaws" ], [ "Chin State Hluttaw", "18", "6", "0", "24" ], [ "Kachin State Hluttaw", "36", "13", "4", "53" ], [ "Kayah State Hluttaw", "14", "5", "1", "20" ], [ "Kayin State Hluttaw", "14", "6", "3", "23" ], [ "Mon State Hluttaw", "20", "8", "3", "31" ], [ "Rakhine State Hluttaw", "34", "12", "1", "47" ], [ "Shan State Hluttaw", "96", "34", "7", "137" ], [ "Regional Hluttaws", "Regional Hluttaws", "Regional Hluttaws", "Regional Hluttaws", "Regional Hluttaws" ], [ "Ayeyarwady Region Hluttaw", "52", "18", "2", "72" ], [ "Bago Region Hluttaw", "56", "19", "1", "76" ], [ "Magway Region Hluttaw", "50", "17", "1", "68" ], [ "Mandalay Region Hluttaw", "56", "19", "1", "76" ], [ "Sagaing Region Hluttaw", "74", "25", "2", "101" ], [ "Taninthayi Region Hluttaw", "20", "7", "1", "28" ], [ "Yangon Region Hluttaw", "90", "31", "2", "123" ], [ "-", "630", "220", "29", "879" ] ], "title": "", "original_id": "175726966dad3404ab9f4ea4021103dc" }, { "_id": "e5ae2d74e0e8d60938f64dea3eb1b402", "header": [ "rank by average", "competition finish", "couple", "total", "number of dances", "average" ], "rows": [ [ "1", "1", "jill & darren", "371", "11", "33.7" ], [ "2", "2", "denise & ian", "359", "11", "32.6" ], [ "3", "4", "aled & lilia", "256", "9", "28.4" ], [ "4", "6", "sarah & brendan", "140", "5", "28.0" ], [ "5", "3", "julian & erin", "269", "11", "24.5" ], [ "6", "5", "roger & camilla", "165", "7", "23.6" ], [ "7", "9", "carol & paul", "42", "2", "21.0" ], [ "8", "8", "esther & anton", "56", "3", "18.7" ], [ "9", "7", "diarmuid & nicole", "55", "4", "13.8" ] ], "title": "", "original_id": "45f4f92e48b5167842bf0c30f624d0b4" }, { "_id": "83a401546ee15751841ca78a9e3058f7", "header": [ "series", "season", "title", "written by", "original air date", "us viewers (millions)" ], "rows": [ [ "36", "1", "the big bang", "kari lizer & jeff astrof", "february 4 , 2008", "9.43" ], [ "37", "2", "beauty is only spanx deep", "kari lizer", "february 11 , 2008", "9.89" ], [ "38", "3", "popular", "jennifer crittenden", "february 18 , 2008", "9.4" ], [ "39", "4", "traffic", "jeff astrof", "february 25 , 2008", "9.14" ], [ "40", "5", "between a rock and a hard place", "aaron shure", "march 3 , 2008", "8.35" ], [ "41", "6", "the new adventures of old christine", "frank pines", "march 10 , 2008", "7.38" ], [ "42", "7", "house", "katie palmer", "march 10 , 2008", "9.62" ], [ "43", "8", "burning down the house (part 1)", "aaron shure", "march 17 , 2008", "11.47" ] ], "title": "", "original_id": "b31b52e170963e2b4d7fae9a6f59cc63" }, { "_id": "e043ed780447d398b5fc8b120aeb87ba", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "cuba", "27", "16", "8", "51" ], [ "2", "mexico", "6", "9", "6", "21" ], [ "3", "colombia", "3", "1", "7", "11" ], [ "4", "bahamas", "2", "4", "3", "9" ], [ "5", "puerto rico", "2", "3", "6", "11" ], [ "6", "jamaica", "1", "3", "3", "7" ], [ "7", "us virgin islands", "1", "0", "1", "2" ], [ "8", "guyana", "1", "0", "0", "1" ], [ "9", "dominican republic", "0", "4", "2", "6" ], [ "10", "trinidad and tobago", "0", "2", "1", "3" ], [ "10", "venezuela", "0", "2", "1", "3" ], [ "12", "barbados", "0", "0", "2", "2" ], [ "13", "haiti", "0", "0", "1", "1" ], [ "13", "panama", "0", "0", "1", "1" ] ], "title": "", "original_id": "9850b7df3d67a990615a254038222699" }, { "_id": "d67cddfe71e4601b36a7d4e1438526c9", "header": [ "asian rank", "world rank", "country", "gdp per capita", "gdp world rank" ], "rows": [ [ "1", "1", "qatar", "85638", "69" ], [ "2", "4", "brunei", "50790", "113" ], [ "3", "5", "singapore", "49754", "44" ], [ "4", "9", "kuwait", "39344", "56" ], [ "5", "14", "united arab emirates", "37941", "55" ], [ "6", "22", "japan", "33596", "3" ], [ "7", "24", "bahrain", "31899", "105" ], [ "8", "26", "republic of china (taiwan)", "30322", "19" ], [ "9", "31", "israel", "27147", "52" ], [ "10", "34", "south