text stringlengths 1 964k | meta dict |
|---|---|
The Vice President Delivers Remarks at a Lunch for Texas Attorney General John Cornyn
AS PREPARED
Thank you, John, and thank you all very much. Its good to see so many friends this afternoon. I appreciate the warm welcome to the home state of George and Laura Bush and the hometown of George and Barbara Bush. And its a special honor to share the platform with the next United States Senator from the state of Texas.
I've been looking forward to this trip, and I thank the people of this great city for your hospitality. Lynne and I spent some very good years living and working in this state. And even though weve moved to Washington, we still see a lot of Texas license plates, and work with some very fine people known to all of you people like Karl Rove, Don Evans, Joe Allbaugh, Al Gonzales, Albert Hawkins, Margaret Spellings, Clay Johnson, Harriet Miers, and of course Karen Hughes. Karens back in Austin now, but weve got her on speed dial. Each of these Texans is serving the President and the nation with honor, and you can be proud of them all.
This state is also well served on Capitol Hill and were here today to make sure things stay that way. No state in the country has a stronger team in the United States Senate than Texas youve got first-class representation with Phil Gramm and Kay Bailey Hutchison. For the good of the state and the nation, we need to keep that team strong and the way to do that is to elect John Cornyn.
Texans know John and his fine record from Bexar [BEAR] County to the Supreme Court to the Attorney Generals office. He works hard, and always speaks with conviction and clarity. Whether the issue is taxes, trade, energy, or national security, John Cornyn is completely in tune with the people of this state. He is a public servant in his prime, and I look forward to swearing him in as the new Senator from Texas.
The President and I need John Cornyn working with us every day on our priorities for the country winning the war on terror, protecting the homeland, and extending the reach of prosperity into as many lives as possible.
On the economy, theres a great deal of work yet to do but we are proceeding from a position of tremendous strength. In spite of all that happened last year from terrorist attack to a serious economic slowdown worker productivity has grown by more than four percent. In the first quarter of this year, the economy grew at an annual rate exceeding six percent. Clearly, were on the path to a strong and sustained recovery.
To stay on that path, our responsibilities are clear, and they begin with pro-growth reforms proposed by President Bush an energy policy to make America less dependent on foreign oil trade promotion authority to open new markets for American products and terrorism insurance to give companies the ability to expand and build.
For their part, leaders of the private sector also have responsibilities to be honest and above board in all dealings, and truthful when they report profits and losses. The foundation of any economy is confidence and President Bush is proposing reform to strengthen the peoples confidence in the basic integrity of the system. These proposals will help ensure better information for investors and more accountability for corporate officials, and deliver a stronger, more independent auditing system. When there are reports of corporate fraud, the American people can be certain that the government will fully investigate, and pursue the wrongdoers.
This nation has brought forth the most productive, creative, and promising economic system the world has ever seen. The Presidents reforms will bring out the best in that system, answering abusive practices with stricter enforcement and higher ethical standards. Most people who do business in America are trustworthy and honest. Their word is good. They keep faith with shareholders and employees. We must not and will not allow the bad deeds of a few to tarnish the free enterprise system.
Americans can also count on President Bush to continue reducing taxes on the hardworking people of this country. The Bush tax cut now in effect is the largest taxpayer relief package in a generation. Now that tax relief is in place, Congress should not take it away. Under current law, the tax cuts are set to expire in 2011. That last thing American workers need is a return to higher taxes. Its far better, in our view, to make the Bush tax cut permanent, and enforce fiscal discipline in Washington, D.C.
Overspending by Congress poses a real risk to our economic vitality. The President has submitted a budget that fits the times with major investments in homeland security and defense, while other domestic spending is held to an increase of two percent. The House has adopted a budget that is consistent with the Presidents request. Now were in the appropriations process, and its critical that we stay within those limits on spending. The President will insist on fiscal discipline and the Constitution gives him a good tool for the job. If necessary, he will use the veto to protect the American taxpayer.
We need John Cornyn in the Senate because he knows what it means to be a careful steward of taxpayer dollars. And we need him there to help us put qualified, sensible judges on the federal bench. Staffing the judiciary is a basic constitutional responsibility of the President and the Senate. President Bush is meeting his responsibility, but the Senate is failing to do so. The President has sent up well over a hundred nominees for the courts, yet only 58 have been confirmed. Nationwide more than 90 judgeships sit empty, and many of these have been classified as judicial emergencies. Yet 11 nominees for the courts of appeals have had to wait more than a year for the Senate Judiciary Committee to even hold a hearing.
In nominating judges President Bush chooses men and women of experience, judicial temperament, and good judgment people who respect the Constitution, and understand the limits of the judicial power. That is the only legitimate standard for selecting judges, and it is the only way to prevent outrages like the California ruling that banned the Pledge of Allegiance.
That decision was handed down by the court of appeals for the ninth circuit. President Bush has submitted three well qualified nominees for that court. And its become obvious to all Americans that we need some new judges on the ninth circuit.
For the fifth circuit, the President has nominated one of Johns former colleagues on the Supreme Court, Priscilla Owen. Fourteen months after her nomination was announced, Justice Owen will finally receive a hearing next Tuesday. At that hearing senators will meet a judge who was twice elected by the voters of this state a woman with a superb legal mind, who enjoys strong bipartisan support and the unqualified endorsement of no fewer than 15 former presidents of the State Bar of Texas.
Just this week Ron Kirk said that if he were elected to the US Senate, quote "there will be many times, probably more times than not, that I'll be supportive of the president." Yet, the first opportunity he had to forecast how he would work WITH the President, he came out AGAINST the president's first-rate nominee. All Texans should be proud of Priscilla Owens fine career and years of service to this state. The Senate should move to confirm her, and all of the Presidents judicial nominees, without wasting another day.
As our administration pursues a full agenda in Washington, never for a moment do we lose sight of the most important responsibility we have: to protect this nation against further attacks and to win the war that began on September 11, 2001.
The first thing the President and I do every day is to receive an intelligence briefing, and learn the current assessment of the dangers forming against the United States. There is little doubting that our enemies are determined to do further and significant harm to the American people. And there is no doubting that we will take every step necessary to defend our country and we will prevail.
The dangers to America require action on many fronts all at once. We are reorganizing the federal government to protect the nation against attack. At present, more than a hundred different federal agencies have some connection to homeland security. That means despite the best of intentions and the hard work of a lot of good people that authority is dispersed too widely accountability is lacking and there is too much duplication of administration. The time has arrived for a new Department of Homeland Security, gathering under one roof the capability to identify threats, check them against our vulnerabilities, and move swiftly to protect the American people. This new department will increase the focus and effectiveness of homeland security, and set clear lines of accountability. We intend to spend less money on bureaucracy and duplication and overhead and more money on protecting the American people.
At the same time, we realize that wars are not won on the defensive. We must take the battle to the enemy and, where necessary, preempt serious threats to our country before they materialize. The only path to safety is the path of action. The United States of America will act, and we will defeat the enemies of freedom.
This lesson has already been learned in Afghanistan, where U.S. forces destroyed the terror camps and liberated an entire nation from the Taliban regime. Yet Afghanistan is only the beginning of a long and unrelenting effort. Were we to stop now, any sense of security we might have would be false and temporary. There is a terrorist underworld spread out among 60 or more countries. The job we have will require every tool of diplomacy, finance, intelligence, law enforcement, and military power. But we will, over time, shut down terrorist camps wherever they are and disrupt terrorist plans and find the terrorists one by one, and bring them to justice. In the case of bin Laden as President Bush said the other day If hes alive, well get him. If hes not alive we got him.
But this war involves more than just a person or a single grouping of people. We also face the threat of weapons of mass destruction. And here the old doctrines of security do not apply. In the days of the Cold War, we were able to manage the threat with summit meetings, arms control treaties, and strategies of deterrence and containment. But there is no way to deter enemies who have no country to defend. And containment is not possible when dictators obtain weapons of mass destruction and have missiles to deliver them, or provide them in secret to a shadowy terror network.
We have already found confirmation that the al-Qaeda terrorists are seriously interested in nuclear and radiological weapons, and in biological and chemical agents. At the same time, there is a danger of terror groups joining together with regimes that have or are seeking to build weapons of mass destruction. In the case of Saddam Hussein, we have a dictator who is clearly pursuing these capabilities and has used them, both in his war against Iran and against his own people.
The government of the United States will not look the other way as threats accumulate against us. Every significant danger to our country requires the most careful, deliberate, and decisive response by America and our allies. A regime that has gassed thousands of its own citizens a regime that hates America and our friends must never be permitted to threaten America with weapons of mass destruction.
The most visible successes in the war have been achieved by our military. More than 60,000 troops are deployed around the world in this effort, and I visited some of them last spring, during my journey to the Middle East. Many of you here today have family members serving in the military. Wherever they are posted, the nation is depending on them. As a former secretary of defense, I have never been more proud of the men and women who wear the uniform of the United States of America.
In this challenge to our freedom we will be expecting a lot from our military and those who serve are entitled to expect a lot from us. If were going to ask young men and women to defend our country, our allies, and our freedom ... if were going to send them in harms way on dangerous missions to fight determined enemies they deserve the best tools, training, and support we can give them. For that reason, President Bush has asked for the most significant increase in defense spending since Ronald Reagan lived in the White House. And for the good of all our military families, the Presidents budget gives every man and woman in uniform a raise in pay and they have earned it.
The conduct of our military does more than bring credit to the country; it reflects the basic character of the American people. This is a good, decent, generous country. We fight not for revenge against our enemies, but for the freedom and security of our own people and for the peace of the world. At times in our history the price of freedom has been high, but Americans have always been willing to pay that price even when the odds weighed heavily against us.
I was reminded of this as I read David McCulloughs biography of our first vice president, John Adams. When Adams and his fellow delegates voted to approve the Declaration of Independence, they knew precisely what kind of trouble they were bringing on themselves. To sign the Declaration, one of the founders said, was like signing your own death warrant. As of July 4, 1776, they would be considered traitors to a king, at war with the army of an empire. Large numbers of enemy soldiers were already positioned on American soil, intent on crushing the rebellion in short order. In mid-August thirty-two thousand British troops landed at Staten Island an army greater in size than the entire population of our largest city at the time, Philadelphia. The American force was far smaller had very little in the way of equipment and supplies and was comprised almost entirely of poorly-trained volunteers. All they had was the courage of human beings determined to live in freedom.
Before they prevailed the Americans endured not weeks, or months, but years of hardship and struggle. The American victory at Yorktown didnt come until the fall of 1781. The Treaty of Paris, which John Adams helped negotiate and which ended the Revolution, was finally concluded in September of 1783 more than seven difficult years after the Declaration was signed.
From that day to this, the people of the United States have understood that the freedom we enjoy did not come easily and we have no intention of letting it slip away. History has called generations of Americans to defend our country and defeat some of the gravest threats humanity has known. We have accepted that duty once again, because we know the cause is just we understand that the hopes of the civilized world depend on us and we are certain of the victory to come.
In this time of testing I am very proud to stand beside a President who has united our nation behind great goals. For all the challenges we face, the United States of America has never been stronger than we are today and even better days are ahead of us. The President and I are very grateful for the opportunity to serve this country. We thank you for your support not just for our efforts, but for solid citizens like John Cornyn, who will be our partner in the important work ahead. | {
"pile_set_name": "Pile-CC"
} |
Q:
How to get the key and value from associative array into a one dimensional array
eg.
['key' => 'value', 'key2' => 'value2']
to
['key', 'value', 'key2', 'value2']
Also, how do I get comma separated string from said array?
A:
Try to do something like that
foreach ($yourArray as $key => $value) {
echo $key . " " . $value;
}
It will echo string "key, value, key2, value2"
| {
"pile_set_name": "StackExchange"
} |
"To the extent that there's additional uncertainty with regard to the company's future, it will only create more challenges," says Cantor Fitzgerald analyst Derek Brown, whose firm makes a market in both Yahoo! and its rival Google ( GOOG).
Yahoo!'s shares have so far benefited from Microsoft's proposal. The stock has jumped as much as 53% since last Friday, when Microsoft publicly revealed its desire to merge the two companies, despite having been privately rebuffed by Yahoo! since 2006. Meanwhile, Microsoft's shares have dipped 7%.
Nonetheless, Yahoo!'s 14,000 employees, who might have been hoping for some much-needed direction, may not be getting it anytime soon. It could take months at best for the company to emerge with some sort of a resolution, and maybe even longer if the deal reaches the hands of the Federal Trade Commission or the U.S. Justice Department for review.
Such lengthy delays could put any one of Yahoo!'s current initiatives in limbo. Darren Chervitz, director of research at the Jacob Internet Fund, which has a position in Yahoo!, notes in particular the company's recent acquisition of Zimbra, which provides open source, next-generation email.
"If you're a Zimbra employee, you might be itching to jump," Chervitz says. "Anything that's new will be more vulnerable."
Yahoo! declined to comment beyond its original statement from Friday in which it said its board of directors will carefully and promptly evaluate Microsoft's proposal. John Robb, a spokesman for Zimbra, said the company's team "remains focused on our customers and delivering new production innovation."
He further noted that Zimbra has moved ahead with the 5.0 version of its product, released on Tuesday, as well as its latest version of Zimbra Desktop.
Even Yang has realized the need for him to keep up his troops' spirits. In a memo to his employees, written in informal lowercase letters, he acknowledged the disruption caused by the Microsoft proposal but urged everyone to stay on track.
"We can't let any of the noise we're hearing around this situation distract us from our core mission," he wrote. "It's critical that we continue to focus on running the business, executing our strategy and delivering value to all of our users, advertisers and publishers."
Easier said than done. Even if Microsoft never swooped in, Yahoo! would have had a difficult time retaining employees already pessimistic about the company's future.
"In the time that Yang's been CEO, we have not been particularly impressed with the plan he's laid out so far or the efforts that have seemed apparent to the Street," Brown says.
For all those who wondered whether they should rough it out with Yahoo! even before Microsoft's proposal, they may have a harder time convincing themselves to stay now, Chervitz says.
"These are in-demand computer engineers and marketing people in still pretty strong markets," Chervitz says.
For Microsoft, that could mean losing some of the very people it hopes to bring on board if the merger goes through. And for Google, whose search engine already has a sizable lead over Microsoft and Yahoo! combined, that could mean widening the gap as Yahoo! tries to sort out its future.
Still, Chervitz says Google's market is shrinking, so any increase in market share may end up being negligible. And given the current state of the economy, Yahoo!'s employees might not be so eager to put themselves back on the job market.
He imagines that turnover at the company may pick up 1% or 2% tops.
"I have a tough time believing it'll be a huge brain drain," Chervitz says. "But even a small level is not great." | {
"pile_set_name": "Pile-CC"
} |
Terror in Chch
Time to recall MPs’ anti-migrant rhetoric
ANALYSIS: We do a lot of talking about Islam at Parliament.
Hansard, the record of parliamentary speeches, has 139 mentions of the word "Muslim", 317 of the word "Islam", and 238 mentions of the word "Islamic" in its searchable record, which dates back to 2003.
In that same time, only one politician — Aaron “do you know I am?” Gilmore, as fate would have it — has mentioned "white supremacy", and none have spoken about "white nationalism".
Other religions are mentioned too — the word “Christian” is mentioned 520 times. But look a little closer, and a distinct difference emerges. While mentions of the word “Christian” tend to be followed by words like “Social Services” more than half of the 238 times, the word “Islam” is mentioned it is followed by the word “State”.
New Zealand is not immune from the global trend of conflating Islam and its nearly two billion adherents with terrorism.
Dr Mohamed Alansari of the University of Auckland noted that when people speak about Islam “it comes with a hint of judgment or a hint of a stereotype and it comes from a place of fear rather than a place of trying to understand”.
The apparent threat of Islam is often conflated with other issues, including security and migration.
No one in Parliament can be expected to wear the blame for Friday’s tragedy.
He was Australian, and appeared to have little connection to New Zealand. But those facts should not prohibit us from examining the crude and hateful rhetoric we have tolerated for too long.
Blame belongs almost exclusively to the terrorist himself. But hate does not breed in a vacuum, and the time is long overdue to hold our leaders to account for playing fast and loose with rhetoric — particularly when it comes to Islam.
Deputy Prime Minister Winston Peters has a longer history than most when it comes to linking concerns about terrorism to Muslims.
The End of Tolerance
In a 2005 speech titled The End Of Tolerance and delivered in the wake of the London bombings, Peters singled out Muslim migrants for special attention.
He spoke about the “political correctness” in other parties:
“They say – ah yes – but New Zealand has always been a nation of immigrants. They miss a crucial point. New Zealand has never been a nation of Islamic immigrants…”
Peters also suggested that moderate Muslims were operating “hand in glove” with extremists.
His exact words are worth quoting in full:
“This two-faced approach is how radical Islam works – present the acceptable face to one audience and the militant face to another.
“In New Zealand the Muslim community have been quick to show us their more moderate face, but as some media reports have shown, there is a militant underbelly here as well.
“Underneath it all the agenda is to promote fundamentalist Islam.
“Indeed these groups are like the mythical Hydra – a serpent underbelly with multiple heads capable of striking at any time and in any direction."
He went on to note that “in many parts of the world the Christian faith is under direct threat from radical Islam,” and said that he had sent a letter to all leaders of Islamic groups in New Zealand, calling them to name any “radicals, troublemakers and potential dangers to our society”.
For what it matters, Peters was wrong on the point of Muslim immigration to New Zealand: an article published in the Waikato Islamic Studies Review notes the first Muslim family to settle permanently in New Zealand arrived at some point in the 1850s and made their home in Cashmere, Christchurch.
Winston Peters has a long history of being outspoken on the issue of Muslim migrants. Photo: Lynn Grieveson.
Peters' language was called out at the time, with Prime Minister Helen Clark telling the House that it was “no more fair to smear all Muslims because some people of that religion commit acts of criminal, murderous violence than it would have been to smear all Irish people because of the acts of the IRA”.
But that was in August — just two months later, Peters was sworn in as Clark’s Foreign Minister.
Peters waded into the issue of Muslim migration even more recently. In the wake of the London Bridge attacks, in June 2017, Peters urged Muslims to turn in potential terrorists.
“While the Islamic community must clean house by turning these monsters in, it starts with their own families,” he said.
Again, Peters lashed out at the culture of political correctness that allowed Muslim “communities apart” to form.
“We must avoid the same politically correct trap that has allowed such communities apart to form — that is, it is we who must change as a society, they say, to accommodate the cultural practices and traditions of others; that, in some twisted spirit of inclusiveness, it is we who must change, and not them,” he said.
Peters was again called out, this time by ACT’s David Seymour, but just a few months after those comments were made, Peters again found himself in government - this time as Deputy Prime Minister.
He made similar remarks about the Orlando nightclub shooting, also in 2017.
But it is not just Peters who wears the blame. Other parties have trafficked in dog-whistle politics too.
National's Judith Collins has claimed the United Nations migration pact would give over "sovereignty for so much of our immigration" to the global body. Photo: Lynn Grieveson.
The National Party has been running a campaign against New Zealand’s signing last December of the UN’s Global Migration Pact.
National alleges, in the words of Judith Collins, that the non-binding pact would give “over sovereignty for so much of our immigration to the United Nations”, a fear which has been stoked and disseminated by online far-right groups according to the Politico news website.
Indeed, as Newsroom noted on Friday, the UN appeared to be a concern of the man who attacked Green co-leader James Shaw on Thursday morning. References to the pact were also scrawled on one of Brenton Tarrant’s guns.
For its part, the UN and many observers refute the notion that it creates “a right to migrate”. Francis Collins, the director of New Zealand’s National Institute of Demographic and Economic Analysis, told Newsroom in December the pact was more about “aspirations”.
“It’s really just an attempt I think to set a number of global norms, or we might even call them aspirations, that countries agreeing to the compact then might try to work towards around migration policy, to sort of get away from both the variations and some of the problematic outcomes of migration policy internationally.”
But that hasn’t stopped some strong rhetoric springing up around the agreement. National’s Gerry Brownlee said on Newshub it would “pretty much open borders”.
National started a petition, saying the pact “defers our immigration policy to the UN” and that it “restricts the ability of future governments to set immigration and foreign policy, and to decide on which migrants are welcome and which aren’t”.
The petition was quietly removed from the party's website in the wake of the shootings. A National spokesman initially claimed the deletion had taken place weeks ago as part of a standard archiving process.
However, in the wake of cached website data showing the page was still online as of Friday afternoon, National leader Simon Bridges revealed an emotional staffer had deleted the petition on Friday night - a fact he said he only became aware of on Tuesday morning.
AIDS, tuberculosis claims
Peters has also had a swipe at the UN on migration. In 2003 he slammed then-Immigration Minister, Lianne Dalziel now the mayor of Christchurch, in the House. Calling her a “bungling, illegal immigrant-loving, hand-wringing, ineffectual, incompetent, no-hoper”.
Citing an open letter from Dalziel, he said she claimed “she cannot do a thing about an alleged Muslim terrorist, because the United Nations will not let her”.
He went on to say she had “done more to destroy the fabric of our society” than any other minister, including bringing “planeloads of Third World ratbags” to the country.
Peters went even further, citing “an illegal African immigrant” who was “raping New Zealand women, infecting them with AIDS, and condemning them to an early death,” and Third World migrants bringing cases of tuberculosis to Auckland hospital.
“I have news for the Prime Minister, her useless Minister of Immigration, and for all the Labour Party Klingons who are polluting this country with the riff-raff of the Third World.
“It is time to put the health and safety of our people first. We are part of the politically correct drivel about saving the world’s flotsam and jetsam,” he said.
Labour also has some guilt. In 2005, then-Immigration Minister David Cunliffe answered questions in The Listener about the Government’s policy of additional screening for migrants from “high-risk” countries.
Labour's tough talk on migration has made some Muslim migrants feel less safe, one Muslim woman in Christchurch says. Photo: Lynn Grieveson.
"Some countries have a higher risk profile in terms of the people they send here and the immigration profiling group within the Immigration Service assesses the risk of individual applicants from those countries,” he said.
He was responding to remarks from then-National leader Don Brash about migrants from countries with "bedrock values”.
Cunliffe pushed back at Brash’s rhetoric, saying he was "trying to do what others have done in history, which is define the 'in' crowd by who is not in it”. But the Listener noted that in practice, the government’s immigration policy was little different to Brash’s, and prioritised migrants from Britain.
Then there was the controversy over Labour's "Chinese-sounding names" attack on overseas home buyers, and a general sense of tough talk on immigration numbers both leading up to and following the 2017 election.
It may not have been aimed at Muslims, but some undoubtedly felt its sting.
Speaking to media outside the Christchurch welfare centre on Sunday, one Muslim woman pointed to the stream of announcements and updates on migration numbers from the Government, saying many in the community felt more targeted and less safe now than before the election.
“People fear the unknown. What they see in the media is Muslims are trying to take over. It's a narrative that people struggle to diminish."
Alansari says that in a vacuum, poor rhetoric has shaped people’s views around Muslims.
“People fear the unknown,” he said.
“What they see in the media is Muslims are trying to take over. It's a narrative that people struggle to diminish,” he said.
“When it comes to understanding the Muslim culture and Muslim religious beliefs, it's often based on misinformed information."
It will take time to know for certain whether such views shaped Tarrant’s views, as it now appears. Media and politicians are wisely not taking his manifesto at face value.
Until then, it seems right to hold our leaders’ rhetoric around race and immigration up to the light, and truly ask ourselves whether we did enough to stamp out racism when it came from people we elected.
Still better, it might be time for parties to look who is on their lists and see what can be done to let New Zealand’s Muslims use the floor of the House to speak for themselves.
Newsroom corrected comments in this story about the deletion National Party's petition on the UN migration pact, after a party spokesman claimed they were incorrect. However, with Simon Bridges now confirming the party did delete the petition following the attacks, we have reinstated the original sentences, along with some information on the denial and retraction. | {
"pile_set_name": "OpenWebText2"
} |
[The characteristics of cylindruria in patients with chronic glomerulonephritis].
Qualitative and quantitative indices of cylindruria were studied in 325 patients aged from 15 to 64 with various morphological forms of chronic glomerulonephritis (CGN). In 237 of them function of kidneys was unchanged while remaining 88 patients revealed various degrees of chronic renal failure (CRF). Parameters of cylindruria in patients with CGN varied widely, significant correlation having been established between presence of erythrocytic cylinders in urinary residue and degree of haematuria. Large granular cylinders were observed in patients with severe and moderate CRF as distinct from patients with normal renal function and initial stage of renal insufficiency. | {
"pile_set_name": "PubMed Abstracts"
} |
Burlington, MA (February 26, 2018)—Avid’s Board of Directors has terminated chief executive officer Louis Hernandez Jr. and appointed Jeff Rosica as its CEO, effective immediately. Hernandez has additionally resigned from his position on the Avid board of directors and Nancy Hawthorne has been elected chairman of the board.
According to Avid, the termination was due to violations of company policies related to workplace conduct. According to a statement from the company, the move was made with the assistance of independent external legal counsel after a special committee comprising independent members of the board of directors conducted “a thorough investigation into allegations of improper non-financially related workplace conduct by Mr. Hernandez. After reviewing the findings of the special committee’s investigation, the board of directors unanimously concluded that the findings warranted immediate termination of Mr. Hernandez’s employment.”
Assuming the mantle of CEO is company president Jeff Rosica, a three-decade industry veteran who joined Avid in early 2013. Prior to his role as president, he served as senior vice president, chief sales and marketing officer for Avid.
Rosica remarked, “I am honored and excited for this opportunity to lead Avid through this important moment in the company’s history. The outlook for Avid is strong, and I look forward to working with the leadership team, the board and our incredibly talented employees as we execute on our strategic priorities and continue our journey to be a best-in-class company and leader in our industry.”
Hernandez first came to Avid in February, 2013, appointed in the wake of a resignation by the company’s previous president/CEO, Gary Greenfield. Prior to his time at Avid, Hernandez was chairman of the board and chief executive officer of Open Solutions, a technology provider for financial institutions.
Under his watch, Avid underwent an often painful consolidation as it shuttered numerous U.S. offices, laying off hundreds of employees in 2016 to move R&D, engineering and customer care services overseas to Taiwan, Poland and the Philippines, though Hernandez later stated in a Pro Sound News interview that the overall reduction was only 10 percent of the company’s workforce. Nonetheless, during his five year run, the company also introduced its Avid Everywhere infrastructure which has taken root and helped stabilize the once-shaky company.
According to Morningstar, following the announcement of Hernandez’s termination, Avid stock dropped 1.9% in early morning trading.
Avid • www.avid.com | {
"pile_set_name": "OpenWebText2"
} |
Inferior Turbinate Reduction: Diode LASER or Conventional Partial Turbinectomy?
Hypertrophy of inferior nasal turbinate is one of the most common causes for nasal obstruction (NO). As diode laser has proven to be as effective as any other lasers, our objective was to study various primary outcomes of its use of diode laser like improvement in NO, intraoperative bleeding, postoperative pain, and rapidity of healing. The study was undertaken to compare the various outcomes by diode laser turbinate reduction (LTR) and conventional partial inferior turbinectomy (PIT). A nonrandomized controlled trial was conducted on 2 groups: One group (30 cases) underwent LTR and PIT was performed in the other group (30 cases). The improvement in NO was measured postoperatively up to 6 months. Intraoperative bleeding was measured and postoperative pain scores were assessed each day up to fifth postoperative day. Lastly, rapidity of healing was evaluated until 6 months. Subjective relief of NO was 90.8% in LTR group, whereas it was 65% in PIT group at 6-month follow-up, which was statistically significant (P < .05). Pain scores were higher until 5 days in PIT group compared to LTR group (P = .0001). Intraoperative bleeding mean scores (milliliters) were 8.03 in LTR group compared to 23.29 in PIT group (P = .00001). Rapidity of healing was faster in LTR group with mean scores of 3.03 weeks in comparison to PIT group where it was 6.33 weeks (P = .00001). Compared to the conventional technique, the outcomes were better with diode laser and caused less morbidity. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Login popup like digg or twitter
I am looking for jquery plugin popup like digg or twitter login.
Which jquery plugin can achieve this?
I should be able to add forms and including ajax support.
Thanks
A:
You can use pretty much any modalbox plugin to achieve a similar effect. I like simplemodal because of how easily it can be customized.
| {
"pile_set_name": "StackExchange"
} |
This invention relates to method and device for controlling communication traffic, and particular to managing of communication traffic to networks, which will be occupied for a long time during the communication, such as communication between a telephone set and an internet or the like. It relates also managing of communication between telephone sets connected to the same access network (AN).
The European Telecommunications Standard Institute (ETSI) has produced standards of type V, the V5.1 and V5.2 interfaces (ETS 300 324-1 and ETS 300 347-1), as an interface between two systems, an Access Network (AN) and a Local Exchange (LE), with flexible (provisioned) information channel (bearer channel) allocation. Supported access types in the V5 interface standard are ISDN-BA and PSTN services. ISDN-BA are provided for digital communication and PSTN for speech communication.
An access network is a system which is implemented between the Local Exchange and the user. Several access networks can be connected to the same local Exchange.
An interface within ETSI has been defined to connect Access Networks (AN) to Local Exchanges (LE). Two V5 interfaces have been defined, one for multiplexing and the second for concentration capabilities in the AN controlled by the LE. This invention relates essentially to the V5.2 interface which concentrates the traffic and causes congestion for others when a sufficient number of users change the traffic behaviour from ordinary telephone calls to calls to be digitised and connected to an internet, a management network, an intranet or the like. This is also due for management networks.
The V5 interface standard, as defined in ETSI having the reference ETS 300 347-1 and ITU-T having the reference G.965, has no support for dropping traffic of the kind mentioned above already in the access network.
PCs (PC=Personal Computers) are nowadays often and will in the future automatically be provided with a multimedia interface, such an access to a data network, e.g. a public data network, for instance an internet, i.e. comprising multiple subnetworks communicating with each other. The PC is connected to the telephone net by means of a modem. Telephone communication between the PC and the public data network often takes a long time, which occupies a telephone line during a time essentially exceeding the time of a normal telephone call.
In an earlier system having direct access to a data network, each subscriber could be provided with a unit dividing the calls in telephone traffic and data traffic intended to be sent through different networks. The subscriber had then to have at least two subscriptions, one for the telephone network and one for the data network. A system like that need extra control circuits for the handling of data traffic on to the data network for each subscriber. This is expensive both for the communication company and for the subscriber.
EP-A-0731618 describes a method for controlling communication traffic for sets connected to the same access network, where every call is linked to a local exchange. A protocol is provided in the access network and the local exchange making it possible to connect sets connected to the access network to communicate with each other. The local exchange sends back an allocation signal according to the protocol when the local exchange has identified that a call request has its destiny to the access network which the call request come from, to set up the call inside the access network without having a pathsway set up for the call in question between the access network and the exchange during the communication.
It is important to provide a cheap and functional telecommunication network which always is available to transmit a call from a subscriber. Concentration of traffic is a common method used in transmission networks to reuse transmission lines for several subscribers. This method is well known and is build on Erlang""s model and very useful for ordinary analogue PSTN services (PSTN=Public, Switched Telephone Network). Nowadays, when the network has become overloaded with data service which has a different behaviour than ordinary telephone calls the existing traffic model need be justified. Data service behaviour can have quite short call length but generate more signalling than ordinary calls. Other data services like internet calls or the like have very long call lengths and no or very low signalling. This invention intends to provide a solution of the last-mentioned situation.
The invention provides a simple and inexpensive solution for minimizing the burden imposed on normal telephone traffic by the calls to data services. Data traffic across a telephone line connected to a local exchange in a telephone network will occupy this line for a considerable time period. The data traffic is, for instance, communication between a subscriber and the Internet or an intranet or the like. The invention separates this data traffic out from ordinary telephone traffic to thereby minimize the influence on ordinary telephone traffic.
An object of the invention is to provide a solution on the problem mentioned above.
To make it possible for ordinary telephone calls to be served in the same way as earlier the long time data traffic need be separated out from the V5.2 interface. Thus, the internet traffic should be routed from the calling station to a dedicated device, such as an access server, placed in or in the connection to the same access network as the calling station and connected almost directly to the long time network, such as internet or the like. The access server multiplexes the calls from the users of the access network before transmitting them to the long time network on only one line. Additional functionality could be made in the ordinary BCC protocol (BCC=Bearer Channel Connection) to allow internal call set-up in the access network controlled in the same way from the local exchange as ordinary calls. The intention according to the invention is that the access server should send a series of data packets for all the subscribers connected to the access network directly to the long time data network.
Thus, functionality already existing in the V5.2 interface standard is added to set-up internal connections in the access network to dedicated networks for internet kind of traffic or the like. The same access server could be used for a number of dedicated networks connected to a switch of for instance the ATM-kind connected to the dedicated networks, or an individual access server could be provided for each dedicated network or a mixture of these possibilities could be provided. The access server could be connected and treated by the access network in the same way as anyone of the telephone lines connected to it, i.e. it has the same type of protocol with L3-address etc.
When a subscriber makes a dial in order to connect to an internet or the like a connection is first made from the access network to a local exchange with a V5.2 interface. The BCC-protocol provided with an amendment makes it possible for the access network to provide internal connections between subscribers connected to the same access network. The local exchange identifies the call as a call to the data network and sends back an allocation to the calling set. The access network reacts on this allocation and makes a direct connection between the calling set and the access server. Thereafter the connection between the user and the data network is established without going through the local exchange and the V5.2 interface on bearer channels (B-channels) even though the local exchange still monitors the call through the C-channel for signalling. Thus, the public telephone network will not be loaded by the long time data traffic.
The invention add functionality already existing in the V5.2 interface standard to set-up internal connection in the access network to dedicated networks for data communication with for instance an internet. The invention will not interfere with the ordinary telephone traffic to subscribers outside the actual access network and/or data traffic of other kind than the one in the data network to which the access server(s) are directly connected to. The invention can act together with the AXE-system. | {
"pile_set_name": "USPTO Backgrounds"
} |
Othello Village is on a plot of land behind a gas station, surrounded by a chain-link fence. It consists of 28 wooden huts and 12 tents that flap in a bitter Pacific wind. Residents share a shower, toilet and kitchen tent, with food stored in plastic boxes to keep out the rats.
Until recently the cabins lacked heating or electricity, and the children who live there – currently 11 of its 67 inhabitants – had to use flashlights to read their schoolbooks. This is how Seattle, one of the richest cities in the world, flush with cash from Amazon and Microsoft, houses some of its poorest residents.
Seattle is not alone. Wooden cabins euphemistically referred to as tiny houses are increasingly viewed as a quick and cheap solution to homelessness and, with minimal public debate, they are mushrooming across the country.
The shed-like structures have appeared in vacant lots and scrubland in at least 10 states, from Florida to New York to Utah. But the trend is most apparent in northern California and the Pacific north-west. Some of America’s most liberal cities have in recent years shifted from banning and clearing unauthorized homeless settlements, based in part on the argument they were unfit for habitation, to sanctioning and even funding camps that skirt building regulations thanks to loopholes or special dispensation.
Depending on who you ask, moving homeless people into tiny houses is either a pragmatic means of rescuing them from the street or an alarming shift in urban planning that could pave the way for the creation of shantytowns.
Barbara Poppe, who coordinated federal homelessness policy for most of Barack Obama’s presidency, said she believes the development of slums is a real risk and that some of the ramshackle camps used for homeless people are “completely deplorable”.
“Why would we accept that people should be living in huts that don’t have access to water, electricity and sanitation?” she said, adding that such basic accommodation stigmatizes homeless people.
Poppe now works as a leading homelessness consultant. She was recently hired by Seattle’s mayor, Ed Murray, to review the city’s homelessness strategy . She advised against funding tiny house encampments, arguing the money would be better spent constructing permanent affordable housing. The city is going ahead with them regardless.
“I always challenge the folks on the west coast about this,” Poppe said. “I say, ‘I don’t understand why you find it acceptable for children and infants to live like this.’” The response, Poppe added, is often a blank stare and a stock reply: “We have to do something. This is better than doing nothing.”
Facebook Twitter Pinterest Gregory Kloehn has built some 50 tiny houses and distributed them to homeless people in West Oakland. Photograph: Brian J Reynolds
‘It’s empowering for the people involved’
That’s also the view of residents of Othello, which opened last year.
They say they are grateful for the lockable doors on their cabins, which offer more privacy than city shelters. Shelters are also often at capacity and exclude many homeless people with rules barring couples and pets.
The rules tend to be more flexible in tiny-house and tent encampments, some of which were born of previously unauthorized camps run by homeless people. Othello is self-managed, with rotations for chores such as manning the security gate.
“It’s self-organization, it’s empowering for the people involved,” said Sean Smith, a former cook who moved into his cabin a couple of months ago. “As opposed to feeling crushed under the weight of circumstance.”
It’s empowering for the people involved ... As opposed to feeling crushed under the weight of circumstance Sean Smith
Smith, who was born in Seattle and has spent much of the past three decades homeless, conceded the tiny house was rudimentary. “It’s a wooden tent, that’s what it is, basically,” he said. “Sure, I got structure, I got the ability to lock the door. I would love to see a fully functioning village where each unit is actually a home.”
He added that someone could “get hypothermia in one of these”.
Even so, Smith and others objected last month when the nonprofit that supports the camp raised enough money to connect the huts to electricity, bringing heat and light. They felt the money would be better spent on constructing more tiny houses, because homeless people inquire about vacancies on a daily basis.
The ethics of tiny homes seem more fraught when their youngest inhabitants are taken into account.
On the other side of Seattle, on land owned by the Lutheran Church of the Good Shepherd, there is a cluster of 14 cabins. Their residents include a woman named Rhonda, who became homeless after losing her job as a restaurant manager. She said she was grateful for the shelter but was finding it a cramped place in which to bring up her five-year-old daughter, Brooklyn.
Outside in America: learn more about our ongoing homelessness project Read more
“She’s got a lot of energy,” she said. “There’s just no room. No TV. Nothing to do.” Her daughter would often rather sit in a car, she said, than spend hours inside the one-room cabin.
‘You have to put homeless people somewhere’
Sharon Lee, executive director of Seattle’s Low Income Housing Institute, which manages both settlements, stressed that the cabins are supposed to be temporary accommodation. “We don’t want tiny houses to be a dead end,” she said.