korea", "24803", "14" ], [ "11", "36", "oman", "23987", "77" ], [ "12", "38", "saudi arabia", "22852", "22" ], [ "13", "59", "malaysia", "13385", "30" ], [ "14", "66", "lebanon", "11279", "84" ], [ "15", "71", "iran", "10570", "18" ], [ "16", "83", "thailand", "7907", "24" ], [ "17", "100", "people 's republic of china", "7325", "2" ], [ "18", "105", "jordan", "6976", "99" ], [ "19", "106", "bhutan", "6962", "n / a" ], [ "20", "109", "maldives", "4603", "n / a" ], [ "21", "111", "syria", "6892", "63" ], [ "22", "113", "sri lanka", "6765", "65" ], [ "23", "120", "indonesia", "6728", "16" ], [ "24", "122", "philippines", "3383", "37" ], [ "25", "124", "mongolia", "3222", "141" ], [ "26", "127", "pakistan", "2594", "26" ], [ "27", "128", "vietnam", "2589", "46" ], [ "28", "129", "india", "2563", "4" ], [ "29", "107", "east timor", "4770", "156" ], [ "30", "132", "yemen", "2343", "81" ], [ "31", "136", "laos", "2054", "128" ], [ "32", "140", "papua new guinea", "1974", "131" ], [ "33", "143", "cambodia", "1818", "103" ], [ "34", "153", "bangladesh", "1311", "48" ], [ "35", "159", "nepal", "3397", "96" ], [ "36", "161", "burma", "1040", "78" ] ], "title": "", "original_id": "47219e7225da35f61cb5307288f2eac3" }, { "_id": "2417200ef525319a013463f25625f74f", "header": [ "Number", "Manufacturer", "Build date", "Length (mm)", "Weight (t)" ], "rows": [ [ "201", "Nippon Sharyo", "1961", "20,000", "30.0" ], [ "202", "Nippon Sharyo", "1961", "20,000", "30.0" ], [ "203", "Nippon Sharyo", "1963", "20,000", "30.0" ], [ "204", "Nippon Sharyo", "1963", "20,000", "30.0" ], [ "205", "Nippon Sharyo", "1963", "20,000", "30.0" ], [ "206", "Nippon Sharyo", "1963", "20,000", "30.0" ], [ "207", "Nippon Sharyo", "1970", "20,000", "30.0" ], [ "208", "Nippon Sharyo", "1970", "20,000", "30.0" ], [ "209", "Nippon Sharyo", "1970", "20,000", "30.0" ], [ "210", "Nippon Sharyo", "1970", "20,000", "30.0" ], [ "211", "Nippon Sharyo", "1975", "20,000", "30.0" ], [ "212", "Nippon Sharyo", "1975", "20,000", "30.0" ], [ "213", "Nippon Sharyo", "1977", "20,000", "30.0" ], [ "214", "Nippon Sharyo", "1977", "20,000", "30.0" ] ], "title": "", "original_id": "759da94748ad76efea4d2e7f8a1a0f98" }, { "_id": "f7ab51757585823845d52b73b00f7a3d", "header": [ "warship", "tons ( lton )", "horse - power", "speed ( knots )", "main artillery", "built year" ], "rows": [ [ "o'higgins", "1101.0", "300", "12", "3x115 - 2x70 - 2x12 - pounders", "1874" ], [ "chacabuco", "1101.0", "300", "11", "1x115 - 2x70 - 2x12 - pounders", "1874" ], [ "abtao", "1051.0", "300", "8", "3x115 - 3x30 - pounders", "1870" ], [ "magallanes", "772.0", "260", "115", "1x115 - 1x64 - 2x20 - pounders", "1874" ], [ "covadonga", "412.0", "140", "7", "2x70 - 3x40 - pounders", "1859" ], [ "esmeralda", "854.0", "200", "8", "16x32 - 2x12 - pounders", "1855" ], [ "uniã cubicn", "1.15", "320", "13", "12x68 - 1x9 - pounders", "1864" ] ], "title": "", "original_id": "93fdf9fdfc3faa74391119e6248abd37" }, { "_id": "122ec56280332bdc97fdfe6580fddeca", "header": [ "rank", "circuit", "headquarters", "screens", "sites" ], "rows": [ [ "1", "regal entertainment group", "knoxville , tn", "7367", "580" ], [ "2", "amc entertainment inc", "kansas city , mo", "5894", "483" ], [ "3", "cinemark theatres", "plano , tx", "3895", "298" ], [ "4", "carmike cinemas , inc", "columbus , ga", "2242", "232" ], [ "5", "cineplex entertainment", "toronto , on", "1438", "133" ], [ "6", "rave motion pictures", "dallas , tx", "939", "62" ], [ "7", "marcus theatres", "milwaukee , wi", "687", "55" ], [ "8", "national amusements", "dedham , ma", "450", "34" ], [ "9", "empire theatres", "stellarton , ns", "438", "53" ] ], "title": "", "original_id": "60670a8d9b1e39dd845fb1639d0d8b86" }, { "_id": "42183e426ca6b353dc24e26ece160332", "header": [ "ballarat fl", "wins", "byes", "losses", "draws", "against" ], "rows": [ [ "sunbury", "16", "1", "1", "0", "1022" ], [ "melton south", "12", "2", "4", "0", "1191" ], [ "redan", "12", "2", "4", "0", "974" ], [ "lake wendouree", "12", "2", "4", "0", "1127" ], [ "daylesford", "11", "2", "5", "0", "1109" ], [ "darley", "11", "2", "5", "0", "1230" ], [ "ballarat", "5", "2", "11", "0", "1665" ], [ "melton", "4", "2", "12", "0", "1638" ], [ "sebastapol", "3", "1", "14", "0", "1802" ], [ "east point", "2", "1", "15", "0", "2090" ], [ "bacchus marsh", "2", "1", "15", "0", "2375" ] ], "title": "", "original_id": "c5b41b1733a460472e3d1bc744be96d1" }, { "_id": "7293f2fa7eafab2bd6237d51379d0fbd", "header": [ "language", "totora municipality", "pojo municipality", "pocona municipality", "chimoré municipality", "puerto villarroel municipality", "entre ríos municipality" ], "rows": [ [ "quechua", "11671", "10203", "12482", "9596", "29940", "14789" ], [ "aymara", "72", "74", "39", "965", "1590", "907" ], [ "guaraní", "7", "9", "3", "19", "39", "41" ], [ "another native", "16", "9", "6", "424", "235", "27" ], [ "spanish", "4967", "4991", "4954", "11530", "29377", "17164" ], [ "foreign", "32", "15", "22", "128", "199", "142" ], [ "only native", "7060", "5623", "7706", "2518", "8131", "3207" ], [ "native and spanish", "4645", "4598", "4790", "7811", "22426", "11864" ], [ "only spanish", "322", "393", "166", "3726", "6956", "5314" ] ], "title": "", "original_id": "9ea49f48f21f83149313285053b6621c" }, { "_id": "8e960f5839593acb4752ea0ce7c0aca6", "header": [ "series", "model", "cpu clock ( mhz )", "cpu cores", "tdp ( w )", "l2 cache (kib)", "radeon cores", "ddr3 speed" ], "rows": [ [ "c - series", "c - 30", "1000", "1", "0 9", "512", "80", "1066" ], [ "c - series", "c - 50", "1000", "2", "0 9", "2512", "80", "1066" ], [ "c - series", "c - 60", "1000 / 1333 (turbo)", "2", "0 9", "2512", "80", "1066" ], [ "c - series", "c - 70", "1000 / 1333 (turbo)", "2", "0 9", "2512", "80", "1066" ], [ "e - series", "e - 240", "1500", "1", "18", "512", "80", "1066" ], [ "e - series", "e - 300", "1300", "2", "18", "2512", "80", "1066" ], [ "e - series", "e - 350", "1600", "2", "18", "2512", "80", "1066" ], [ "e - series", "e - 450", "1650", "2", "18", "2512", "80", "1333" ], [ "e - series", "e1 - 1200", "1400", "2", "18", "2512", "80", "1066" ], [ "e - series", "e1 - 1500", "1480", "2", "18", "2512", "80", "1066" ], [ "e - series", "e2 - 1800", "1700", "2", "18", "2512", "80", "1333" ], [ "e - series", "e2 - 2000", "1750", "2", "18", "2512", "80", "1333" ], [ "g - series", "t - 24l", "0 800", "1", "0 5", "512", "80", "1066" ], [ "g - series", "t - 30l", "1400", "1", "18", "512", "80", "1333" ], [ "g - series", "t - 40n", "1000", "2", "0 9", "2512", "80", "1066" ], [ "g - series", "t - 44r", "1200", "1", "0 9", "512", "80", "1066" ], [ "g - series", "t - 48l", "1400", "2", "18", "2512", "80", "1066" ], [ "g - series", "t - 48n", "1400", "2", "18", "2512", "80", "1066" ], [ "g - series", "t - 52r", "1500", "1", "18", "512", "80", "1066" ], [ "g - series", "t - 56n", "1600", "2", "18", "2512", "80", "1066" ], [ "z - series", "z - 01", "1000", "2", "5.9", "2512", "80", "1066" ], [ "z - series", "z - 60", "1000", "2", "4.5", "2512", "80", "1066" ] ], "title": "", "original_id": "a391095376b9b00a461c12b58b5cf94b" }, { "_id": "41c5c295549635003a30b51ff8d88987", "header": [ "ensemble", "gold medals", "silver medals", "bronze medals", "total medals" ], "rows": [ [ "amador valley hs", "0", "1", "0", "1" ], [ "ayala high school", "4", "2", "1", "7" ], [ "baldwinsville hs", "2", "0", "0", "2" ], [ "claremont hs", "1", "1", "0", "2" ], [ "downers grove hs", "0", "0", "1", "1" ], [ "father ryan hs", "0", "1", "0", "1" ], [ "fort mill hs", "2", "1", "2", "5" ], [ "franklin central hs", "6", "0", "0", "6" ], [ "gateway high school", "2", "1", "1", "4" ], [ "goshen hs", "0", "2", "1", "3" ], [ "harrison central paragon hs", "0", "0", "1", "1" ], [ "james logan high school", "1", "1", "0", "2" ], [ "john overton hs", "0", "1", "2", "3" ], [ "king philip high school", "0", "1", "0", "1" ], [ "mansfield hs", "0", "1", "0", "1" ], [ "mission viejo high school", "0", "1", "0", "1" ], [ "muscle shoals hs", "1", "1", "2", "4" ], [ "new philadelphia hs", "0", "1", "0", "1" ], [ "northglenn hs", "0", "0", "1", "1" ], [ "rangeview hs", "0", "1", "0", "1" ], [ "roland hayes school", "0", "0", "1", "1" ], [ "tarpon springs hs", "0", "1", "0", "1" ], [ "tunstall hs", "0", "3", "4", "7" ], [ "warsaw community hs", "0", "0", "1", "1" ] ], "title": "", "original_id": "7982e29a97a23d0882ec57e3f0ef5106" }, { "_id": "1128d489978c5410ef44cd0f04c35ce6", "header": [ "sr no", "name of road", "passes through - district (s", "length (in km)", "mdr no" ], "rows": [ [ "1", "nahan dadahul haripurdhar", "sirmour", "87.0", "1" ], [ "2", "solan meenus (except state highway 6 portion)", "sirmour / solan", "98.0", "2" ], [ "3", "banethi rajgarh chandol", "sirmour", "127.0", "3" ], [ "4", "markanda bridge suketi park kala amb trilokpur", "sirmour", "21.5", "4" ], [ "5", "kolar bilaspur", "sirmour", "13.0", "5" ], [ "6", "parwanoo kasauli dharampur sabhathu solan", "solan", "65.32", "6" ], [ "7", "barotiwala baddi sai ramshar", "solan", "44.95", "7" ], [ "8", "kufri chail kandaghat", "solan / shimla", "57.0", "8" ], [ "9", "solan barog kumarhatti", "solan", "13.0", "9" ], [ "10", "dharampur kasauli", "solan", "10.5", "10" ], [ "11", "arki dhundan bhararighat", "solan", "18.7", "11" ], [ "12", "nalagarh dhabota bharatgarh", "solan", "9.4", "12" ], [ "13", "shogi mehli junga sadhupul", "shimla", "49.4", "13" ], [ "14", "mashobra bhekhalti", "shimla", "18.0", "14" ], [ "15", "narkanda thanadhar kotgarh bithal", "shimla", "44.0", "15" ], [ "16", "rampur mashnoo sarahan jeori", "shimla", "62.0", "19" ], [ "17", "bakrot karsog (sanarli) sainj", "mandi", "41.8", "21" ], [ "18", "salapper tattapani suni luhri", "mandi / shimla", "120.8", "22" ], [ "19", "mandi kataula bajaura", "mandi", "51.0", "23" ], [ "20", "mandi gagal chailchowk janjehli", "mandi", "45.8", "24" ], [ "21", "chailchowk gohar pandoh", "mandi", "29.6", "25" ], [ "22", "mandi rewalsar kalkhar", "mandi", "28.0", "26" ], [ "23", "nore wazir bowli", "kullu", "37.0", "28" ], [ "24", "kullu nagar manali (left bank)", "kullu", "39.4", "29" ], [ "25", "jia manikarn", "kullu", "33.5", "30" ], [ "26", "swarghat nainadevi bhakhra", "bilaspur / una", "55.7", "31" ], [ "27", "nainadevi kaula da toba", "bilaspur", "12.2", "32" ], [ "28", "bamta kandrour", "bilaspur", "6.7", "33" ], [ "29", "nagaon beri", "bilaspur / solan", "37.0", "34" ], [ "30", "hamirpur bhoranj jahu", "hamirpur", "30.0", "35" ], [ "31", "nadaun sujanpur", "hamirpur", "21.0", "36" ], [ "32", "barsar deothsidh", "hamirpur", "11.3", "37" ], [ "33", "sujanpur sandhol marhi", "hamirpur / mandi", "45.0", "38" ], [ "35", "una hoshiarpur bankhandi hoshairpur", "una", "15.0", "40" ], [ "36", "tahliwal garhshankar (hp boundary)", "una", "8.0", "41" ], [ "37", "bharwain chintpurni kandrori damtal", "una / kangra", "95.56", "42" ], [ "38", "baijnath ladbharol kandapattan", "kangra / mandi", "33.0", "43" ], [ "39", "gaggal chetru dharamshala mcleodganj", "kangra", "24.0", "44" ], [ "40", "rait charhi dharamshala", "kangra", "20.0", "45" ], [ "41", "kaloha pragpur dhaliara dadasiba sansarpur", "kangra", "60.92", "46" ], [ "42", "kandwal damtal", "kangra", "16.5", "47" ], [ "43", "dadh malan", "kangra", "4.0", "48" ], [ "44", "banikhet dalhouse khajiar", "chamba", "29.0", "49" ], [ "45", "chamba bharmour", "chamba", "45.0", "52" ] ], "title": "", "original_id": "5c2f583f71d78d31ef4fca4f4f3e084f" }, { "_id": "eb65b158687008218de778e57ce630c1", "header": [ "#", "Name", "Birth and death", "Office started", "Office ended" ], "rows": [ [ "1", "Geir Vídalín", "27 