She hit upon the concept after decades navigating restrictive building codes and planning rules that made it impossible to build cheap and quick housing for homeless people; Lee was thrilled to discover “a bit of a loophole” whereby structures smaller than 120-square feet are not recognized as permanent dwellings. Tiny houses costing a mere $2,200 would be exempt from regulations governing residential buildings.
Seattle – which has declared a state of emergency over its homelessness crisis – threw its support behind the initiative, granting special permission for clusters of cabins on public and private land across the city and giving Lee $1.24m to run various sites in 2017. By the end of the year, her organization will have 127 cabins at five locations, providing shelter to more than 310 men, women and children.
The city insists they are only a stopgap solution, and the ultimate goal is to move tiny-house residents into permanent homes. Lee said she has achieved this with 161 people.
But she conceded there was a shortage of places where people could move. Seattle’s lack of affordable housing has contributed to what Lee calls the worst homelessness crisis of her 25-year career. Her own organization owns or manages around 2,000 units of affordable housing and is constantly building more, but it can take three to four years for any one project to come to fruition. The situation may be helped by a huge property-tax levy for low-income housing that was approved by voters last year.
In the meantime, “you have to put homeless people somewhere”, Lee said. “If the shelters can’t take them, where should they be? On the streets?”
You have to put homeless people somewhere. If the shelters can’t take them, where should they be? On the streets? Sharon Lee
This is not the only indication that tiny-house villages may be an enduring presence.
Ten encampments of shed-like structures for homeless people are planned for the end of 2017 in San Jose, in an area where the expansion of technology giants such as Google, Apple and Facebook has contributed to an acute housing shortage and soaring rental costs. It is the most ambitious tiny-house experiment in the country.
Ray Bramson, a manager at the city’s housing department, said the aim is for every occupant of a tiny house to be moved into permanent housing within five years, a goal bolstered by the recent approval of a local ballot measure that will channel hundreds of millions of dollars into affordable homes. In any event, the California legislation that allows San Jose to bypass building and safety rules for its tiny houses expires in 2022.
Yet Bramson conceded that “things could change” and that if the demand persists, the legislation could be renewed. “If these continue to be viable we would absolutely look into whether they could stay longer,” he said.
Andrew Heben, who helped start a tiny-house village in Oregon and has documented their rise in his book, Tent City Urbanism, said that virtually all of them began as temporary encampments that cities only reluctantly agreed to. But he said he was unaware of any that have been shut down.
“Most cities insist on the ‘temporary’ designation even though they know these will be needed into the foreseeable future,” he said.
Facebook Twitter Pinterest Alan describes his tiny home as ‘utter relief ... like reaching the shore after a shipwreck.’ Photograph: Jenny Riffle/The Guardian
A growing movement
The movement is burgeoning. In Los Angeles and Oakland, both cities that have resisted efforts for city-approved communities of tiny houses, activists have been distributing homemade varieties in unsanctioned acts of guerilla philanthropy. An artist named Gregory Kloehn has built some 50 tiny houses and distributed them to homeless people in West Oakland.
But if tiny houses for homeless people are indeed destined to become permanent features of the cityscape, some say they must meet a higher standard. There is added urgency, Heben argues, because the need for them will almost certainly increase under the Trump administration. The Republican president has, for example, proposed cutting billions of dollars from the Department of Housing and Urban Development, which funds affordable housing.
Heben’s second village, which he begins construction on this month, will be a permanent community consisting of 250-square feet structures – small as opposed to tiny – with en-suite bathrooms and even kitchenettes.
They will cost $60,000 per unit rather than $3,300, as at Heben’s inaugural project, yet they will still only be a third of the price of conventional affordable housing in Eugene.
These sorts of comparatively comfortable tiny homes already exist at Quixote village in Olympia, the state capital of Washington. Some view it as the gold-standard for tiny house communities. Ten of the original 30 residents who moved in three years ago have stayed, and some have signaled they want to remain for good. Quixote “is almost the pinnacle of their aspirations”, said Alan, 66, a resident for two years.
Showers and shared kitchen facilities are in a warm, permanent building, rather than the canvas tents used sixty miles away in Seattle. Every tiny house has a porch and a bathroom. As an equal proportion of the development’s total price tag, each house costs $88,000; on an individual basis they are $19,000 per unit.
Alan said that he and his ex-wife, both nurses, once had a combined income of $100,000 and a 32ft sailboat. But their divorce tipped him into a downward spiral, and he spent more than a decade living in a homemade shack, on the streets, and in a Salvation Army shelter.
He recalled the feeling when he first moved into his tiny home in Quixote just over two years ago. “The ability to go in the cabin, close the door, lie on the bed – utter relief,” he said. “Like reaching the shore after a shipwreck.”
Alan reads for as many as 18 hours a day – “it is probably the most extreme, intense, escapism,” he said - and there are New Yorker covers decorating the walls of his cabin and books stacked in every corner. On the windowsill is a book that documents how shantytowns appeared across Seattle during the Great Depression.
Might tiny houses for homeless people also be described as shanties?
“That’s a viewpoint taken from high above,” he said. “To the people out there on streets, living in cardboard boxes in alleyways, this represents the promised land.” | {
"pile_set_name": "OpenWebText2"
} |
Latent microvolt T-wave alternans in survivors of unexplained cardiac arrest unmasked by epinephrine challenge.
The arrhythmogenic substrate in survivors of unexplained cardiac arrest (UCA) has not been defined. To test the hypothesis that patients with UCA have latent repolarization abnormalities, in particular T-wave alternans (TWA), which may be unmasked with epinephrine (EPI) challenge. We prospectively studied 10 UCA survivors (46 ± 9 years) and 11 first-degree relatives (FDRs) of sudden death victims (37 ± 14 years). Patients with UCA underwent standard clinical testing, which was normal. FDRs had normal clinical history and testing. All subjects underwent an EPI infusion (0.05, 0.1, and 0.2 μg/(kg·min), 5 minutes each dose) while recording continuous digital 12-lead electrocardiograms. Corrected QT interval and QT variability index were evaluated at each EPI dose. TWA magnitude (V(alt)) was assessed at each dose by using the spectral method. Positive (+) TWA at each dose was defined as V(alt) > 0 with k ≥ 3 in 1 or more 128-beat segment in ≥2 electrocardiogram leads. A novel metric, TWA burden, reflecting V(alt) integrated over time (s), was also evaluated for each EPI dose. There was no difference between UCA survivors and FDRs with respect to heart rate, QT, corrected QT interval, or QT variability index at baseline or during EPI. At baseline, +TWA was similar between UCA survivors and FDRs (10% vs 0%; P = NS). During EPI, +TWA was more prevalent in UCA survivors than in FDRs (80% vs 18%; P = .009). TWA burden was greater in UCA survivors than in FDRs during EPI 0.1 (P = .039) and EPI 0.2 μg/(kg·min) (P = .009). UCA survivors are more likely to demonstrate latent TWA compared with FDRs, which becomes manifest with EPI. This novel finding provides evidence for an arrhythmogenic substrate in UCA survivors. | {
"pile_set_name": "PubMed Abstracts"
} |
Emerging noninvasive biomarkers for early detection of Alzheimer's disease.
Alzheimer's disease (AD) diagnosis still depends on the triad of clinical, imaging and neuropsychological testing. The development of accurate, easy to use and inexpensive biological markers for AD is a long-standing aspiration for researchers and the medical community. Here we describe some of the recent advances in the field of biomarkers, both in cerebrospinal fluid (CSF) and in peripheral blood. | {
"pile_set_name": "PubMed Abstracts"
} |
[A new method of evaluation of split renal function based on contrast-enhanced multislice spiral computed tomography].
Traditionally, evaluation of the split renal function is performed using nephroscintigraphy. However, as shown in several studies, there might be quite significant inaccuracy in the interpretation of dynamic nephroscintigraphy results. But due to the lack of alternative methods for evaluation of split renal function, nephroscintigraphy remains the method of choice. To investigate the feasibility of digital analysis of contrast-enhanced MSCT imaging for evaluation of the split renal function. This is a prospective study conducted at the R.M. Fronshteyn Clinic of Urology from November 2015 to February 2017. The study comprised 31 patients with urolithiasis (n=7), hydronephrosis (n=9), kidney cancer (n=14) and urinary bladder tumor (n=1). During the preoperative period, the patients underwent contrast-enhanced MSCT, 3D-reconstruction, and digital analysis. The obtained data were compared with the results of dynamic nephroscintigraphy. Contrast-enhanced MSCT findings were not inferior to data obtained with dynamic nephroscintigraphy regarding information content (p<0.004). The new method of digital processing of three-dimensional contrast-enhanced MSCT allows for concomitant assessment of both the anatomical features of the kidney and renal function that may help to improve the accuracy of surgical planning to choose the optimal extension of the intervention. | {
"pile_set_name": "PubMed Abstracts"
} |
Ryan Jones has kept his Wales place despite losing the captaincy for Saturday's Test against New Zealand.
Jones captained Wales in their shambolic 16-16 draw with Fiji last week, conceding an injury-time penalty that cost his team victory and was then told by the head coach Warren Gatland that Matthew Rees would reclaim leadership duties against the All Blacks.
Jones described it as "the worst 20 minutes" of his rugby career, but Gatland – who faced a chorus of criticism from those who felt he had made Jones a scapegoat – has retained the 29-year-old.
He moves from blindside flanker to No8, with Dan Lydiate wearing the No6 shirt and the fit-again Sam Warburton preferred to his Cardiff Blues colleague Martyn Williams at openside.
Both Warburton and the prop Gethin Jenkins have recovered from calf muscle injuries that ruled them out of the South Africa and Fiji games earlier this month, while there is a surprise recall for the powerful Blues wing Tom James.
James, who was not included in Gatland's original autumn Test squad, is parachuted straight into the team after being preferred to Aled Brew, Chris Czekaj, Will Harries and Tom Prydie to replace Shane Williams who has a dislocated shoulder.
James, 23, has not played for Wales since last season's Six Nations defeat against England at Twickenham. He stormed out of training – and the squad – after being criticised by Gatland.
There are nine changes and two back-row positional switches from the Fiji match, with returning players including Tom Shanklin, Stephen Jones, Mike Phillips, Bradley Davies, Alun Wyn Jones and Rees, who captained Wales in recent weeks against Australia and South Africa.
Both Thomas and Martyn Williams are on the bench, where Gatland has opted for five forwards and just two backs in Richie Rees and Andrew Bishop.
Gatland said: "Sam Warburton gets his chance to start, and Ryan Jones, having not played a lot of rugby this season, has a chance to play at No8. But we are also conscious that we have a strong bench to call on to come on and make an impact in that area.
"Gethin Jenkins is back in the front row, Matthew Rees also returns, and with Adam Jones in the best shape I've seen him, we know we are strong there.
"Tom James was injured when we named the squad at the start of the series, but he did well for the Blues last weekend in their game against Ulster. He has genuine pace, and that along with size and physicality and some experience at this level is what we are going to need against New Zealand." | {
"pile_set_name": "Pile-CC"
} |
Video: In the Studio with Deanna Bowen
For almost a decade, Toronto artist Deanna Bowen has been excavating her family’s genealogy—who they were and how generations of them have experienced anti-Blackness in 20th-century Canada.
“It’s been a long, long journey of unpacking Blackness in Canada, the problem being that it’s such a complex, ultimately violent story that I’m talking about,” Bowen says. “So how do you frame it properly?”
To understand how her family history positions her in Canada today, Bowen’s deep historical research ranges from community and institutional archives, first-person conversations and forgotten photographs to newspaper clippings and television recordings. She uses whatever medium can best tell the stories she uncovers: shot-for-shot remakes in video and performance, documentary photography, text-based reproductions, and a theatrical production for a fall 2017 solo exhibition at Mercer Union.
In this studio-visit video, Bowen shares key works that have resulted from this intensive research, including aspects of Invisible Empires—a project that reproduced and re-presented white-supremacist artifacts in a gallery setting. | {
"pile_set_name": "Pile-CC"
} |
Compare and Contrast Eastern and Abrahamic Religions * Abrahamic religions are dualistic: they believe in two kinds of reality- the material and nonmaterial. On the other hand, the Eastern religions believe mostly in one kind of reality. * In the Eastern religions, sentient beings have value because any of them could be reincarnated souls. But in Abrahamic religions, a clear distinction is made between humans and the rest of the world. It is humanity that it at the center of creation. * In Abrahamic religions, all things were created by God, and it is God who will someday end things as they are. However, Eastern religions mostly believe that the universe is non-created and is eternal. * The principle of Karma is what the Eastern religions use to explain many of the bad things that happen in life. Things are the way they are because how one lived in a previous life. The Abrahamic religions, on the other hand, explain the bad things that happen in life in terms of reaping and sowing, and the original sin of Adam and Eve. * In the Abrahamic religions, there is the belief that a person gets only one life to live right, and then he or she can attain a reward at the end of life. So sin is taken very seriously. The religions of the East teach that one gets many life times to make things right. There is always a chance for liberation. So sin is not taken as seriously as in the Abrahamic religions- though they all fear building up bad Karma. * In the Eastern religions, it mostly through enlightenment that humans become better. Knowledge is paramount; looking within is the key. However, the Abrahamic religions emphasize enlightenment through getting closer to God. Reading his word and obeying him all contribute to a true kind of enlightenment and eternal rewards at the end of this life. * Eastern religions teach the concept of Dharma- which a personal duty of all humans. Dharma is also considered to be the basic principles of the cosmos. But, again,...
YOU MAY ALSO FIND THESE DOCUMENTS HELPFUL
...technology, there was religion. This was part of the pre-modern times. Depending upon what part of the world you are from depends on what type of religion you are likely to encounter. This also determines the likelihood of what religion you may have grown up with. Your religion and your background helps in determining what values you may have. These believe and values vary in different religions. Some may learn some parts of these religions from movies or hearsay. Sometimes as we get older it is hard to determine what we believe as we do.
Before 500 BC there were three western religions. They started very similar in the pre-modern times. When you look into the religion of Islam, the studies not only consist of the Qur'an but also the Bible. There are similarities as well as differences amongst these two religions. Many with the Muslims community that have converted from a Christian background before turning to Islam as their spiritual guidance. There are many comparisons as well as differences amongst these two religions.
Judaism, one of the western religions compares closely with the religions of Christianity and Islam. The bible is used in the religious studies although preferred in the original Hebrew text. Amongst these three western religions come relationships that will have learners...
...The "Soul" According to Eastern & Western Religions
The idea of the soul varies widely in religious tradition. While these variations exist, its basic definition is unvarying. The soul can be described as the ultimate internal principle by which we think, feel, and will, and by which our bodies are animated. The soul is seen as the core principle of life or as the essence of a being 1. Views on the permanence of the soul vary throughout religious tradition as well. While some view it as a mortal entity in flux others believe the soul is an immortal and permanent unit. These interpretations vary from time period to time period and between religions. These characteristics of the soul are interpreted differently through an Eastern or Western perspective. In general, Eastern and Western Religions, with the exception of Buddhism, consider the soul to be a permanent entity, which is either reborn or sentenced to a permanent heaven or hell.
Christianity views the soul as the permanent entity within oneself, which is judged by God. The purity of one's soul decides whether it passes to heaven or hell. Christianity shares this basic belief with both Islam and Judaism which also say heaven or hell is the final resting place of the soul. The Easternreligion, Hinduism, preaches that Atman, or permanent soul, is in every being and is the embodiment of the...
...Western and EasternReligion Comparison
Islam and Buddhism are two distinct religious traditions that provide their own
meaningful responses to the fundamental questions about life. Their views on
issues relating to the possibility of a Supreme Being, the purpose of life and
their understanding of the cycle of life and death are all quite distinct from
each other, but at the same time, having minor similarities. These can be seen
in the following comparative study between the teachings of these two world
religions. Is there a Supreme Being? What is the nature of the divine? All
Muslims profess the existence of the One and Only God, God Almighty who is also
referred to as 'Allah'. They firmly believe that Allah is the most high and
honored, the creator and the sustainer of all that exists and he has no physical
connections between any thing he has created whether it be the creatures or
human beings on this earth. He has no beginning and no end. Allah has no
physical dimensions like hunger, sleep or rest for he is the one who gives such
attributes to his creatures. Buddhism on the other hand, recognises no creator
god who initially brought the universe into existence and continues to control
it in the way that Allah controls everything that is or happens in the universe
from the smallest to the greatest events. The founder of Buddhism, who is known
as Buddha, did not want to be worshipped as a god. He taught that...
...Religion is the one element of life that has connected the races and societies of the world for hundreds of years. It has given meaning to lives that may seem otherwise hopeless. Out of the 5 religions I have looked at, I think 3 of the religions are the most alike. Christianity, Judaism and Islam are all very closely unified as Abrahamicreligions because they share tons of common beliefs and thoughts. My investigation is on some of the similarities and differences of these three religions. All three religions believe in one God and the same God, the God of Abraham. So how do they differ?
The Abrahamic faiths are strictly monotheistic. Even though Christians believe the Holy Triune (God as the Father, the Son and the Hoy Spirit.) they still consider God as one. Despite the many similarities between the Abrahamic faiths, there are some differences. For instance, Judaism denies that Jesus was a prophet while Christians and Islam acknowledge Jesus as a prophet. Also, the three religions all have their own special worship days. The Muslims worship on Fridays, the Jews have their worship on Saturdays and the Christian one is on Sundays.
The Jews, the Muslims and the Christians all worship in different places and have different religious texts. The Jews worship in a place called the synagogue. In some synagogues, men and women have...
...The differences and similarities between the Eastern, Buddhism and Hinduism, and the Western, Christanity and Judiasm, religious traditions had a cultural impact on the society during 1000 B.CE. to 600 C.E.
The Easternreligions each had their own cultural impact on society. Hinduism reinforced the caste system, offering hope for an improved lifestyle. Hinduism also started the path of recarnation, the other eastern rileigion, Buddhism, also shared the concept of recarnation with Hinduism, but in a differnet perspective. One of the reasons of popularity of Buddhism was its acceptance of men and women from all ranks of society.
The Western religions also impacted society in there own way. Judaism was a monotheism religion which led the path for Christrianity. One of the reasons Christrianity became so popular, was because of its appeal to all social classes,especially the poor.
The differences between the Eastern and Western religions are that the Eastern religious believe in recarnation. Hinduism beleive that if you do good in your current life, you will have good karma and when you are reincarnated you will move up in the caste system. Buddhism has a similar concept, they believe that a seris of reincarnation would lead a faithful follower to higher levels toward the ultimate goal, nirvana, or a divine essence. The Western...
...Hinduism and AbrahamicReligions
The Comparison of
Hinduism and AbrahamicReligions
By Christa Dunwoody
Abstract
The differences between Hinduism and AbrahamicReligions are many. The primary difference of beliefs is that AbrahamicReligion believes that there is one God. Hinduism beliefs vary being Pantheistic, monotheistic and polytheistic it is one of the most complex religions of the world. In the comparison of Hinduism and AbrahamicReligion differ on their concept of God. Along with their differences on the concept of God the Hindu’s and AbrahamicReligions also differ on their concept of man’s destiny. Finally Hindu’s and AbrahamicReligions also differ on their concept of Salvation.
The Comparison of Hinduism and AbrahamicReligionsComparing the main doctrines of Hinduism to the teachings of the Abrahamicreligions I learned there are vast differences. The term Hinduism refers to the religious and social institutions of India. Concerned mainly with the religious aspects, but the religious and social are both tied together and are referred to by the term Hindu. Considering past and present beliefs and practices of Hinduism there is much variation in Hinduism as in...