October 1761\n–\n20 September 1823", "1801", "1823" ], [ "2", "Steingrímur Jónsson", null, "1824", "1845" ], [ "3", "Helgi Thordersen", "8 April 1794\n–\n4 December 1867", "1846", "1866" ], [ "4", "'Pétur Pétursson", "3 October 1808\n–\n15 May 1891", "1866", "1889" ], [ "5", "Hallgrímur Sveinsson", "5 April 1841\n–\n16 December 1909", "1889", "1908" ], [ "6", "Þórhallur Bjarnarson", "2 December 1855\n–\n15 December 1916", "1908", "1916" ], [ "7", "Jón Helgason", "1866\n–\n1942", "1917", "1939" ], [ "8", "Sigurgeir Sigurðsson", "3 August 1890\n-\n13 October 1953", "1939", "1953" ], [ "9", "Ásmundur Guðmundsson", "6 October 1888\nReykholt\n–\n29 May 1969\nReykjavík", "1954", "1989" ], [ "10", "Sigurbjörn Einarsson", "30 June 1911\nVestur-Skaftafellssýsla\n–\n28 August 2008\nReykjavík", "1959", "1981" ], [ "11", "Pétur Sigurgeirsson\n(son of Sigurgeir Sigurðsson, 8th Bishop of Iceland)", "2 June 1919\n–\n3 June 2010", "1981", "1989" ], [ "12", "Ólafur Skúlason", "29 December 1929\n–\n9 June 2008", "1989", "1997" ], [ "13", "Karl Sigurbjörnsson\n(son of Sigurbjörn Einarsson, 10th Bishop of Iceland)", "5 February 1947\nReykjavík", "1998", "2012" ], [ "14", "Agnes Sigurðardóttir", "19 October 1954\nÍsafjörður", "24 June 2012", "Incumbent" ] ], "title": "", "original_id": "aca822dccfa5b7a04abe4dd08ba88e50" }, { "_id": "7624895211adc46a0d6444ade17518a9", "header": [ "rank", "nation", "gold", "silver", "bronze", "total" ], "rows": [ [ "1", "australia", "3", "3", "5", "11" ], [ "2", "russia", "3", "3", "2", "8" ], [ "3", "italy", "3", "1", "2", "6" ], [ "4", "united states", "2", "0", "0", "2" ], [ "5", "germany", "1", "2", "3", "6" ], [ "6", "netherlands", "1", "2", "0", "3" ], [ "7", "belgium", "1", "0", "0", "1" ], [ "7", "spain", "1", "0", "0", "1" ], [ "7", "lithuania", "1", "0", "0", "1" ], [ "7", "norway", "1", "0", "0", "1" ], [ "7", "slovenia", "1", "0", "0", "1" ], [ "12", "france", "0", "2", "2", "4" ], [ "13", "denmark", "0", "1", "1", "2" ], [ "13", "portugal", "0", "1", "1", "2" ], [ "15", "hungary", "0", "1", "0", "1" ], [ "15", "switzerland", "0", "1", "0", "1" ], [ "15", "ukraine", "0", "1", "0", "1" ], [ "18", "new zealand", "0", "0", "1", "1" ], [ "18", "south africa", "0", "0", "1", "1" ] ], "title": "", "original_id": "ef758cb602e41211846652763d99176e" }, { "_id": "a2c051cfd28eefbe60f38b96d011a803", "header": [ "administrative region", "population (2002 census data)", "surface km 2", "main rivers", "average annual rainfall (mm)", "average annual runoff (mm)", "per capita average annual renewable water resources m 3" ], "rows": [ [ "i - tarapacá", "428594", "58698", "azapa river , vítor river and camarones river", "93.6", "7.1", "972" ], [ "ii - antofagasta", "493984", "126444", "loa river", "44.5", "0.2", "51" ], [ "iii - atacama", "254336", "75573", "salado river", "82.4", "0.7", "208" ], [ "iv - coquimbo", "603210", "40656", "elqui river , choapa river and limarí river", "222.0", "18.0", "1213" ], [ "v - valparaíso", "1539852", "16396", "petorca river , la ligua river and aconcagua river", "434.0", "84.0", "894" ], [ "metro region (mr) - santiago metropolitan", "7003122", "15349", "maipo river", "650.0", "200.0", "438" ], [ "vii - maule", "908097", "30325", "mataquito river and maule river", "1377.0", "784.0", "26181" ], [ "viii - biobío", "1861562", "36929", "itata river , biobío river and laja river", "1766.0", "1173.0", "23270" ] ], "title": "", "original_id": "2e09024d7ebcee21c3bd33ae5f07e020" }, { "_id": "61f16dcb195739cb066a453534f61a66", "header": [ "name", "location", "enrollment", "1 - year ranking of 727", "5 - year ranking of 693" ], "rows": [ [ "centennial collegiate vocational institute", "guelph", "1533", "63", "22" ], [ "centre dufferin district high school", "shelburne", "998", "265", "281" ], [ "centre wellington district high school", "fergus", "1459", "330", "246" ], [ "college heights secondary school", "guelph", "649", "717", "688" ], [ "erin district high school", "erin", "616", "197", "148" ], [ "guelph collegiate vocational institute", "guelph", "1314", "16", "30" ], [ "john f ross collegiate vocational institute", "guelph", "1895", "181", "165" ], [ "norwell district secondary school", "palmerston", "795", "126", "343" ], [ "orangeville district secondary school", "orangeville", "1574", "181", "194" ], [ "wellington heights secondary school", "mount forest", "680", "371", "426" ], [ "westside secondary school", "orangeville", "996", "478", "343" ] ], "title": "", "original_id": "be9cbb9a182bb4bf349e35b9d80a915c" }, { "_id": "5d0543391a930a7668018882a7eb6475", "header": [ "location", "founded", "type", "enrollment", "nickname", "joined", "left", "current conference" ], "rows": [ [ "mount berry , georgia", "1902", "private", "1937", "vikings", "1996", "2004", "saa (ncaa division iii)" ], [ "birmingham , alabama", "1856", "private", "1400", "panthers", "1996", "2001", "saa (ncaa division iii)" ], [ "nashville , tennessee", "1891", "private", "4278", "bisons", "1996", "2001", "atlantic sun (a - sun) (ncaa division i)" ], [ "cleveland , tennessee", "1918", "private", "4954", "flames", "1996", "2004", "ssac , gulf south in 2013" ], [ "nashville , tennessee", "1901", "private", "2345", "trojans", "1996", "2012", "g - mac (ncaa division ii)" ], [ "jackson , tennessee", "1823", "private", "4259", "union", "1996", "2012", "gulf south (gsc) (ncaa division ii)" ], [ "walnut ridge , arkansas", "1941", "private", "700", "eagles", "1996", "2001", "american midwest" ], [ "batesville , arkansas", "1872", "private", "600", "scots", "1997", "2012", "american midwest" ], [ "memphis , tennessee", "1941", "private", "1970", "eagles", "2005", "2009", "uscaa / nccaa independent" ], [ "jackson , tennessee", "1843", "private", "800", "eagles", "2006", "2009", "closed in 2011" ], [ "lebanon , tennessee", "1842", "private", "1500", "bulldogs", "2002", "2012", "mid - south" ] ], "title": "", "original_id": "7836545f3321d5afd884f55b7532878a" }, { "_id": "28938d88502e1276dad58e2a1ba93a91", "header": [ "station name", "2002 - 03", "2004 - 05", "2005 - 06", "2006 - 07", "2007 - 08", "2008 - 09", "2009 - 10", "2010 - 11", "2011 - 12" ], "rows": [ [ "devonport", "18795", "16202", "18573", "19655", "17450", "21652", "21674", "27006", "27756" ], [ "dockyard", "4070", "5088", "4895", "5335", "4924", "5280", "5524", "5406", "7716" ], [ "keyham", "8957", "6374", "7594", "7976", "5050", "5648", "5016", "6330", "7708" ], [ "st budeaux victoria road", "5451", "5818", "6146", "5264", "5193", "5678", "7026", "6942", "7780" ], [ "bere ferrers", "17808", "12862", "11459", "10824", "10824", "11580", "12606", "14374", "15020" ], [ "bere alston", "37944", "29552", "27263", "26866", "28936", "32454", "36272", "41666", "44792" ], [ "calstock", "25739", "24024", "21123", "23476", "26825", "31168", "33368", "33198", "32456" ], [ "gunnislake", "39009", "37190", "43885", "43676", "48747", "49070", "51424", "50218", "52116" ] ], "title": "", "original_id": "f98c79fd3e60a413ecc94008e44c91b3" }, { "_id": "f6b2b02751c12bc7370a4c1a775e81c6", "header": [ "Party", "No. of candidates", "No. of elected", "No. of votes", "%" ], "rows": [ [ "Indian National Congress", "236", "150", "2889994", "38.82%" ], [ "Communist Party of India", "86", "28", "800951", "10.76%" ], [ "Kisan Mazdoor Praja Party", "129", "15", "667446", "8.97%" ], [ "Bharatiya Jana Sangh", "85", "9", "415458", "5.58%" ], [ "Forward Bloc (Marxist Group)", "48", "11", "393591", "5.29%" ], [ "Socialist Party", "63", "0", "215382", "2.89%" ], [ "Akhil Bharatiya Hindu Mahasabha", "33", "4", "176762", "2.37%" ], [ "Forward Bloc (Ruikar)", "32", "2", "107905", "1.45%" ], [ "Revolutionary Socialist Party", "16", "0", "63173", "0.85%" ], [ "Revolutionary Communist Party of India", "10", "0", "32859", "0.44%" ], [ "Bolshevik Party of India", "8", "0", "20117", "0.27%" ], [ "Akhil Bharatiya Ram Rajya Parishad", "14", "0", "7100", "0.10%" ], [ "Independents", "614", "19", "1653165", "22.21%" ], [ "Total:", "1374", "238", "7443903", "-" ] ], "title": "", "original_id": "439da477576bb07f8300853e210649dc" }, { "_id": "9bdb2ce7f880a0e1c65d339b1bb92d23", "header": [ "Tribunal", "Number of autos da fe", "Executions in persona", "Executions in effigie", "Penanced", "Total" ], "rows": [ [ "Barcelona", "8", "1", "1", "15", "17" ], [ "Logroño", "1", "1", "0", "0?", "1?" ], [ "Palma de Mallorca", "3", "0", "0", "11", "11" ], [ "Saragossa", "1", "0", "0", "3", "3" ], [ "Valencia", "4", "2", "0", "49", "51" ], [ "Las Palmas", "0", "0", "0", "0", "0" ], [ "Córdoba", "13", "17", "19", "125", "161" ], [ "Cuenca", "7", "7", "10", "35", "52" ], [ "Santiago de Compostela", "4", "0", "0", "13", "13" ], [ "Granada", "15", "36", "47", "369", "452" ], [ "Llerena", "5", "1", "0", "45", "46" ], [ "Madrid", "4", "11", "13", "46", "70" ], [ "Murcia", "6", "4", "1", "106", "111" ], [ "Seville", "15", "16", "10", "220", "246" ], [ "Toledo", "33", "6", "14", "128", "148" ], [ "Valladolid", "10", "9", "2", "70", "81" ], [ "Total", "125", "111", "117", "1235", "1463" ] ], "title": "", "original_id": "4fbaad0b3bacf8c4a5741ff081c032c4" }, { "_id": "340766308116e1bc3d18f7d043a6e5ac", "header": [ "incident no", "date", "place", "killed", "injured" ], "rows": [ [ "1", "february", "tumkur , karnataka", "6", "0" ], [ "2", "august", "dantewada , chattisgarh", "350", "0" ], [ "3", "17 august", "andhra pradesh", "0", "0" ], [ "4", "11 november", "giridih , jharkhand", "0", "0" ], [ "5", "11 november", "giridih , jharkhand", "5", "16" ], [ "6", "13 november", "jehanabad , bihar", "4", "5" ], [ "7", "30 december", "dantewada , chhattisgarh", "2", "0" ], [ "total", "total", "total", "367", "21" ] ], "title": "", "original_id": "f3e8910d05ad5055c1c42a079952b8da" }, { "_id": "298909e2d6ec586736b401c4352e4c3a", "header": [ "rank", "peak", "elevation (m)", "prominence (m)", "isolation (km)", "municipality", "county" ], "rows": [ [ "1", "galdhøpiggen", "2469", "2372", "1570", "lom", "oppland" ], [ "2", "jiehkkevárri", "1833", "1741", "140", "lyngen , tromsø", "troms" ], [ "3", "snøhetta", "2286", "1675", "83", "dovre", "oppland" ], [ "4", "store lenangstind", "1625", "1576", "47", "lyngen", "troms" ], [ "5", "gjegnen / blånibba", "1670", "1460", "47", "bremanger", "sogn og fjordane" ], [ "6", "hamperokken", "1404", "1396", "18", "tromsø", "troms" ], [ "7", "skårasalen", "1542", "1385", "7", "ørsta", "møre og romsdal" ], [ "8", "oksskolten", "1916", "1384", "185", "hemnes", "nordland" ], [ "9", "botnafjellet", "1572", "1339", "15", "gloppen", "sogn og fjordane" ], [ "10", "kvitegga", "1717", "1324", "23", "stranda , ørsta", "møre og romsdal" ], [ "11", "fresvikbreen", "1660", "1310", "17", "vik", "sogn og fjordane" ], [ "12", "smørskredtindane", "1630", "1306", "12", "stranda , ørsta", "møre og romsdal" ], [ "13", "njunis", "1717", "1305", "53", "målselv", "troms" ], [ "14", "store trolla", "1850", "1292", "11", "sunndal", "møre og romsdal" ], [ "15", "langlitinden", "1276", "1276", "26", "ibestad", "troms" ], [ "16", "indre russetind", "1527", "1268", "9", "balsfjord", "troms" ], [ "17", "møysalen", "1262", "1262", "60", "hinnøya", "nordland" ], [ "18", "stortind", "1320", "1242", "14", "tromsø", "troms" ], [ "19", "folgefonna", "1660", "1233", "29", "kvinnherad , odda", "hordaland" ] ], "title": "", "original_id": "f54fdc8f3471782a34be35f0f3e38535" }, { "_id": "c220d3fb6e6ac058f53e5fd86f5a50f4", "header": [ "place", "code", "area (km 2 )", "population", "most spoken language" ], "rows": [ [ "abantungwa / kholwa", "51401", "245.25", "57273", "zulu" ], [ "colenso", "51402", "4.9", "4476", "zulu" ], [ "ezakheni", "51404", "39.0", "59943", "zulu" ], [ "kliprivier nu", "51406", "2.8", "381", "zulu" ], [ "kliprivier", "51405", "107.21", "27696", "zulu" ], [ "ladysmith", "51407", "91.97", "41425", "zulu" ], [ "mchunu", "51408", "34.42", "2301", "zulu" ], [ "mthembu", "51409", "80.7", "6920", "zulu" ], [ "mvelani", "51410", "2.43", "11898", "zulu" ], [ "nkankezi", "51411", "4.86", "824", "zulu" ], [ "remainder of the municipality", "51403", "2350.72", "12316", "zulu" ] ], "title": "", "original_id": "29c36dbc873ed833d3fdc8c19375453b" }, { "_id": "d4804193a3d2483988e79a34f3545aee", "header": [ "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "Measure unit", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)", "POPULATION (by age group in 2002)" ], "rows": [ [ "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "SPECIFICATION", "Measure unit", "TOTAL", "0–9", "10–19", "20–29", "30–39", "40–49", "50–59", "60–69", "70–79", "80 +" ], [ "I.", "TOTAL", "TOTAL", "TOTAL", "TOTAL", "person", "214", "35", "44", "28", "26", "23", "22", "12", "16", "8" ], [ "I.", "—", "of which in", "of which in", "of which in", "%", "100", "16.4", "20.6", "13.1", "12.1", "10.7", "10.3", "5.6", "7.5", "3.7" ], [ "I.", "1.", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX", "BY SEX" ], [ "I.", "1.", "A.", "Males", "Males", "person", "103", "16", "21", "12", "14", "13", "10", "6", "8", "3" ], [ "I.", "1.", "A.", "—", "of which in", "%", "48.1", "7.5", "9.8", "5.6", "6.5", "6.1", "4.7", "2.8", "3.7", "1.4" ], [ "I.", "1.", "B.", "Females", "Females", "person", "111", "19", "23", "16", "12", "10", "12", "6", "8", "5" ], [ "I.", "1.", "B.", "—", "of which in", "%", "51.9", "8.9", "10.7", "7.5", "5.6", "4.7", "5.6", "2.8", "3.7", "2.3" ] ], "title": "", "original_id": "a0d083844e9797e0e9f96920b57ce41d" }, { "_id": "d34c47757ee2db65b7338a57feae28a1", "header": [ "city", "january (avg high degree)", "january (avg low degree)", "july (avg high degree)", "july (avg low degree)" ], "rows": [ [ "winnipeg , mb", "10.6", "6.5", "78.4", "56.3" ], [ "saskatoon , sk", "13.8", "5.3", "77.5", "52.9" ], [ "regina , sk", "15.3", "4.2", "78.2", "53.4" ], [ "quebec city , qc", "19.4", "3.0", "76.5", "57.2" ], [ "edmonton , ab", "20.7", "0.1", "73.0", "49.1" ], [ "ottawa , on", "21.6", "6.1", "79.9", "60.3" ], [ "calgary , ab", "30.4", "8.2", "73.8", "49.6" ], [ "montreal , qc", "22.5", "6.8", "79.3", "61.0" ], [ "halifax , ns", "31.8", "17.2", "73.6", "59.2" ], [ "st john 's , nl", "30.6", "17.2", "69.3", "51.6" ], [ "toronto , on", "30.7", "19.8", "79.9", "64.4" ], [ "windsor , on", "31.5", "18.9", "82.6", "64.2" ], [ "vancouver , bc", "44.2", "34.3", "71.8", "56.7" ], [ "kamloops , bc", "32.7", "21.4", "84.0", "57.6" ], [ "yellowknife , nt", "6.9", "21.1", "70.3", "54.7" ], [ "iqaluit , nu", "9.0", "23.6", "54.1", "39.4" ], [ "moncton , nb", "25.3", "6.8", "76.5", "55.2" ], [ "charlottetown , pei", "25.9", "10.2", "73.9", "57.4" ], [ "whitehorse , yt", "12.2", "2.6", "69.1", "46.4" ] ], "title": "", "original_id": "58c12f5c85dc3306c3e383b2ae5f130c" }, { "_id": "e1f55363e53c35e41a7d01c351a558b9", "header": [ "-", "Total", "Male", "Female" ], "rows": [ [ "Population", "7159", "3645", "3514" ], [ "Children aged below 6 years", "913", "479", "434" ], [ "Scheduled caste", "1782", "890", "892" ], [ "Scheduled tribe", "744", "383", "361" ], [ "Literates", "4323", "2642", "1681" ], [ "Workers (all)", "3612", "2007", "1605" ], [ "Main workers (total)", "2187", "1463", "724" ], [ "Main workers: Cultivators", "756", "500", "256" ], [ "Main workers: Agricultural labourers", "830", "443", "387" ], [ "Main workers: Household industry workers", "107", "86", "21" ], [ "Main workers: Other", "494", "434", "60" ], [ "Non-workers (total)", "3547", "1638", "1909" ] ], "title": "", "original_id": "ee32b677b3e51d25608fcdbef787f33b" } ]