...Christianity, Judaism, and Islam are all very closely unified as Abrahamicreligions because they share a multitude of common beliefs and thoughts. Hinduism, on the other hand is almost complete opposite of these religions. The extreme differences within these religions has seemed to cause problems between them throughout history. Hinduism is considered to be an Easternreligion while Judaism, Christianity, and Islam are considered Western. (Lafave,2004.)Location, leaders, religious practices, and political issues are just a few aspects that bring them to differentiating opinions.
The Abrahamicreligions have many shared ideas and thoughts in relation to life and the driving force of the universe. Jews ,Christians, & Muslims all agree upon the notion that there is only one creator of all of humanity. They are all monotheistic religions and they rely on holy scriptures as a life guided tool. The Christians use the Holy Bible, Islams refer to the Qu’ran, while Jews refer mostly to the Torah. All believe that the human body is only a temporary state and that if the soul is a deemed a good one by following God’s plan then it goes on to live eternally in heaven with Jesus or the equivalent. If the soul judged by God is unworthy, then it must live in hell with the devil. Jews, Muslims, and Christians alike all believe in a coming of the Messiah,...
...East Asian religions, also known as Taoist religions, refer to the religions and philosophies that are dominant in the Chinese, Korean, Japanese, and Vietnamese regions and any other places near them. Taoism is the root of all these religions, teaching that nature is the greatest teacher and that everything has a flow and a way. Confucianism teaches that without education and social order there can be no religion, and the act of learning is the religious experience. Buddhism taught that craving, jealously, and gluttony will only bring chaos and that good deeds will bring a good life and a good next life. China, 500 B.C.E, was quite advanced for the time, but although very advanced, war tore through the country, ruining social structure and the feudal system. During this time chaos was sweeping through the whole county when K'ung-fu-tzu or Confucianism was born. Confucius was raised in a poverty and war-stricken China. Through seeing the corrupt nature of the rich and powerful and living through challenging times, he pledged to teach peace, wisdom and social structure. Through his sadness as a child and adolescence he grew wiser and more determined. He believed that education was the building block of a good society and people would become better through learning. He went... | {
"pile_set_name": "Pile-CC"
} |
The patellofemoral joint and its implications in the rehabilitation of the knee.
The normal mechanics of patellar motion lead to an eventual age-dependent degeneration of the patellofemoral joint in the majority of persons. This review explores the relationships between normal patellar mechanics, patellofemoral joint disease, and findings of quadriceps femoris muscle-function studies. Implications of these relationships are then discussed with regard to the rehabilitation of all patients. | {
"pile_set_name": "PubMed Abstracts"
} |
Premalignant variations in extracellular matrix composition in chemically induced hepatocellular carcinoma in rats.
Chemical composition of extracellular matrix (ECM) plays a pivotal role in cellular and tissue development, regeneration, and differentiation. It also plays a key role in pathogenesis of hepatocellular carcinoma (HCC). This study explored premalignant changes in the liver tissue content of collagen (as hydroxyproline, HP), total glycosaminoglycans (TGAGs), free glucosamine (FGA), total sialic acid (TSA), lysosomal membrane integrity variations (calculated as total and free cathepsin D activities), and liver histology. Serum alfa-fetoprotein (AFP) level was used as an early marker for HCC in two groups of Wistar rats. One group of rats served as control and was provided normal saline orally. The other group was provided trichloroacetic acid (TCA) as 0.5 g/kg/day for five consecutive days by oral gavage. Animals were killed before tumor development. The treatment revealed dysplastic changes in addition to microsteatosis (fatty changes). Both sinusoids and the portal vein among dysplastic cells were dilated and congested. These dysplastic foci are believed to be premalignant and may be precancerous lesions. The following things were observed: a highly significant increase in serum AFP (as a key marker for HCC), a significant decrease in HP and TSA, a significant increase in FGA, nonsignificant decrease in TGAGs, significant up-regulation of free cathepsin D, nonsignificant decrease in total cathepsin D activities, and destabilization of lysosomal membrane integrity. Down-regulation of HP, TSA, and TGAGs seems to be a prerequisite for cancer development. This might be stimulated by up-regulation of free cathepsin D activity. Perhaps tissue fibrosis is not a condition for developing HCC because collagen was significantly depressed. Up-regulated FGA could be assumed to be a defense mechanism against TCA-induced proteolysis of membrane proteins because it is frequently reported to be of value in cancer chemotherapy. Studied ECM perturbations can be assumed as preliminary changes during chemical hepatocarcinogenesis at the tissue level. Prospective studies on blood levels of cathepsins, TGAGs, and individual ECM variables such as TSA, FGA, and Hp in patients at risk for HCC, performed in parallel with assessments of AFP, may provide a cost-effective way to find new links between tissue changes and circulation that would permit early prediction of disease. It may also provide a way to monitor HCC and compensate for the missed peak AFP values. | {
"pile_set_name": "PubMed Abstracts"
} |
Red T offers you the opportunity to select from our image bank or create your own bespoke art work from the originals in our collection by selecting an area of the work you particularly like and using that as the image you choose make into a print.
This gives you the easy ability to create a unique series of works across a hotel lobby, in hotel rooms, throughout your offices or serviced apartments; the options are plentiful and flexible to fit with your requirements.
We have pre selected a collection of options from each original for you. You can either order from these in a range of standard sizes to have a speedy solution or, if you don’t see what you want, we offer bespoke sizing, cropping and even colour alterations to suit your needs.
Each original work is only available to be reprinted in any manipulation a total of 100 times before we archive the original back into our collection and it is no longer available, thus reassuring you that you won’t see similar works flooding the market.
Multiples work with some of China’s most exciting artists to provide our clients with bespoke print options for their home, office or commercial project. We offer stunning art work at scale, quantity and to your individual specifications.
After years working with many great artists, it became clear that a major area where their original practice is compromised is in commercial projects. Prices for original works negotiated right down and scale increased. This coupled with an increase in demand for commercial work through development across Asia gave us the idea for Red T Multiples.
We work with artists to ensure their original works can retain value and not be compromised as we can offer clients what they need through our Multiples service.
We buy original works from artists we know and love, having already gained their consent to manipulate just these works in order to create up to 100 prints. And then we stop. This way our artists know their work is still getting into the hands of people who want it, but that everyone wins on price, scale and quantity. The artists don’t need to lower their prices or change their practice in order to get a sale and the client can get volume to any scale, quickly for cheaper.
For every sale to you, our artists also benefit through our royalty scheme.
Click to view Multiples. Be informed Multiples is a business to business service. If you’d like to purchase as an individual, please click the Private tab and we would be delighted to put you in touch with one of our lovely retail partners. | {
"pile_set_name": "Pile-CC"
} |
Radiology: closing a century, opening a millennium.
As we close the file on the first century of radiology, we honor the pioneers and reflect on the progress they started. We also open a new file, not just a new century, but a new millennium of opportunity. The dramatic technologic advances in diagnostic imaging within recent decades have provided the foundation for expanding our activities in Oral and Maxillofacial Radiology. We are no longer just dental radiology; we can no longer rest on the teaching and practice of conventional dental radiography. We can summarize in one word the direction our efforts must take in opening the millennium: research. Only with research at the fundamental as well as clinical level we can continue to expand our service to the public, to our patients, and to our colleagues. | {
"pile_set_name": "PubMed Abstracts"
} |
The hidden risks and subtleties of capitation or, what you were never told when you agreed to accept capitated risk.
For your physician practice to be successful under a capitated contract, you must understand the subtleties of the arrangement that can impact the practice's level of risk exposure. This means you must know the key questions to ask when negotiating the contract and capitation amount, as well as what should be monitored to ensure the contract is implemented correctly. How the capitated rate is calculated and whether or not it appropriately covers the risk of each benefit plan the practice will be servicing will determine the financial viability of the contractual agreement. In addition, after the contract becomes effective, you should make sure that the practice is providing and billing for services consistent with its contractual obligations, and that the reimbursement received is correct based on the practice's membership mix. | {
"pile_set_name": "PubMed Abstracts"
} |
This application relates to German Application DE 109 44 325.0, filed Sep. 28, 1998, which disclosure is incorporated herein by reference.
The invention relates to a method of producing alcohols by catalytic hydrogenation of aldehydes or ketones using an Ru carrier catalyst. The catalyst to be used in accordance with the invention is deactivated to a rather slight extent and therefore has a higher service life than Ru carrier catalysts previously used for this purpose.
The conversion of aldehydes and ketones into the corresponding alcohols by catalytic hydrogenation is known. Nickel carrier catalysts or Raney nickel are frequently used as catalysts for the hydrogenation of aldehydes and ketones. A disadvantage of such catalysts is the Ni leaching, during which Ni passes in dissolved form into the liquid reaction medium. This renders the workup of the reaction mixture difficult and the leached-out Ni must be removed, e.g., burned, with other byproducts, leaving carcinogenic NiO.
In order to avoid the problems cited, carrier-bound noble-metal catalysts, especially Ru catalysts, have been used. B. J. Arena (Applied Catalysis A 87 (1992) 219-229) teaches the use of Ru catalysts on aluminum oxide for the hydrogenation of glucose to sorbitol. A disadvantage of this catalyst is the short effective service life caused by deactivation. During the deactivation of Ruxe2x80x94Al2O3 not only deactivating components such as iron, sulfur and gluconic acid are deposited on the catalyst but at the same time the properties of the Ru carrier and of the Al2O3 carrier change, which manifest themselves in, among other things, an agglomeration of the Ru and a reduction of the BET surface of the Al2O3. In order to reduce the deactivation, additional purification measures of the feed materials and/or frequent regeneration of the catalyst are necessary, which renders the method more complicated and/or less economical.
According to xe2x80x9cCarbohydrates as Organic Raw Materials IIIxe2x80x9d, ed. by H. van Bekkum et al. (1996) 52-54 sorbitol can be obtained from polysaccharides such as starch, during which the hydrolysis of the polysaccharide and the hydrogenation of the released glucose take place at the same time by hydrogenation in the presence of an Ru carrier catalyst with H-USY zeolite as carrier. The carrier acts as acid catalyst. According to this document similar results are achieved if a combination of 5% Ru on activated carbon as hydrogenation catalyst and zeolite-ZSM 5 as acid catalyst is used. No indications about the effective service life of the catalyst can be gathered from this document.
According to U.S. Pat. No. 4,933,473 hydroxypivalaldehyde or its dimer can be converted by catalytic hydrogenation into neopentylglycol. A combination of platinum, ruthenium and tungsten in a certain amount ratio serves as catalyst. This catalytically active metal combination can also be used on a carrier from the series of SiO2, Al2O3, MgO, TiO2, ZrO2, zeolites, carbon, silicon carbide and diatomaceous earth. The selectivity is the highest when Pt/Ru/W-activated carbon is used and drops off sharply in the series Al2O3, SiO2, TiO2 as carrier. Neither the examples nor reference examples concern the use of a catalyst on the basis of Ru as the sole noble metal on an oxide carrier.
As was determined by the inventors of this application, the conversion and selectivity and especially the catalytic service life are insufficient in many instances when using Ru activated carbon in the generic hydrogenation. Reference has already been made to the problems which result when Ruxe2x80x94Al2O3 is used.
Accordingly, the present invention solves the problem by making available an improved method for the catalytic hydrogenation of aldehydes and ketones to the corresponding alcohols. The improvement is directed to the raising of the service life of the carrier-bound Ru catalyst to be used.
A method of producing an alcohol by the catalytic hydrogenation of the corresponding aldehyde, except 3-hydroxypropionaldehyde, or ketone in aqueous or organic solution at a temperature of 20xc2x0 to 200xc2x0 C. and an H2 pressure of 0.5 to 30 MPa using a carrier-bound ruthenium catalyst was found which is characterized in that ruthenium on an oxide carrier selected from the group TiO2, SiO2, ZrO2, MgO, mixed oxides thereof and silicates thereof, except zeolites, with a ruthenium content of 0.1 to 20% by weight is used as catalyst.
The advantageous use of a ruthenium catalyst with the oxide carrier materials has already been recognized in the method of producing 1,3-propane diol from 3-hydroxypropionaldehyde according to the not yet published DE patent application 197 37 190.6. However, the use of these catalysts is not limited, as has now been found, to the hydrogenation of 3-hydroxypropionaldehyde. The disclosure of DE patent application 197 37 190.6 is therefore incorporated by reference to its full extent in the disclosure of the present application.
Ruthenium catalysts on oxide carriers to be used in accordance with the invention are described, e.g., in xe2x80x9cCatalyst Supports and Supported Catalystsxe2x80x9d by Alvin B. Stiles, Butterworth 1987, chapters 2 and 3. The coating of the oxide carrier can take place especially advantageously by means of the xe2x80x9cincipient wetness method xe2x80x9dxe2x80x94see xe2x80x9cPreparation of Catalystxe2x80x9d ed. By B. Delmon, P. A. Jacobs, G. Poncald, Amsterdam Elsevier 1976, page 13.
The water absorption capacity of the carrier is determined for this. Thereafter, an aqueous ruthenium chloride solution with a concentration corresponding to the ruthenium coating to be formed is produced. The carrier is charged with aqueous ruthenium chloride in accordance with the water absorption capacity. The charged carrier is subsequently dried, preferably at 20xc2x0 to 100xc2x0 C., at normal pressure in an atmosphere of inert gas such as neon, helium, argon or air, reduced with hydrogen at a temperature of preferably 100xc2x0 to 500xc2x0 C. for 20 min to 24 hrs using a gaseous mixture of H2/N2 containing 1 to 100% by volume hydrogen, and washed free of chlorine, if necessary, preferably to a chlorine content of less than 100 ppm Clxe2x88x92.
According to a preferred embodiment the carrier is based on titanium dioxide or silicon dioxide. A pyrogenically produced TiO2, especially a TiO2 produced by flame hydrolysis, is preferably used as the carrier.
For example, a pyrogenic titanium dioxide obtained by flame hydrolysis from titanium tetrachloride with a BET surface of 40 to 60 m2/g and a total pore volume of 0.25 to 0.75 ml/g can be used as the carrier. This carrier may have an average size of the primary particles of 20 nm, a density of 3.7 g/cm3 and an X-ray structure of 20 to 40% rutile and 80 to 60% anatase and with impurities of silicon dioxide, aluminum oxide and iron oxide that are below 0.5% by weight. Pyrogenic titanium oxide-like material, for example, P25 produced by Degussa-Hxc3xcls AG, is especially suitable as a carrier for the catalytically active component. This carrier has a high specific surface with a BET of on the average 50 m2/g (measured according to DIN 66131).
The Ru coating of the carrier is in a range of 0.1 to 20% by weight, preferably 0.5 to 10% by weight and especially preferably 1 to 5% by weight.
The hydrogenation can be carried out in a customary manner, either discontinuously or continuously. The catalyst can be suspended thereby in the liquid reaction medium. Alternatively, the catalyst is used in the form of molded bodies such as pellets, granulates, spheres, extruded blanks and arranged in a reactor as a fixed bed. This fixed-bed reactor can be operated in a flooded state as a bubble reactor but is preferably operated as a trickle-bed reactor.
One skilled in the art will adapt the conditions of pressure and temperature to the substrate to be hydrogenated. It is an advantage of the catalysts to be used in accordance with the invention that their high activity makes mild reaction conditions possible in general, such as 20xc2x0 to 100xc2x0 C. and 1 to 10 MPa, especially 2 to 5 MPa H2 pressure.
The aldehydes and ketones to be hydrogenated can have any structure, such as, aliphatic, aromatic, heteroaromatic, aliphatic-aromatic or aliphatic-heteroaromatic. They can also contain other functional groups, and it should be determined beforehand whether these functional groups should remain unchanged or should be hydrogenated themselves. According to a preferred embodiment, carbohydrates and other carbonyl compounds containing one or more hydroxyl groups are converted into polyols.
The aldehyde or ketone substrate can be hydrogenated per se, if it is liquid, or can be hydrogenated dissolved in a solvent. Solvents can be organic or aqueous or represent mixtures. Water is especially preferred as a solvent, to which organic solutizers can be added as needed.
It is known that acetals and ketals can be produced in the reduction of aldehydes and ketones. In order to split these byproducts in situ and convert them completely into the desired alcohol it is purposeful to carry out the hydrogenation in the presence of an acidic catalyst. This acidic catalyst can be dissolvedxe2x80x94e.g., in the case of a mineral acidxe2x80x94or be present undissolved as solid acid. At an elevated reaction temperature the preferred carriers, SiO2 and TiO2, act themselves as acids.
The ruthenium catalysts bound to oxide carriers in accordance with the invention have a surprisingly long service life since they deactivate much more slowly than previously used, carrier-bound Ru catalysts. This improves the economy of the method since the activity remains preserved for a long time and non-productivity time periods for catalytic regeneration are minimized. The space-time yield is thus increased.
The following examples and reference examples illustrate the invention.
The catalysts were tested under stationary conditions in order to also be able to determine the long-term behavior. The hydrogenation was carried out continuously in a trickle-bed system with 140 ml reactor volume. The system comprised a liquid receiver, the reactor and a liquid separator. The reaction temperature was adjusted via a heat-carrier circuit. Pressure and hydrogen current were regulated electronically. The aqueous solution of the substrate (aldehyde or ketone) was charged to the hydrogen current with a pump and the mixture put onto the head of the reactor (trickle-bed method of operation). After having passed through the reactor the product formed was removed at regular intervals from the separator. The concentration of the aldehyde or ketone in the educt solution, the temperature, H2 pressure and the liquid charging LHSV 1 hxe2x88x921 can be gathered from the following examples. The results of the tests are collated in tables 1 and 2. | {
"pile_set_name": "USPTO Backgrounds"
} |
La philosophie est bien plus qu'une discipline. Son but est de transformer la connaissance en art de vivre en considérant comme digne d'intérêt et de réflexion l'existence dans tous ses recoins.
La philosophie est bien plus qu'une discipline. Son but est de transformer la connaissance en art de vivre en considérant comme digne d'intérêt et de réflexion l'existence dans tous ses recoins. Littérature, vie quotidienne, cinéma, musique, actualité, expérience personnelle : la philosophie ne connait ni contraintes, ni limites. Elle vise à transmettre le goût pour les questions plus qu'à délivrer une connaissance. C'est pourquoi elle ne s'arrête jamais, c'est pourquoi, plus que jamais, les Chemins continuent.
Et tous les vendredis, Adèle Van Reeth donne la parole à ceux qui réconcilient philosophie et actualité. Tables rondes autour des nouvelles parutions, analyses d'enjeux politiques, masterclass avec un philosophe au parcours singulier, et réflexion philosophique à partir d'un film ou d'un roman contemporain. | {
"pile_set_name": "OpenWebText2"
} |
Gov. Rick Scott said Thursday that his administration won't appeal a federal court ruling that the state illegally tried to purge the voter rolls of suspected noncitizens too close to the 2012 presidential election.
The announcement was a victory for the League of Women Voters and other voter advocacy organizations that accused Scott of seeking to disenfranchise minority voters who likely were inclined to support President Barack Obama.
"Our goal continues to be 100 percent participation by eligible voters and zero percent fraud," Scott's office said in a news release. "Florida voters deserve an election system they can be proud of."
A three-judge panel of the 11th U.S. Circuit Court of Appeals in Atlanta ruled last April that the Scott-controlled elections apparatus in the Florida Department of State sought to identify and remove noncitizens from the voter rolls in advance of the 2012 election. Federal law bars states from "systematic" removals of voters less than 90 days before a federal primary or general election. | {
"pile_set_name": "OpenWebText2"
} |
Post-Impressionism
Post-Impressionism (also spelled Postimpressionism) is a predominantly French art movement that developed roughly between 1886 and 1905, from the last Impressionist exhibition to the birth of Fauvism. Post-Impressionism emerged as a reaction against Impressionists' concern for the naturalistic depiction of light and colour. Due to its broad emphasis on abstract qualities or symbolic content, Post-Impressionism encompasses Les Nabis Neo-Impressionism, Symbolism, Cloisonnism, Pont-Aven School, and Synthetism, along with some later Impressionists' work. The movement was led by Paul Cézanne (known as father of Post-impressionism), Paul Gauguin, Vincent van Gogh, and Georges Seurat.
The term Post-Impressionism was first used by art critic Roger Fry in 1906. Critic Frank Rutter in a review of the Salon d'Automne published in Art News, 15 October 1910, described Othon Friesz as a "post-impressionist leader"; there was also an advert for the show The Post-Impressionists of France. Three weeks later, Roger Fry used the term again when he organized the 1910 exhibition, Manet and the Post-Impressionists, defining it as the development of French art since Manet.
Post-Impressionists extended Impressionism while rejecting its limitations: they continued using vivid colours, often thick application of paint, and real-life subject matter, but were more inclined to emphasize geometric forms, distort form for expressive effect, and use unnatural or arbitrary colour.
Overview
The Post-Impressionists were dissatisfied with what they felt was the triviality of subject matter and the loss of structure in Impressionist paintings, though they did not agree on the way forward. Georges Seurat and his followers concerned themselves with Pointillism, the systematic use of tiny dots of colour. Paul Cézanne set out to restore a sense of order and structure to painting, to "make of Impressionism something solid and durable, like the art of the museums". He achieved this by reducing objects to their basic shapes while retaining the saturated colours of Impressionism. The Impressionist Camille Pissarro experimented with Neo-Impressionist ideas between the mid-1880s and the early 1890s. Discontented with what he referred to as romantic Impressionism, he investigated Pointillism, which he called scientific Impressionism, before returning to a purer Impressionism in the last decade of his life. Vincent van Gogh used colour and vibrant swirling brush strokes to convey his feelings and his state of mind.
Although they often exhibited together, Post-Impressionist artists were not in agreement concerning a cohesive movement. Yet, the abstract concerns of harmony and structural arrangement, in the work of all these artists, took precedence over naturalism. Artists such as Seurat adopted a meticulously scientific approach to colour and composition.
Younger painters during the early 20th century worked in geographically disparate regions and in various stylistic categories, such as Fauvism and Cubism, breaking from Post-Impressionism.
Defining Post-Impressionism
The term was used in 1906, and again in 1910 by Roger Fry in the title of an exhibition of modern French painters: Manet and the Post-Impressionists, organized by Fry for the Grafton Galleries in London. Three weeks before Fry's show, art critic Frank Rutter had put the term Post-Impressionist in print in Art News of 15 October 1910, during a review of the Salon d'Automne, where he described Othon Friesz as a "post-impressionist leader"; there was also an advert in the journal for the show The Post-Impressionists of France.
Most of the artists in Fry's exhibition were younger than the Impressionists. Fry later explained: "For purposes of convenience, it was necessary to give these artists a name, and I chose, as being the vaguest and most non-committal, the name of Post-Impressionism. This merely stated their position in time relatively to the Impressionist movement." John Rewald limited the scope to the years between 1886 and 1892 in his pioneering publication on Post-Impressionism: From Van Gogh to Gauguin (1956). Rewald considered this a continuation of his 1946 study, History of Impressionism, and pointed out that a "subsequent volume dedicated to the second half of the post-impressionist period": Post-Impressionism: From Gauguin to Matisse, was to follow. This volume would extend the period covered to other artistic movements derived from Impressionism, though confined to the late 19th and early 20th centuries. Rewald focused on such outstanding early Post-Impressionists active in France as van Gogh, Gauguin, Seurat, and Redon. He explored their relationships as well as the artistic circles they frequented (or were in opposition to), including:
Neo-Impressionism: ridiculed by contemporary art critics as well as artists as Pointillism; Seurat and Signac would have preferred other terms: Divisionism for example
Cloisonnism: a short-lived term introduced in 1888 by the art critic Édouard Dujardin, was to promote the work of Louis Anquetin, and was later also applied to contemporary works of his friend Émile Bernard
Synthetism: another short-lived term coined in 1889 to distinguish recent works of Gauguin and Bernard from that of more traditional Impressionists exhibiting with them at the Café Volpini.
Pont-Aven School: implying little more than that the artists involved had been working for a while in Pont-Aven or elsewhere in Brittany.
Symbolism: a term highly welcomed by vanguard critics in 1891, when Gauguin dropped Synthetism as soon as he was acclaimed to be the leader of Symbolism in painting.
Furthermore, in his introduction to Post-Impressionism, Rewald opted for a second volume featuring Toulouse-Lautrec, Henri Rousseau "le Douanier", Les Nabis and Cézanne as well as the Fauves, the young Picasso and Gauguin's last trip to the South Seas; it was to expand the period covered at least into the first decade of the 20th century—yet this second volume remained unfinished.
Reviews and adjustments
Rewald wrote that "the term 'Post-Impressionism' is not a very precise one, though a very convenient one." Convenient, when the term is by definition limited to French visual arts derived from Impressionism since 1886. Rewald's approach to historical data was narrative rather than analytic, and beyond this point he believed it would be sufficient to "let the sources speak for themselves."
Rival terms like Modernism or Symbolism were never as easy to handle, for they covered literature, architecture and other arts as well, and they expanded to other countries.
Modernism, thus, is now considered to be the central movement within international western civilization with its original roots in France, going back beyond the French Revolution to the Age of Enlightenment.
Symbolism, however, is considered to be a concept which emerged a century later in France, and implied an individual approach. Local national traditions as well as individual settings therefore could stand side by side, and from the very beginning a broad variety of artists practicing some kind of symbolic imagery, ranged between extreme positions: The Nabis for example united to find synthesis of tradition and brand new form, while others kept to traditional, more or less academic forms, when they were looking for fresh contents: Symbolism is therefore often linked to fantastic, esoteric, erotic and other non-realist subject matter.
To meet the recent discussion, the connotations of the term 'Post-Impressionism' were challenged again: Alan Bowness and his collaborators expanded the period covered forward to 1914 and the beginning of World War I, but limited their approach widely on the 1890s to France. Other European countries are pushed back to standard connotations, and Eastern Europe is completely excluded.
So, while a split may be seen between classical 'Impressionism' and 'Post-Impressionism' in 1886, the end and the extent of 'Post-Impressionism' remains under discussion. For Bowness and his contributors as well as for Rewald, 'Cubism' was an absolutely fresh start, and so Cubism has been seen in France since the beginning, and later in Anglosaxonia. Meanwhile, Eastern European artists, however, did not care so much for western traditions, and proceeded to manners of painting called abstract and suprematic—terms expanding far into the 20th century.
According to the present state of discussion, Post-Impressionism is a term best used within Rewald's definition in a strictly historical manner, concentrating on French art between 1886 and 1914, and re-considering the altered positions of impressionist painters like Claude Monet, Camille Pissarro, Auguste Renoir, and others—as well as all new schools and movements at the turn of the century: from Cloisonnism to Cubism. The declarations of war, in July/August 1914, indicate probably far more than the beginning of a World War—they signal a major break in European cultural history, too.
Along with general art history information given about "Post-Impressionism" works, there are many museums that offer additional history, information and gallery works, both online and in house, that can help viewers understand a deeper meaning of "Post-Impressionism" in terms of fine art and traditional art applications.
Gallery of major Post-Impressionist artists
See also
Art periods
Cubism
Kapists
Neo-impressionism
Expressionism
References and sources
References
Sources
Bowness, Alan, et alt.: Post-Impressionism. Cross-Currents in European Painting, Royal Academy of Arts & Weidenfeld and Nicolson, London 1979
Further reading
Manet and the Post-Impressionists (exh. cat. by R. Fry and D. MacCarthy, London, Grafton Gals, 1910–11)
The Second Post-Impressionist Exhibition (exh. cat. by R. Fry, London, Grafton Gals, 1912)
J. Rewald. Post-Impressionism: From Van Gogh to Gauguin (New York, 1956, rev. 3/1978)
F. Elgar. The Post-Impressionists (Oxford, 1977)
Post-Impressionism: Cross-currents in European Painting (exh. cat., ed. J. House and M. A. Stevens; London, RA, 1979–80)
B. Thomson. The Post-Impressionists (Oxford and New York, 1983, rev. 2/1990)
J. Rewald. Studies in Post-Impressionism (London, 1986)
Beyond Impressionism, exhibit at Columbus Museum of Art, October 21, 2017 – January 21, 2018 http://www.columbusmuseum.org/beyond-impressionism
External links
"Post-Impressionists", Walter Sickert's review in The Fortnightly Review of the "Manet and the Post-Impressionists" exhibition at the Grafton Galleries
"Post-Impressionism", Roger Fry's lecture on the closing of the "Manet and the Post-Impressionists" exhibition at the Grafton Galleries, as published in The Fortnightly Review
Georges Seurat, 1859-1891, a full text exhibition catalog from The Metropolitan Museum of Art
Toulouse-Lautrec in the Metropolitan Museum of Art, a full text exhibition catalog from The Metropolitan Museum of Art
"Roger Fry, Walter Sickert and Post-Impressionism at the Grafton Galleries", a reflection by Prof. Marnin Young on the 1910-1911 exhibition
Category:Post-Impressionism
Category:Modernism
Category:Art movements | {
"pile_set_name": "Wikipedia (en)"
} |
Most people are familiar with the term Information Technology (IT), which covers the spectrum of technologies for information processing, including software, hardware, communications technologies and related services. Operation Technology (OT) is a relatively newer term that refers to hardware and software that detects or causes a change through the direct monitoring and/or control of physical devices, processes and events in the enterprise. For example, OT networks interconnect industrial control systems such as programmable logic controllers, supervisory control and data acquisition systems, distributed control systems, process control domains, safety instrumented systems, and building management and automation systems.
As many organizations are discovering, the Industrial Internet is a huge new opportunity for growth and efficiency. To realize this value, OT environments need to be connected. With production systems becoming more interconnected, the exposure to cyber incidents increases. Attacks and disruptions on critical infrastructure put reputation, production, people, and profits at risk.
Traditionally, OT networks have operated separately from IT networks. For example, OT networks utilized proprietary protocols optimized for the required functions, some of which have become adopted as ‘standard’ industrial communications protocols (e.g., DNP3, Modbus, Profibus, RTU, CANBUS, HART, DeviceNet). More recently, IT-standard network protocols are being implemented in OT devices and systems to reduce complexity and increase compatibility with more traditional IT hardware (e.g., TCP/IP). This has led to a demonstrable reduction in security for OT systems.
Network security systems are designed to protect critical infrastructure, control systems and OT assets. Network security systems provide protection from cyber threats and vulnerabilities in OT environments by monitoring and blocking malicious activity and misconfiguration to promote OT safety and protect productivity. While effective, configuring a network security system is a difficult and time intensive manual task. For example, a network administrator is often tasked with manually generating whitelist policies that identify commands that should be allowed within the network. This requires the network administrator to analyze the software services running on the devices in the network and determine the commands that are likely to be transmitted to provide the software services. Accordingly, improvements are needed. | {
"pile_set_name": "USPTO Backgrounds"
} |
After being widely criticized for mocking members of a student group that wanted nothing more but to meet with her, Minnesota Rep. Mary Franson (R) responded with a private Facebook post suggesting she was worried about becoming the next Roy Moore.
“A man’s life was destroyed in AL,” Franson wrote, alluding to Moore. “40 years ago he met with minors alone and they recently accused him of horrendous actions. In the world of we must believe every sexual harassment claim, I would think my approach is beyond reasonable. All it takes is one perceived action and my life is destroyed. The life of my family is destroyed. That is a risk I will not take.”
CREDIT: SCREENGRAB
Moore, of course, allegedly did much more that just “meet” with minors. At least six women have accused Moore of sexual misconduct, including child molestation and sexual assault.
Jack Ballou, the 17-year-old founder of the student group Franson refused to meet with — Alexandria Area High School (AAHS) Democrats — has been blocked by Franson. Told of her Facebook post, Ballou told ThinkProgress that he’s “shocked.”
“If any of what she said was true, she could have just told us initially that she doesn’t meet with minors,” Ballou said. “I’m also so confused how she started defending Roy Moore… last year I met with Mary through the student page program, one on one at her office. She had no issue then.”
Instead of setting her up for a sexual assault, Ballou said he and other members of AAHS Democrats merely wanted to meet with Franson to discuss issues of concerns to students, such as student debt. In her Facebook post, Franson acknowledged their concerns, but suggested they’d be best off turning to their families members for help — like she did — instead of asking elected officials.
“If it wasn’t for my Great Uncle (constituent of mine) vouching and writing letter [sic] of my independent status, I may not have been able to attend [college],” Franson wrote. “I had to work my way through college. So yes, I understand the struggle because I lived it.”
Franson also accused AAHS Democrats of setting up “an ambush or set up,” and compares the student group with Antifa.
CREDIT: SCREENGRAB
Franson’s refusal to meet with the students was covered on Monday night by the Fox affiliate in the Twin Cities. In an interview with the TV station, Franson claimed that “this has absolutely nothing to do with me not wanting to meet with Democrats — it has everything to do with the fact that we all have to be careful in today’s world.”
But Franson’s damage control is belied by her Twitter exchange with AAHS Democrats. In it, she dismissed the students as “a partisan group” and wrote, “It’s not a Legislator’s duty to meet with a ‘proudly’ partisan democrat group. ¯\_(ツ)_/¯” | {
"pile_set_name": "OpenWebText2"
} |
CB1 cannabinoid receptor antagonism: a new strategy for the treatment of liver fibrosis.
Hepatic fibrosis, the common response associated with chronic liver diseases, ultimately leads to cirrhosis, a major public health problem worldwide. We recently showed that activation of hepatic cannabinoid CB2 receptors limits progression of experimental liver fibrosis. We also found that during the course of chronic hepatitis C, daily cannabis use is an independent predictor of fibrosis progression. Overall, these results suggest that endocannabinoids may drive both CB2-mediated antifibrogenic effects and CB2-independent profibrogenic effects. Here we investigated whether activation of cannabinoid CB1 receptors (encoded by Cnr1) promotes progression of fibrosis. CB1 receptors were highly induced in human cirrhotic samples and in liver fibrogenic cells. Treatment with the CB1 receptor antagonist SR141716A decreased the wound-healing response to acute liver injury and inhibited progression of fibrosis in three models of chronic liver injury. We saw similar changes in Cnr1-/- mice as compared to wild-type mice. Genetic or pharmacological inactivation of CB1 receptors decreased fibrogenesis by lowering hepatic transforming growth factor (TGF)-beta1 and reducing accumulation of fibrogenic cells in the liver after apoptosis and growth inhibition of hepatic myofibroblasts. In conclusion, our study shows that CB1 receptor antagonists hold promise for the treatment of liver fibrosis. | {
"pile_set_name": "PubMed Abstracts"
} |
Conventional high efficiency feed horns are very useful as elements in phased array antenna and also as feed elements in a multi-beam reflector, in satellite communication systems. A multiple beam reflector has several feed elements that are used for receiving and transmitting multiple beams. Feed horn size is restricted because of the number of feed elements and required beam spacing. A phased array antenna with high efficiency feed horn elements requires 20% less elements, for a desired gain requirement, than that of corrugated feed horns or potter horns that usually have aperture efficiencies of about 70%. The reduction in feed horn elements reduces manufacturing costs, size, and weight of the phased array antenna.
A low efficiency feed horn yields less amplitude taper to a reflector edge for a given feed horn aperture size, which causes high side lobes and spill over loss. High side lobes are not desirable as they cause signal interference between beams. A conventional high efficiency feed horn minimizes spillover loss and interference problems due to its improved edge taper.
Corrugated horns have a disadvantage of a rim, which reduces usable aperture in cases where horn size is limited as with multi-beam antenna. The traditional corrugated horns are therefore not suitable for multi-beam antenna. Antenna packaging is a large driver in designing of multi-spot beam antennas.
Although the high efficiency horns are useful for many applications, they suffer from a limited bandwidth problem. The bandwidth of such feed horns is generally less than 10%. Therefore, separate transmit and receive antennas are required which take up more space and increase costs. Two different phased arrays are used in a phased array antenna, one for a transmitting band and one for a receiving band.
Since feed horn bandwidth decreases as aperture size increases, traditional reflector antennas must limit the horn size. This forces the main reflector aperture to be large in order to minimize spillover loss. Also, large focal lengths are needed to improve scanning performance, which further drives the reflector size to be large.
The above-described problems associated with traditional feed horns result in a trade-off between generally three alternatives; using two single band feed horns, using a dual band feed horn that is large in size relative to single band feed horns, or using a smaller sized dual band feed horn that suffers from interference problems and large spillover loss, which results in poor efficiency.
Additionally, all of the above mentioned feed horns also propagate both transverse electric (TE) modes and transverse magnetic (TM) modes. The propagation of both TE and TM modes further reduces the efficiency of a feed horn.
Therefore, it would be desirable to provide an improved feed horn design that supports dual bands, is smaller in size relative to conventional dual band feed horns, and operates at efficiency levels at least as high as that of conventional high efficiency feed horns with good cross-polarization level. | {
"pile_set_name": "USPTO Backgrounds"
} |
The Vegas Golden Knights are riding a historic run to the Stanley Cup Final. How impressive is the expansion team's season? Watch above to see how the Golden Knights are setting records in their inaugural campaign... | {
"pile_set_name": "Pile-CC"
} |
Lupton, Cumbria
Lupton is a linear village and civil parish in the South Lakeland district of Cumbria, England, along the main A65 road north west of Kirkby Lonsdale, from the village of Hutton Roof. The parish had a population of 162 at the 2011 Census.
As well as All Saints Church, the village has a public house, the Plough. Lupton Tower is an 18th-century house now used as a corporate head office.
See also
Listed buildings in Lupton, Cumbria
References
External links
Category:Villages in Cumbria
Category:Civil parishes in Cumbria | {
"pile_set_name": "Wikipedia (en)"
} |
# Copyright 2020 The TensorFlow Authors. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# ==============================================================================
"""Functions to generate bidirectional feature pyramids based on image features.
Provides bidirectional feature pyramid network (BiFPN) generators that can be
used to build object detection feature extractors, as proposed by Tan et al.
See https://arxiv.org/abs/1911.09070 for more details.
"""
import collections
import functools
from six.moves import range
from six.moves import zip
import tensorflow as tf
from object_detection.utils import bifpn_utils
def _create_bifpn_input_config(fpn_min_level,
fpn_max_level,
input_max_level,
level_scales=None):
"""Creates a BiFPN input config for the input levels from a backbone network.
Args:
fpn_min_level: the minimum pyramid level (highest feature map resolution) to
use in the BiFPN.
fpn_max_level: the maximum pyramid level (lowest feature map resolution) to
use in the BiFPN.
input_max_level: the maximum pyramid level that will be provided as input to
the BiFPN. Accordingly, the BiFPN will compute additional pyramid levels
from input_max_level, up to the desired fpn_max_level.
level_scales: a list of pyramid level scale factors. If 'None', each level's
scale is set to 2^level by default, which corresponds to each successive
feature map scaling by a factor of 2.
Returns:
A list of dictionaries for each feature map expected as input to the BiFPN,
where each has entries for the feature map 'name' and 'scale'.
"""
if not level_scales:
level_scales = [2**i for i in range(fpn_min_level, fpn_max_level + 1)]
bifpn_input_params = []
for i in range(fpn_min_level, min(fpn_max_level, input_max_level) + 1):
bifpn_input_params.append({
'name': '0_up_lvl_{}'.format(i),
'scale': level_scales[i - fpn_min_level]
})
return bifpn_input_params
def _get_bifpn_output_node_names(fpn_min_level, fpn_max_level, node_config):
"""Returns a list of BiFPN output node names, given a BiFPN node config.
Args:
fpn_min_level: the minimum pyramid level (highest feature map resolution)
used by the BiFPN.
fpn_max_level: the maximum pyramid level (lowest feature map resolution)
used by the BiFPN.
node_config: the BiFPN node_config, a list of dictionaries corresponding to
each node in the BiFPN computation graph, where each entry should have an
associated 'name'.
Returns:
A list of strings corresponding to the names of the output BiFPN nodes.
"""
num_output_nodes = fpn_max_level - fpn_min_level + 1
return [node['name'] for node in node_config[-num_output_nodes:]]
def _create_bifpn_node_config(bifpn_num_iterations,
bifpn_num_filters,
fpn_min_level,
fpn_max_level,
input_max_level,
bifpn_node_params=None,
level_scales=None):
"""Creates a config specifying a bidirectional feature pyramid network.
Args:
bifpn_num_iterations: the number of top-down bottom-up feature computations
to repeat in the BiFPN.
bifpn_num_filters: the number of filters (channels) for every feature map
used in the BiFPN.
fpn_min_level: the minimum pyramid level (highest feature map resolution) to
use in the BiFPN.
fpn_max_level: the maximum pyramid level (lowest feature map resolution) to
use in the BiFPN.
input_max_level: the maximum pyramid level that will be provided as input to
the BiFPN. Accordingly, the BiFPN will compute additional pyramid levels
from input_max_level, up to the desired fpn_max_level.
bifpn_node_params: If not 'None', a dictionary of additional default BiFPN
node parameters that will be applied to all BiFPN nodes.
level_scales: a list of pyramid level scale factors. If 'None', each level's
scale is set to 2^level by default, which corresponds to each successive
feature map scaling by a factor of 2.
Returns:
A list of dictionaries used to define nodes in the BiFPN computation graph,
as proposed by EfficientDet, Tan et al (https://arxiv.org/abs/1911.09070).
Each node's entry has the corresponding keys:
name: String. The name of this node in the BiFPN. The node name follows
the format '{bifpn_iteration}_{dn|up}_lvl_{pyramid_level}', where 'dn'
or 'up' refers to whether the node is in the top-down or bottom-up
portion of a single BiFPN iteration.
scale: the scale factor for this node, by default 2^level.
inputs: A list of names of nodes which are inputs to this node.
num_channels: The number of channels for this node.
combine_method: String. Name of the method used to combine input
node feature maps, 'fast_attention' by default for nodes which have more
than one input. Otherwise, 'None' for nodes with only one input node.
input_op: A (partial) function which is called to construct the layers
that will be applied to this BiFPN node's inputs. This function is
called with the arguments:
input_op(name, input_scale, input_num_channels, output_scale,
output_num_channels, conv_hyperparams, is_training,
freeze_batchnorm)
post_combine_op: A (partial) function which is called to construct the
layers that will be applied to the result of the combine operation for
this BiFPN node. This function will be called with the arguments:
post_combine_op(name, conv_hyperparams, is_training, freeze_batchnorm)
If 'None', then no layers will be applied after the combine operation
for this node.
"""
if not level_scales:
level_scales = [2**i for i in range(fpn_min_level, fpn_max_level + 1)]
default_node_params = {
'num_channels':
bifpn_num_filters,
'combine_method':
'fast_attention',
'input_op':
functools.partial(
_create_bifpn_resample_block, downsample_method='max_pooling'),
'post_combine_op':
functools.partial(
bifpn_utils.create_conv_block,
num_filters=bifpn_num_filters,
kernel_size=3,
strides=1,
padding='SAME',
use_separable=True,
apply_batchnorm=True,
apply_activation=True,
conv_bn_act_pattern=False),
}
if bifpn_node_params:
default_node_params.update(bifpn_node_params)
bifpn_node_params = []
# Create additional base pyramid levels not provided as input to the BiFPN.
# Note, combine_method and post_combine_op are set to None for additional
# base pyramid levels because they do not combine multiple input BiFPN nodes.
for i in range(input_max_level + 1, fpn_max_level + 1):
node_params = dict(default_node_params)
node_params.update({
'name': '0_up_lvl_{}'.format(i),
'scale': level_scales[i - fpn_min_level],
'inputs': ['0_up_lvl_{}'.format(i - 1)],
'combine_method': None,
'post_combine_op': None,
})
bifpn_node_params.append(node_params)
for i in range(bifpn_num_iterations):
# The first bottom-up feature pyramid (which includes the input pyramid
# levels from the backbone network and the additional base pyramid levels)
# is indexed at 0. So, the first top-down bottom-up pass of the BiFPN is
# indexed from 1, and repeated for bifpn_num_iterations iterations.
bifpn_i = i + 1
# Create top-down nodes.
for level_i in reversed(range(fpn_min_level, fpn_max_level)):
inputs = []
# BiFPN nodes in the top-down pass receive input from the corresponding
# level from the previous BiFPN iteration's bottom-up pass, except for the
# bottom-most (min) level node, which is computed once in the initial
# bottom-up pass, and is afterwards only computed in each top-down pass.
if level_i > fpn_min_level or bifpn_i == 1:
inputs.append('{}_up_lvl_{}'.format(bifpn_i - 1, level_i))
else:
inputs.append('{}_dn_lvl_{}'.format(bifpn_i - 1, level_i))
inputs.append(bifpn_node_params[-1]['name'])
node_params = dict(default_node_params)
node_params.update({
'name': '{}_dn_lvl_{}'.format(bifpn_i, level_i),
'scale': level_scales[level_i - fpn_min_level],
'inputs': inputs
})
bifpn_node_params.append(node_params)
# Create bottom-up nodes.
for level_i in range(fpn_min_level + 1, fpn_max_level + 1):
# BiFPN nodes in the bottom-up pass receive input from the corresponding
# level from the preceding top-down pass, except for the top (max) level
# which does not have a corresponding node in the top-down pass.
inputs = ['{}_up_lvl_{}'.format(bifpn_i - 1, level_i)]
if level_i < fpn_max_level:
inputs.append('{}_dn_lvl_{}'.format(bifpn_i, level_i))
inputs.append(bifpn_node_params[-1]['name'])
node_params = dict(default_node_params)
node_params.update({
'name': '{}_up_lvl_{}'.format(bifpn_i, level_i),
'scale': level_scales[level_i - fpn_min_level],
'inputs': inputs
})
bifpn_node_params.append(node_params)
return bifpn_node_params
def _create_bifpn_resample_block(name,
input_scale,
input_num_channels,
output_scale,
output_num_channels,
conv_hyperparams,
is_training,
freeze_batchnorm,
downsample_method=None,
use_native_resize_op=False,
maybe_apply_1x1_conv=True,
apply_1x1_pre_sampling=True,
apply_1x1_post_sampling=False):
"""Creates resample block layers for input feature maps to BiFPN nodes.
Args:
name: String. Name used for this block of layers.
input_scale: Scale factor of the input feature map.
input_num_channels: Number of channels in the input feature map.
output_scale: Scale factor of the output feature map.
output_num_channels: Number of channels in the output feature map.
conv_hyperparams: A `hyperparams_builder.KerasLayerHyperparams` object
containing hyperparameters for convolution ops.
is_training: Indicates whether the feature generator is in training mode.
freeze_batchnorm: Bool. Whether to freeze batch norm parameters during
training or not. When training with a small batch size (e.g. 1), it is
desirable to freeze batch norm update and use pretrained batch norm
params.
downsample_method: String. Method to use when downsampling feature maps.
use_native_resize_op: Bool. Whether to use the native resize up when
upsampling feature maps.
maybe_apply_1x1_conv: Bool. If 'True', a 1x1 convolution will only be
applied if the input_num_channels differs from the output_num_channels.
apply_1x1_pre_sampling: Bool. Whether a 1x1 convolution will be applied to
the input feature map before the up/down-sampling operation.
apply_1x1_post_sampling: Bool. Whether a 1x1 convolution will be applied to
the input feature map after the up/down-sampling operation.
Returns:
A list of layers which may be applied to the input feature maps in order to
compute feature maps with the specified scale and number of channels.
"""
# By default, 1x1 convolutions are only applied before sampling when the
# number of input and output channels differ.
if maybe_apply_1x1_conv and output_num_channels == input_num_channels:
apply_1x1_pre_sampling = False
apply_1x1_post_sampling = False
apply_bn_for_resampling = True
layers = []
if apply_1x1_pre_sampling:
layers.extend(
bifpn_utils.create_conv_block(
name=name + '1x1_pre_sample/',
num_filters=output_num_channels,
kernel_size=1,
strides=1,
padding='SAME',
use_separable=False,
apply_batchnorm=apply_bn_for_resampling,
apply_activation=False,
conv_hyperparams=conv_hyperparams,
is_training=is_training,
freeze_batchnorm=freeze_batchnorm))
layers.extend(
bifpn_utils.create_resample_feature_map_ops(input_scale, output_scale,
downsample_method,
use_native_resize_op,
conv_hyperparams, is_training,
freeze_batchnorm, name))
if apply_1x1_post_sampling:
layers.extend(
bifpn_utils.create_conv_block(
name=name + '1x1_post_sample/',
num_filters=output_num_channels,
kernel_size=1,
strides=1,
padding='SAME',
use_separable=False,
apply_batchnorm=apply_bn_for_resampling,
apply_activation=False,
conv_hyperparams=conv_hyperparams,
is_training=is_training,
freeze_batchnorm=freeze_batchnorm))
return layers
def _create_bifpn_combine_op(num_inputs, name, combine_method):
"""Creates a BiFPN output config, a list of the output BiFPN node names.
Args:
num_inputs: The number of inputs to this combine operation.
name: String. The name of this combine operation.
combine_method: String. The method used to combine input feature maps.
Returns:
A function which may be called with a list of num_inputs feature maps
and which will return a single feature map.
"""
combine_op = None
if num_inputs < 1:
raise ValueError('Expected at least 1 input for BiFPN combine.')
elif num_inputs == 1:
combine_op = lambda x: x[0]
else:
combine_op = bifpn_utils.BiFPNCombineLayer(
combine_method=combine_method, name=name)
return combine_op
class KerasBiFpnFeatureMaps(tf.keras.Model):
"""Generates Keras based BiFPN feature maps from an input feature map pyramid.
A Keras model that generates multi-scale feature maps for detection by
iteratively computing top-down and bottom-up feature pyramids, as in the
EfficientDet paper by Tan et al, see arxiv.org/abs/1911.09070 for details.
"""
def __init__(self,
bifpn_num_iterations,
bifpn_num_filters,
fpn_min_level,
fpn_max_level,
input_max_level,
is_training,
conv_hyperparams,
freeze_batchnorm,
bifpn_node_params=None,
name=None):
"""Constructor.
Args:
bifpn_num_iterations: The number of top-down bottom-up iterations.
bifpn_num_filters: The number of filters (channels) to be used for all
feature maps in this BiFPN.
fpn_min_level: The minimum pyramid level (highest feature map resolution)
to use in the BiFPN.
fpn_max_level: The maximum pyramid level (lowest feature map resolution)
to use in the BiFPN.
input_max_level: The maximum pyramid level that will be provided as input
to the BiFPN. Accordingly, the BiFPN will compute any additional pyramid
levels from input_max_level up to the desired fpn_max_level, with each
successivel level downsampling by a scale factor of 2 by default.
is_training: Indicates whether the feature generator is in training mode.
conv_hyperparams: A `hyperparams_builder.KerasLayerHyperparams` object
containing hyperparameters for convolution ops.
freeze_batchnorm: Bool. Whether to freeze batch norm parameters during
training or not. When training with a small batch size (e.g. 1), it is
desirable to freeze batch norm update and use pretrained batch norm
params.
bifpn_node_params: An optional dictionary that may be used to specify
default parameters for BiFPN nodes, without the need to provide a custom
bifpn_node_config. For example, if '{ combine_method: 'sum' }', then all
BiFPN nodes will combine input feature maps by summation, rather than
by the default fast attention method.
name: A string name scope to assign to the model. If 'None', Keras
will auto-generate one from the class name.
"""
super(KerasBiFpnFeatureMaps, self).__init__(name=name)
bifpn_node_config = _create_bifpn_node_config(
bifpn_num_iterations, bifpn_num_filters, fpn_min_level, fpn_max_level,
input_max_level, bifpn_node_params)
bifpn_input_config = _create_bifpn_input_config(
fpn_min_level, fpn_max_level, input_max_level)
bifpn_output_node_names = _get_bifpn_output_node_names(
fpn_min_level, fpn_max_level, bifpn_node_config)
self.bifpn_node_config = bifpn_node_config
self.bifpn_output_node_names = bifpn_output_node_names
self.node_input_blocks = []
self.node_combine_op = []
self.node_post_combine_block = []
all_node_params = bifpn_input_config
all_node_names = [node['name'] for node in all_node_params]
for node_config in bifpn_node_config:
# Maybe transform and/or resample input feature maps.
input_blocks = []
for input_name in node_config['inputs']:
if input_name not in all_node_names:
raise ValueError(
'Input feature map ({}) does not exist:'.format(input_name))
input_index = all_node_names.index(input_name)
input_params = all_node_params[input_index]
input_block = node_config['input_op'](
name='{}/input_{}/'.format(node_config['name'], input_name),
input_scale=input_params['scale'],
input_num_channels=input_params.get('num_channels', None),
output_scale=node_config['scale'],
output_num_channels=node_config['num_channels'],
conv_hyperparams=conv_hyperparams,
is_training=is_training,
freeze_batchnorm=freeze_batchnorm)
input_blocks.append((input_index, input_block))
# Combine input feature maps.
combine_op = _create_bifpn_combine_op(
num_inputs=len(input_blocks),
name=(node_config['name'] + '/combine'),
combine_method=node_config['combine_method'])
# Post-combine layers.
post_combine_block = []
if node_config['post_combine_op']:
post_combine_block.extend(node_config['post_combine_op'](
name=node_config['name'] + '/post_combine/',
conv_hyperparams=conv_hyperparams,
is_training=is_training,
freeze_batchnorm=freeze_batchnorm))
self.node_input_blocks.append(input_blocks)
self.node_combine_op.append(combine_op)
self.node_post_combine_block.append(post_combine_block)
all_node_params.append(node_config)
all_node_names.append(node_config['name'])
def call(self, feature_pyramid):
"""Compute BiFPN feature maps from input feature pyramid.
Executed when calling the `.__call__` method on input.
Args:
feature_pyramid: list of tuples of (tensor_name, image_feature_tensor).
Returns:
feature_maps: an OrderedDict mapping keys (feature map names) to
tensors where each tensor has shape [batch, height_i, width_i, depth_i].
"""
feature_maps = [el[1] for el in feature_pyramid]
output_feature_maps = [None for node in self.bifpn_output_node_names]
for index, node in enumerate(self.bifpn_node_config):
node_scope = 'node_{:02d}'.format(index)
with tf.name_scope(node_scope):
# Apply layer blocks to this node's input feature maps.
input_block_results = []
for input_index, input_block in self.node_input_blocks[index]:
block_result = feature_maps[input_index]
for layer in input_block:
block_result = layer(block_result)
input_block_results.append(block_result)
# Combine the resulting feature maps.
node_result = self.node_combine_op[index](input_block_results)
# Apply post-combine layer block if applicable.
for layer in self.node_post_combine_block[index]:
node_result = layer(node_result)
feature_maps.append(node_result)
if node['name'] in self.bifpn_output_node_names:
index = self.bifpn_output_node_names.index(node['name'])
output_feature_maps[index] = node_result
return collections.OrderedDict(
zip(self.bifpn_output_node_names, output_feature_maps))
| {
"pile_set_name": "Github"
} |
Fun Times in Indianapolis for Super Bowl
Unless you’ve been hiding under a rock, you should know that Indianapolis will be the host city of Super Bowl XLVI (46). On Sunday, February 5, 2012 Lucas Oil Stadium will be filled to the brim with eager fans cheering on the New England Patriots and the New York Giants. This is the first time Indianapolis has ever hosted a Super Bowl and we couldn’t be more excited! A plethora of fanfare surrounding this epic event awaits all Central Indiana football fans. Even if you don’t love football, you will love all of the happenings around town leading up to the big game.
Super Bowl XLVI Lucas Oil Stadium Tours begin on Monday 1/23 and run through Tuesday 2/7. Highlights of the tour include: both team locker rooms, media room, a walk on the field and insider look at Super Bowl preparations, the stadium and grounds. Get your tickets through Ticketmaster or the Lucas Oil Stadium box office.
The NLF Experience begins on Friday 1/27 and runs through Saturday 2/4 at the Indiana Convention Center. Don’t miss what the NFL calls “pro football's interactive theme park offering over 30 participatory games, displays, entertainment attractions, kids' football clinics, free autograph sessions and the largest football memorabilia show ever”!
Super Bowl Village. The heart of downtown Indianapolis will be transformed into Super Bowl Village beginning Friday 1/27 through Super Bowl Sunday 2/5. With continuous events for ten days, until midnight each night, this three-block festival will have something for everyone! Too many events abound to list, but a few highlights include: 60+ free concerts on two stages, zip-lines over Capitol Avenue, nightly pyrotechnic shows, live ESPN t.v. show broadcasts and the roman numeral sculpture on monument circle!
More information about Super Bowl Village here http://www.indianapolissuperbowl.com/super-bowl-village/Check out the Map of Super Bowl Village.
Super Cars will be on display Friday 1/27 through Sunday 1/29 in the heart of downtown Indianapolis. Iconic Indy cars have been fused with NFL franchises to create awe and “provide unique photo opportunities for fans of every team”. More information here
The Legacy Loop 5K / HealthBowl will take place on Saturday 1/28 from 9 a.m. until 2 p.m. Register for this walk/run on-site at Arsenal Tech High School, 1500 East Michigan Street, Indianapolis.
Super Tools for Teachers are available to get your classrooms in on the action! Multiple programs are offered giving educators Super Bowl themed lesson plans. Check out these exciting programs:Super Learning in a Super State (SLSS) is an official Indiana Host Committee sanctioned youth outreach program for grades K-12. Focus is on literacy, health and fitness, environmental awareness, community service, character education and interdisciplinary learning. Register here and download the free curriculum guides.
NFL PLAY 60 Challenge comes from a partnership of the NFL and the American Heart Association, in efforts to incorporate physical fitness into the classroom. Register here and download resources. | {
"pile_set_name": "Pile-CC"
} |
/* Copyright (C) 1992, 93, 96, 97, 98, 99, 2004 Free Software Foundation, Inc.
* This file is part of the GNU C Library.
*
* The GNU C Library is free software; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation; either
* version 2.1 of the License, or (at your option) any later version.
*
* The GNU C Library is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
* Lesser General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public
* License along with the GNU C Library; if not, write to the Free
* Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA
* 02111-1307 USA.
*/
#include <config.h>
#include <stdarg.h>
#include <stdio.h>
#if HAVE_STRING_H
#include <string.h>
#endif /* HAVE_STRING_H */
#include "replacements.h"
/* Taken from glibc 2.6.1 */
char *
tds_strsep(char **stringp, const char *delim)
{
char *begin, *end;
begin = *stringp;
if (begin == NULL)
return NULL;
/* A frequent case is when the delimiter string contains only one
* character. Here we don't need to call the expensive `strpbrk'
* function and instead work using `strchr'. */
if (delim[0] == '\0') {
end = NULL;
} else if (delim[1] == '\0') {
char ch = delim[0];
if (*begin == ch)
end = begin;
else if (*begin == '\0')
end = NULL;
else
end = strchr(begin + 1, ch);
} else {
/* Find the end of the token. */
end = strpbrk(begin, delim);
}
if (end) {
/* Terminate the token and set *STRINGP past NUL character. */
*end++ = '\0';
} else {
/* No more delimiters; this is the last token. */
}
*stringp = end;
return begin;
}
| {
"pile_set_name": "Github"
} |
jungle
Well I made it! Sorry for the delay in letting you know I made it safely to Brazil. The city as I flew in. Pulling up to the terminal. I went to Florianópolis for New Years weekend. HUGE Island full of 42 beaches. Alex and Mariella are a couple I hang out with. Alex is also… | {
"pile_set_name": "Pile-CC"
} |
Step-by-Step solutions are actual worked out problems to the questions at the end of each chapter that help you understand your homework and study for your exams. Chegg and eCampus are providing you two weeks absolutely free. 81% of students said using Step-by-Step solutions prepared them for their exams.
Summary
Thompson, Strickland and Gambles', CRAFTING AND EXECUTING STRATEGY, 17e presents the latest research findings from the literature and cutting-edge strategic practices of companies have been incorporated to keep step with both theory and practice. The chapter content continues to be solidly mainstream and balanced, mirroring both the best academic thinking and the pragmatism of real-world strategic management. Known for its cases and teaching notes, CRAFTING AND EXECUTING STRATEGY, 17e provides an unparalleled case line up. (1) 22 of the 26 cases are brand new or extensively updated for this edition, (2) The selection of cases is diverse, timely, and thoughtfully-crafted and complements the text presentation pushing students to apply the concepts and analytical tools they have read about. (3) Many cases involve high-profile companies. (4) And there's a comprehensive package of support materials that are a breeze to use, highly effective, and flexible enough to fit most any course design.
Table of Contents
Concepts and Techniques for Crafting and Executing Strategy
Introduction and Overview
What Is Strategy and Why Is It Important?
Leading the Process of Crafting and Executing Strategy
Core Concepts and Analytical Tools
Evaluating a CompanyG++s External Environment
Evaluating a CompanyG++s Resources and Competitive Position
Crafting a Strategy
Five Generic Competitive Strategies
Which One to Employ?
Supplementing the Chosen Competitive Strategy: Other Important Strategy Choices
Strategies for Competing in Foreign Markets
Diversification: Strategies for Managing a Group of Businesses
Ethical Business Strategies, Social Responsibility, and Environmental Sustainability Section D: Executing the Strategy | {
"pile_set_name": "Pile-CC"
} |
/*
* Globalize Culture en-ZA
*
* http://github.com/jquery/globalize
*
* Copyright Software Freedom Conservancy, Inc.
* Dual licensed under the MIT or GPL Version 2 licenses.
* http://jquery.org/license
*
* This file was generated by the Globalize Culture Generator
* Translation: bugs found in this file need to be fixed in the generator
*/
(function( window, undefined ) {
var Globalize;
if ( typeof require !== "undefined" &&
typeof exports !== "undefined" &&
typeof module !== "undefined" ) {
// Assume CommonJS
Globalize = require( "globalize" );
} else {
// Global variable
Globalize = window.Globalize;
}
Globalize.addCultureInfo( "en-ZA", "default", {
name: "en-ZA",
englishName: "English (South Africa)",
nativeName: "English (South Africa)",
numberFormat: {
",": " ",
percent: {
pattern: ["-n%","n%"],
",": " "
},
currency: {
pattern: ["$-n","$ n"],
",": " ",
".": ",",
symbol: "R"
}
},
calendars: {
standard: {
patterns: {
d: "yyyy/MM/dd",
D: "dd MMMM yyyy",
t: "hh:mm tt",
T: "hh:mm:ss tt",
f: "dd MMMM yyyy hh:mm tt",
F: "dd MMMM yyyy hh:mm:ss tt",
M: "dd MMMM",
Y: "MMMM yyyy"
}
}
}
});
}( this ));
| {
"pile_set_name": "Github"
} |
The present invention relates to a method and arrangement for operating a drive for a plurality of auxiliary devices arranged on an internal-combustion engine in a motor vehicle, having a differential gear arranged between the internal-combustion engine and the auxiliary devices.
In order to meet the current or voltage requirement of electrical consumers in a motor vehicle, a timed exciting current is fed to a rotary current generator. When there is, for example, a first low rotational generator speed, the exciting current is switched on and off by a regulator at predetermined intervals in such a manner that a specific first medium exciting current is adjusted in the case of a constant wiring voltage. So that the wiring voltage which is permissible for the wiring of the motor vehicle is regulated to its desired value when a second higher rotational generator speed occurs, the regulator changes the timing signal in such a manner that the switched-off time fractions increase and a second medium exciting current is adjusted which is lower than the first. As a result, the wiring voltage, which is a function of the exciting current and the rotational speed and is induced in the generator, remains constant.
It is known to arrange a transmission between an output of an internal-combustion engine and a drive of auxiliary devices. The transmission, as a function of parameters, carries out an adaptation of the rotational driving speed of the auxiliary devices to the rotational output speed of the internal-combustion engine. For example, in the German Patent Document DE-PS 31 24 102, a consumer-current-dependent change-over between a higher and a lower rotational driving speed of an electric generator is disclosed. The transmission connected in front of the electric generator has a clutch actuated by a control device. The clutch carries out the rotational speed change-over in such a manner that the higher rotational driving speed will be maintained only when a low rotational speed of the internal-combustion engine and at the same time a high current requirement, is present at the electric generator. The current requirement is fed to a regulator for the exciting current which, in turn, is fed to the control device.
In the German Patent Document DE-OS 28 01 812, a planetary transmission is arranged coaxially on a crankshaft end. The sun gear of the planetary transmission is provided with an electromagnetically stallable clutch disk. The ring gear of the planetary transmission drives auxiliary devices. When the sun gear is free, all auxiliary devices are driven at a low rotational speed. When the sun gear is fixed, the rotational output speed of the ring gear will increase so that all auxiliary devices are driven at a joint higher rotational speed. The change-over of the clutch disk takes place as a function of several parameters, for example, of the battery charging current or the cooling water temperature of the internal-combustion engine.
From the above-mentioned prior art, it is known to change over the rotational speed of the drive of the auxiliary devices as a function of parameters between a low and a higher rotational speed. A continuous adaptation or a disconnecting of one or several auxiliary devices is not possible.
It is an object of the invention to provide a method and arrangement for operating a drive for auxiliary devices of an internal-combustion engine which permits a controlled drive of individual auxiliary devices according to the requirements.
This and other objects are achieved by the present invention which provides a method of operating a drive for a plurality of auxiliary devices arranged on an internal-combustion engine in a motor vehicle, having a differential gear arranged between the internal-combustion engine and the auxiliary devices. The method includes switching on and off with a regulator in a timed manner an exciting current. The exciting current is supplied to a first auxiliary device as a function of a rotational speed of the generator such that a wiring voltage induced in the auxiliary device remains substantially constant, wherein the first auxiliary device is a rotary current generator. A signal of the internal-combustion engine is supplied to the regulator as a function of at least one of a load and a cooling water temperature of the internal-combustion engine. This thereby affects the timing of the regulator so as to change a driving torque supplied to the rotary current generator. A rotational generator speed and therefore a rotational driving speed of at least a second auxiliary device is changed by the differential gear to maintain the wiring voltage.
The aforementioned objects are also achieved by an embodiment of the present invention which provides an arrangement for operating a drive for a plurality of auxiliary devices arranged on an internal-combustion engine in a motor vehicle, having a differential gear arranged between the internal-combustion engine and the auxiliary devices. A regulator switches on and off in a timed manner an exciting current supplied to a first auxiliary device as a function of a rotational speed of the generator such that a wiring voltage induced in the first auxiliary device remains substantially constant. A signal of the internal-combustion engine is supplied to the regulator as a function of at least one of a load and a cooling water temperature of the internal-combustion engine to thereby affect the timing of the regulator so as to change a driving torque supplied to the first auxiliary device. A rotational generator speed is changed and therefore a rotational driving speed of at least a second auxiliary device is also changed by the differential gear to maintain the wiring voltage, wherein the differential gear is a planetary transmission. The planetary transmission has first and second outputs. The first output has a ring gear. The first auxiliary device is coupled to the ring gear. The second output has a sun gear. The second auxiliary device is coupled to the sun gear. A planet carrier is coupled to a crankshaft.
Via the intervention into the exciting current fed to the rotary current generator (electric generator), in combination with a differential gear arranged between the internal-combustion engine and the auxiliary devices, this method permits a drive of individual auxiliary devices, such as a water pump, that is controlled according to the requirements.
The power supplied by the internal-combustion engine to the differential gear in the case of a constant rotational speed may be considered to be constant. As a function of the construction of the transmission, the supplied power is distributed to these assemblies at a torque ratio that is constant at first. The required driving torque of the water pump may be considered to be constant while that of the electric generator depends on the intensity of the exciting current.
In the case of a cold start of the internal-combustion engine, a signal is, for example, supplied to the regulator. The signal is a function of the cooling water temperature and changes the timing of the exciting current of the electric generator. When the internal-combustion engine is cold, only a low cooling water throughput or no cooling water throughput at all is desired. The wiring voltage induced in the electric generator is a direct function of the exciting current and of the rotational driving speed of the electric generator. When the exciting current falls and the driving torque of the electric generator is therefore reduced by a certain amount, the rotational driving speed is increased by means of the differential gear. The wiring voltage is therefore kept constant.
Because of the compensating effect of the planetary transmission, the rotational driving speed of the water pump will be reduced.
Advantageously by using this method, when the rotational speed of the internal-combustion engine is low, a high transmission ratio can be achieved with respect to the electric generator. This allows the electric requirements to be covered, for example, also at the idling speed of the engine. On the other hand, it is possible to lower the transmission ratio in the case of high rotational speeds of the internal-combustion engine. As a result, the power consumption and the noise emission caused by the fan wheel of the electric generator will be reduced. The electric generator can therefore be operated in a favorable efficiency range of its characteristic diagram.
Additional advantages are achieved with respect to the second auxiliary device, for example, a water pump. In the case of the known design of a conventionally driven water pump, the power consumption relates to the cooling water flow rate of the internal-combustion engine at full load and maximal rotational speed. In the case of a partial load and low rotational speeds, the cooling requirements of the internal-combustion engine will be reduced to up to a third of the maximal cooling power. The method according to the invention allows a drive of the water pump which is controlled according to the demand. In this case, when the cooling water temperature is low, the differential gear reduces the rotational driving speed of the water pump and, when the internal-combustion engine is warmed up, increases it corresponding to the increased cooling requirements.
In an advantageous embodiment of the invention, the supply of the signal that is a function of the load or the cooling water temperature only takes place when it falls below a predetermined limit value for the cooling water temperature. When the actual cooling water temperature is below the limit value, the timing of the exciting current will be changed in such a manner that this exciting current will fall. As a result, the driving torque of the electric generator will be reduced, and its rotational speed will rise. Consequently, the rotational speed of the water pump will decrease.
In certain embodiments, a locking device is arranged between the output of the planetary transmission and the water pump. The locking device stops the water pump in the case of a cold start. This increases the rotational speed of the electric generator. With a controllable design of this locking device, the cooling power can in addition be regulated between one third and zero of the maximal cooling power.
Other objects, advantages and novel features of the present invention will become apparent from the following detailed description of the invention when considered in conjunction with the accompanying drawings. | {
"pile_set_name": "USPTO Backgrounds"
} |
Friday, June 17, 2005
Alaska weather creates ideal conditions for mosquitoes
If you're visiting Alaska for the first time, you may think that we have a lot of bugs. And you would be right. If you've lived here for only a few years, you may be thinking that there are a lot more mosquitoes, gnats, wasps, and other bugs this year compared to previous years. Again, you would be correct.
But the fact is, there really is not an unusual number of flying, biting bugs this year. It's just that we got used to having it good.
The past few years were unusually dry and hot, and the snow cover, which mosquitoes use to survive the winter, was not sufficient to protect them. Because the summers were dry, there were fewer places for them to breed.
This past winter, we had a more normal snow cover, and that was followed by a wetter, cooler spring.
Among the upsides, the salmon, trout, and other fish, as well as some birds, will be fatter and larger than in those previous years. So get some bug dope, a head net, some fishing gear, and a license (of course), and make the best of it.
The other good news is that, so far, Alaska has not had any cases of West Nile Virus, Malaria, or Yellow Fever, all increasingly common mosquito-borne diseases. Also, we haven't had any scorpions, ticks, or snakes for a very long time. | {
"pile_set_name": "Pile-CC"
} |
DARPP-32 in the ciliary epithelium of the eye: a neurotransmitter-regulated phosphoprotein of brain localizes to secretory cells.
DARPP-32, a phosphoprotein enriched in dopaminoceptive brain neurons containing the D-1 receptor subtype, probably functions as an intracellular third messenger to mediate some of the physiological effects of dopamine at the D-1 receptor. By immunohistochemistry in rat, cat, Rhesus monkey, and human, we have localized DARPP-32 to the non-pigmented epithelium of the ciliary body, the innermost layer of the bi-layered epithelium responsible for secretion of aqueous humor into the eye. The immunoreactive protein in rat ciliary body, identified by immunolabeling of a ciliary body extract separated by sodium dodecyl sulfate/polyacrylamide gel electrophoresis, is indistinguishable from DARPP-32 derived from rat caudatoputamen. By analogy with brain, we propose that DARPP-32 may act as a third messenger in the ciliary epithelium, probably through a dopaminergic mechanism. | {
"pile_set_name": "PubMed Abstracts"
} |
The prognostic value of multiple electrode aggregometry and light transmittance aggregometry in stable cardiovascular patients with type 2 diabetes mellitus.
Limited data are available regarding the clinical relevance of platelet function measurements in stable patients with coronary artery disease (CAD). Our aim is to evaluate the agreement between multiple electrode aggregometry (MEA) and light transmittance aggregometry (LTA) in detecting clopidogrel low responders and their prognostic value in CAD patients with type 2 diabetes mellitus (T2DM) on dual platelet inhibition. LTA and MEA were performed in 122 stable cardiovascular patients with T2DM. The upper quartile of patients according to maximum LTA (LTAmax) and MEA measurements were defined as clopidogrel low responders. Agreement between the two methods was evaluated by kappa statistics. We assessed the potential correlation between antiplatelet response and clinical outcome and the optimal cutoff value according to ROC analysis to predict the occurrence of major adverse cardiovascular events (MACE), during 1-year follow-up period. Cohen's kappa coefficients (0.214) indicated fair agreement (70.2%) between LTA and MEA. A total of 25 MACE occurred in 108 patients (23.1%). Patients with MACE had higher LTAmax than those without (57.1 ± 16.5 vs 49.3 ± 18.3, respectively, p = 0.023). MEA measurements were similar between patients with and without MACE (30.1 ± 15.4 vs 30.6 ± 20.8, respectively; p = 0.84). Multiple logistic regression showed LTAmax response as an independent predictor of death from cardiovascular causes (Odds Ratio, adjusted:0.2;0.05-0.81). ROC analysis indicated that LTAmax cutoff of 62.5% best predicted death (AUC = 0.67, sensitivity = 78%, specificity = 61.5%). The assessment of platelet responsiveness remains highly test-specific. Our results support the prognostic role of LTA, but not MEA testing, for death risk evaluation in stable cardiovascular T2DM patients. | {
"pile_set_name": "PubMed Abstracts"
} |
class AddReplyToIdToReplies < ActiveRecord::Migration
def change
add_column :homeland_replies, :reply_to_id, :integer
add_index :homeland_replies, :reply_to_id
end
end
| {
"pile_set_name": "Github"
} |
Helicobacter pylori Activates IL-6-STAT3 Signaling in Human Gastric Cancer Cells: Potential Roles for Reactive Oxygen Species.
Recent studies have shown that Helicobacter pylori (H. pylori) activates signal transducer and activator of transcription 3 (STAT3) that plays an important role in gastric carcinogenesis. However, the molecular mechanism underlying H. pylori-mediated STAT3 activation is still not fully understood. In this study, we investigated H. pylori-induced activation of STAT3 signaling in AGS human gastric cancer cells and the underlying mechanism. AGS cells were cocultured with H. pylori, and STAT3 activation was assessed by Western blot analysis, electrophoretic mobility shift assay and immunocytochemistry. To demonstrate the involvement of reactive oxygen species (ROS) in H. pylori-activated STAT3 signaling, the antioxidant N-acetylcysteine was utilized. The expression and production of interleukin-6 (IL-6) were measured by reverse-transcription polymerase chain reaction and enzyme-linked immunosorbent assay (ELISA), respectively. The interaction between IL-6 and IL-6 receptor (IL-6R) was determined by the immunoprecipitation assay. H. pylori activates STAT3 as evidenced by increases in phosphorylation on Tyr(705) , nuclear localization, DNA binding and transcriptional activity of this transcription factor. The nuclear translocation of STAT3 was also observed in H. pylori-inoculated mouse stomach. In the subsequent study, we found that H. pylori-induced STAT3 phosphorylation was dependent on IL-6. Notably, the increased IL-6 expression and the IL-6 and IL-6R binding were mediated by ROS produced as a consequence of H. pylori infection. H. pylori-induced STAT3 activation is mediated, at least in part, through ROS-induced upregulation of IL-6 expression. These findings provide a novel molecular mechanism responsible for H. pylori-induced gastritis and gastric carcinogenesis. | {
"pile_set_name": "PubMed Abstracts"
} |
Sid Meier’s Civilization VI Review – More of the same but extra
Sid Meier’s Civilization VI Review – More of the same but extra
This title was reviewed on PC, but is also available on Nintendo Switch. Check out our Switch review here.
We have two distinct reviews and scores, which to some may be controversial as it’s the same game. But, Civilization VI on Nintendo Switch plays like a whole different game due to the platform, hence we are standing by our decision for two seperate reviews and scores.
If you’ve played any of the Civilization games then you already know what to expect. If not, then settle in as we go over what the game is about and what changes were made for this new title in the franchise.
Civilization VI is a turn-based strategy game where you start of with a warriors unit and settlers, then grow all the way to a futuristic city with enough power to expand towards the stars or bring doom upon the earth. This is one of those games that you don’t just play on the fly, but rather sink a bunch of time that requires snacks, an empty schedule and one or many drinks. While the game does offer a single player campaign as well as Multiplayer, the real meat of the game lies in it’s custom games.
To start off, it’s essential to mention that the game boasts a total of 19 different nations – 27 with DLCs, each with their own traits that can help shape their play style. This, mixed with a robust game creation menu; changing map geography, game speed, winning conditions among other settings, gives the game longevity due to its high replayability.
As I said before you start the game with a Settlers unit and a Warriors Unit. And so the first order of business is finding the most suitable tile to settle your city on. Once your capital is established, your management duties truly begin.
Beforeyou start, there are different resources to manage, and I shall break it down into three categories with further explanation.
Currency:
Gold: Gold can be earned through trading, buildings in cities or from passives of your government and/or civilization. It’s also commonly used to buy and sell with other nations.
Faith: Either through specific structures or passives that benefits your people, this one can also be used to buy special units and buildings when you invest into it. It also allows you to build a pantheon, granting your benefits to your people, and even from a religion down the line.
What’s more special about Gold and Faith is that they can also be used to purchase units and structures as well as Great People – Special units that can give you huge advantage, depending on their specialty (Great Prophet can create religion, Great Artist can create a work of art that gives you bonuses and prestige, Great general can level up a unit or simply buff them with his presence, etc).
Advancement:
Culture: Determines at which rate your governments evolves, opening up new governing policies. These policies grant you special cards that you can use to boost your civilization’s bonuses and help you shape your kingdom to what you want it to be; a military juggernaut or trading hub, among others. This resource can be also earned through specific buildings or passives. Accomplishing certain side objectives can grant you Inspiration which halves the time needed to study a certain policy. Also higher culture means faster boarder expansion.
Science: Determines how many turns are needed to research a new technology, opening up new buildings to build and units to recruit. Like Culture, doing certain objectives can speed up a research and this is called Eureka.
Miscellaneous:
Food: Governs the speed at which your population grows. So make sure your population’s needs are met, otherwise you face starvation and penalties. Earned mostly through specific structures or tiles, as well as trading in some cases.
Housing: Plain and simple, you can’t have a bigger population without expanding your housing to harbor them. Special structures and government policies can offer this much needed resource.
Amenities: Gained through owning or trading for luxury goods, this resource manages your populace’s happiness, with positive giving your bonuses and negative risks causing a riot in your city where this resource is lacking. Building camps around exotic animals or specific buildings around certain luxury resources can increase it, but also government policies and special buildings.
Luxury and special resources: this includes exotic animals, iron, oil, and uranium among many others, and these can not only increase your amenities but also be used to trade with other nations for gold or simply resources you may lack.
Phew, with all of that information out of the way, how does it all come together?
Well, glad to report that no matter your playstyle, the game’s robust research, civic and nations’ system can be played and enjoyed whatever you choose to play as. Want to be a trading civilization with emphasis on getting gold – like myself? I was racking hundreds upon hundreds of gold pieces each turn, allowing me to buy a lot of anything if needed. Want to play as the conquering marauder? There is plenty of policies with boosts to combat performance and a huge variety of units to throw at your enemy. Hey, you came into this wanting to be the most cultured and sophisticated civilization? Artists and musicians will flock to your city, so will tourists and the adoration of neighboring friendlies. There is always a downside to each of these but that’s easily expected as one cannot simply have it all, and with this one you don’t need to, because you can play and play again, experimenting until you find that perfect set up; and THAT is rewarding.
But this doesn’t mean I don’t have any bones to pick with Civilisation VI, because of some changes that were made that I’m not honestly liking thus far. Most noticeably of these is the new Worker units that can no longer build roads until you reach renaissance Era, making the first three stages of the game a sludge to go through with units moving at a crawl. Yes now roads will automatically build when you establish a trading route between two cities, but it limits the strategic placement of roads, like in Civ 5, that eased mobility throughout my territory so that I could deploy my units much more easily. Also you no longer start with a Scout unit(replaced by a Warriors Unit), which means that you risk falling behind if you intend on looking for a suitable place to settle if the initial starting point isn’t to your liking. Units gain minimal experience beyond first level, which is somewhat illogical, as one battle makes your warriors experienced, but then the next four they learn nothing from it. I get that this could be done for balancing reasons but it’s still a pain that discourages progress.
Aside from the other nations on the map, there are also city-states that you can increase your relation with by assigning envoys – you can earn these through searching new civic policies, and these can give you major bonuses. My problem isn’t with the bonuses, but the rate at which these city-states recruit military units, and not because I tried to invade them and got destroyed, but rather because I became friendly with them early on and I had no need to build any military units because anyone that would declare war on me got simply overwhelmed. This should be a good thing, right? Not really. As a player, perhaps, because abusing the system is always fun, but as a critic I find this to be a balance issue that needs fixing.
If you’re a returning Civilization fan, than you’ll feel at home with this one, although some of the changes like the way Builders work or Great People recruitment can take getting used to. I enjoyed my time with this one and definitely see myself playing it again and again because it’s how this genre of games is built; there is always that next turn, that next research, that next policy and next step towards victory. | {
"pile_set_name": "Pile-CC"
} |
The GRIP project has provided partial support for UNC's advanced technology tracker work and is a customer for trackers designed by this team. As noted last year, the UNC optical tracker is attractive in the PIT because it is immune to the electrical noise created by the motors in the PHANToM. This electrical noise causes significant error in our current commercial magnetic trackers. The new lightweight optical tracker was deployed early in the reporting period and has undergone testing, calibration and algorithmic refinement during this reporting period with RMS noise of 0.1 mm in position and 0.03 degrees in orientation. The system measures position and orientation in a 26 by 30 foot working area and makes 1500 to 2000 measurements per second with less than 1 millisecond of latency. Software has been developed and tested for multiple simultaneous trackers operating under the same ceiling (n = 2 currently) to support deployment of this tracker in the PIT. Experiments were conducted to determine an optimal pattern of tracker ceiling tiles (the tracker's LED beacon system is located in the tiles) for the PIT two-user configuration. We expect to deploy the tracker over the PIT before the end of March 1998. | {
"pile_set_name": "NIH ExPorter"
} |
Ludwig Gramminger
Ludwig Gramminger, also known as "Wiggerl" Gramminger (June 11, 1906 – August 28, 1997) was a German Alpinist and one of the pioneers of modern mountain rescue techniques. He was born in Munich. In 1925 he joined the Alpine mountain rescue service. A skilled climber, he pioneered the use of stretch rail and the use of steel rope to lower one of the rescuers to the base of the wall. He also pioneered the so-called Gramminger seat named after him. One of the better-publicised uses of his technique was during the 1957 rescue of an Italian climber, Claudio Corti, from the North Wall of the Eiger. Gramminger died in Munich, aged 91.
Category:German mountain climbers
Category:People from Munich
Category:Officers Crosses of the Order of Merit of the Federal Republic of Germany
Category:1906 births
Category:1997 deaths | {
"pile_set_name": "Wikipedia (en)"
} |
The present invention disclosed herein relates to a semiconductor device, and more particularly, to a semiconductor device having a local silicon-on-insulator (SOI) structure and a method of forming the same.
The present invention has been derived from research undertaken as a part of IT R & D program of the Ministry of Information and Communication and Institution of Information Technology Association (MIC/IITA) [2006-S-004-02], integrated development of silicon-based high-speed optical interconnection IC.
A semiconductor device formed on a silicon-on-insulator (SOI) substrate may have high radiation tolerance and latch-up immunity, restrain the short channel effect, and operate with low power consumption, by means of a buried oxide (BOX) layer buried in a substrate under the device. Furthermore, the semiconductor device can operate at a high speed because an operating region of the semiconductor device is capacitively insulated from the substrate.
There are mainly two types of methods for forming a typical SOI substrate. One is a wafer bonding method that bonds two wafers with an oxide layer therebetween. The other is a separation by implanted oxygen (SIMOX) method. In the SIMOX method, a high concentration oxygen ion implanted layer is formed at a predetermined depth of a silicon wafer by implanting oxygen ions from the surface of the silicon wafer. Subsequently, the silicon wafer is thermally treated to form a BOX layer.
In the wafer bonding method, a SOI substrate can be obtained by bonding two silicon wafers with an oxide layer having a thickness of more than 1 micrometer. In this case, the broader the surface area of the wafer is, the more difficult it is to ensure proper bonding and uniformity of wafer thickness.
Also, a BOX layer must be formed with a thickness of more than 1 micrometer in order to integrate an optical element and an electrical element onto the SOI substrate. Accordingly, a high concentration (of greater than 5×1018 atom/cm2) ion implantation is required to form a BOX layer having a thickness of 1 mm in the SIMOX method. However, a high concentration ion implantation may increase the threading dislocation density, the oxide precipitate density and the lattice defects of silicon, and cause silicon inclusions and pinholes in the BOX layer. Subsequently, the reliability and the operating characteristics of a semiconductor device may be deteriorated. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
function to get the name of any method?
I would like to have a function called GetMethodName such that the following code would print "myMethod":
int myMethod(string foo, double bar)
{
// ...
}
Console.Out.WriteLine(GetMethodName(myMethod));
This should work no matter what the method signature myMethod has. Is this possible?
A:
No, it's not possible like that. It would be possible with the mythical infoof operator which the C# team would like to include, but haven't got round to yet - but without that, you'd have to use a method group conversion, which will only work if you know the specific type of delegate to use.
The closest you can probably come is to use an expression tree:
public static string GetMethodName(Expression expression)
{
// Code to take apart the expression tree and find the method invocation
}
GetMethodName(() => myMethod(0, 0));
That wouldn't actually need to call myMethod, but you would need to provide dummy arguments - which could be irritating if there are any out/ref parameters.
A:
As pointed out on Eric Lippert's blog you could fake it with the Action and Func delegates
public static MethodInfo GetInfo<T>(Action<T> action)
{
return action.Method;
}
public static MethodInfo GetInfo<T, TResult>(Func<T, TResult> func)
{
return func.Method;
}
public static MethodInfo GetInfo<T, U, TResult>(Func<T, U, TResult> func)
{
return func.Method;
}
public static int Target(int v1, int v2)
{
return v1 ^ v2;
}
static int Main(string[] args)
{
var mi = GetInfo<string[], int>(Main);
Console.WriteLine(mi.Name);
var mi2 = GetInfo<int, int, int>(Target);
Console.WriteLine(mi2.Name);
return 0;
}
A:
What about this?
public static string GetMethodName(Expression<Action> exp)
{
var b = (MethodCallExpression)exp.Body;
return b.Method.Name;
}
// ...
var name = GetMethodName(() => myMethod(string.Empty, 0.0));
System.Out.WriteLine(name);
| {
"pile_set_name": "StackExchange"
} |
Send this page to someone via email
Prime Minister Justin Trudeau is urging both men and women to embrace the word “feminist.”
Speaking at a panel on gender equality at the World Economic Forum in Davos, Switzerland on Friday, Trudeau called on both men and women to use the word “feminist.”
“We shouldn’t be afraid of the word feminist, men and women should use it to describe themselves anytime they want,” Trudeau said.
The prime minister, who calls himself a feminist, was addressing gender parity and said that men need to be a part of the discussion to close the gender gap.
WATCH: Trudeau says gender balance in government brings ‘better decision making’
3:00 Trudeau says gender balance in government brings ‘better decision making’ Trudeau says gender balance in government brings ‘better decision making’
Trudeau was on the panel with with Melinda Gates and Facebook COO Sheryl Sandberg and spoke about how his wife and “incredible partner” Sophie reminds him to talk to his son “about how he treats women and how he’s going to grow up to be a feminist just like dad.”
Story continues below advertisement
Trudeau has made gender equality a priority during his time as prime minister, promising during the campaign to appoint a diverse cabinet with equal representation of men and women. He also gained international attention shortly after assuming office when he defended his gender-balanced cabinet to a reporter by saying “Because it’s 2015.”
WATCH: Convincing women to run for politics is difficult, ‘frustrating’
3:06 Trudeau: Convincing women to run for politics is difficult, ‘frustrating’ Trudeau: Convincing women to run for politics is difficult, ‘frustrating’
“We have made it very explicit that gender balance and diversity as well, not just for its own sake; because you’re getting better decision making…you’re getting a government that reflects the reality of a broad population you’re supposed to serve.” | {
"pile_set_name": "OpenWebText2"
} |
The present invention pertains to an internal combustion engine ignition control system. More particularly, the present invention pertains to an electronic ignition control system for generating a spark to ignite the fuel within a cylinder of an internal combustion engine at the optimum time to assure maximum fuel efficiency and engine performance.
The operating performances of an internal combustion engine is dependent, at least in part, on the point during the cycle of operation of each cylinder at which the fuel is ignited. The time of ignition affects the fuel efficiency, the amount of power generated by the engine, and the smoothness of engine operation. Mechanical means for controlling the ignition time are available, but generally these are cumbersome devices of questionable accuracy, often involving weights and springs to control the operating time of various components, and such mechanical components are inherently inaccurate and subject to operating fluctuations. | {
"pile_set_name": "USPTO Backgrounds"
} |
27 A.3d 116 (2011)
131 Conn.App. 903
HSBC BANK USA, National Association, Trustee (NAAC 2007-2),
v.
Dahill DONOFRIO et al.
No. 32042.
Appellate Court of Connecticut.
Argued September 12, 2011.
Decided September 27, 2011.
DIPENTIMA, C.J., and BEACH and PETERS, Js.
PER CURIAM.
The judgment is affirmed and the case is remanded for the purpose of setting a new law day.
| {
"pile_set_name": "FreeLaw"
} |
Q:
the application stopped when stop playing the sound
I created my Android app to play sound when user select option value on i did my code well. All thing worked well but when i added my code to make user mute or stop the sound when click on lock button at his mobile it worked well but when i rotate the mobile horizontal the error " the application stopped unexpectedly " occurred. I checked my code and i reached that the error at onPause method .
@Override
protected void onResume() {
IntentFilter intentFilter = new IntentFilter();
intentFilter.addAction(Intent.ACTION_SCREEN_OFF);
registerReceiver(new IntentListener(), intentFilter);
super.onResume();
}
@Override
protected void onPause() {
IntentFilter intentFilter = new IntentFilter();
super.onPause(); // Don't forget this line
mp.pause(); // Or whatever the function is to pause it
unregisterReceiver(new IntentListener());
}
@Override
public void onConfigurationChanged(Configuration newConfig) {
super.onConfigurationChanged(newConfig);
setContentView(R.layout.activity);
}
<activity
android:name="xx"
android:label="@string/app_name"
android:configChanges="orientation|keyboardHidden|screenSize">
06-25 13:59:31.442: W/KeyCharacterMap(331): No keyboard for id 0
06-25 13:59:31.442: W/KeyCharacterMap(331): Using default keymap: /system/usr/keychars/qwerty.kcm.bin
06-25 13:59:31.592: D/AndroidRuntime(331): Shutting down VM
06-25 13:59:31.603: W/dalvikvm(331): threadid=1: thread exiting with uncaught exception (group=0x4001d800)
06-25 13:59:31.672: E/AndroidRuntime(331): FATAL EXCEPTION: main
06-25 13:59:31.672: E/AndroidRuntime(331): java.lang.RuntimeException: Unable to pause activity {com.ramadan/com.ramadan.Ramadan}: java.lang.NullPointerException
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.ActivityThread.performPauseActivity(ActivityThread.java:3348)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.ActivityThread.performPauseActivity(ActivityThread.java:3305)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.ActivityThread.handlePauseActivity(ActivityThread.java:3288)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.ActivityThread.access$2500(ActivityThread.java:125)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:2044)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.os.Handler.dispatchMessage(Handler.java:99)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.os.Looper.loop(Looper.java:123)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.ActivityThread.main(ActivityThread.java:4627)
06-25 13:59:31.672: E/AndroidRuntime(331): at java.lang.reflect.Method.invokeNative(Native Method)
06-25 13:59:31.672: E/AndroidRuntime(331): at java.lang.reflect.Method.invoke(Method.java:521)
06-25 13:59:31.672: E/AndroidRuntime(331): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:868)
06-25 13:59:31.672: E/AndroidRuntime(331): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:626)
06-25 13:59:31.672: E/AndroidRuntime(331): at dalvik.system.NativeStart.main(Native Method)
06-25 13:59:31.672: E/AndroidRuntime(331): Caused by: java.lang.NullPointerException
06-25 13:59:31.672: E/AndroidRuntime(331): at com.ramadan.Ramadan.onPause(Ramadan.java:125)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.Activity.performPause(Activity.java:3842)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.Instrumentation.callActivityOnPause(Instrumentation.java:1190)
06-25 13:59:31.672: E/AndroidRuntime(331): at android.app.ActivityThread.performPauseActivity(ActivityThread.java:3335)
06-25 13:59:31.672: E/AndroidRuntime(331): ... 12 more
A:
You will get lots more information if you look at the logcat output from your crash, as it will give you the reason for the exception. However, just looking at the above code, you cannot call registerReceiver() and unregisterReceiver() with different instances, they must be the same object. The call to unregisterReceiver() is likely filing with an exception saying that receiver instance was never registered before. Your code needs to look more like this:
//We need a reference to this instance somehow
private IntentListener listener = new IntentListener();
@Override
public void onResume() {
IntentFilter intentFilter = new IntentFilter();
intentFilter.addAction(Intent.ACTION_SCREEN_OFF);
registerReceiver(listener, intentFilter);
super.onResume();
}
@Override
public void onPause() {
super.onPause();
unregisterReceiver(listener); //must be the same instance you registered!
}
| {
"pile_set_name": "StackExchange"
} |
Curcumin decreases oxidative stress in mitochondria isolated from liver and kidneys of high-fat diet-induced obese mice.
Oxidative stress plays a key role in obesity and diabetes-related mitochondrial dysfunction. Mitochondrial dysfunction is characterized by increased oxidative damage, nitric oxide (NO) synthesis, and a reduced ratio of adenosine-5'-triphosphate (ATP) production/oxygen consumption. Curcumin represents a potential antioxidant and anti-inflammatory agent. In this study, our objective was to determine the effect of curcumin treatment on oxidative stress and mitochondrial dysfunction in high-fat diet (HFD)-induced obese mice (OM). These results suggest that curcumin treatment increased oxygen consumption and significantly decreased lipid and protein oxidation levels in liver mitochondria isolated from HFD-induced OM compared with those in the untreated OM (UOM). In kidney mitochondria, curcumin treatment significantly increased oxygen consumption and decreased lipid and protein peroxidation levels in HFD-induced OM when compared with those in UOM. Curcumin treatment neither has any effect on body weight gain nor have any effects on mitochondrial NO synthesis. These findings suggest that obesity induces oxidative stress and mitochondrial dysfunction, whereas curcumin may have a protective role against obesity-induced oxidative stress and mitochondrial dysfunction. | {
"pile_set_name": "PubMed Abstracts"
} |
Pre-Doctoral Internship in Clinical Psychology
The department sponsors an APPIC approved independent, full-time pre-doctoral internship in clinical psychology. Supervised by full and part time psychology faculty of the department, the internship provides an excellent training opportunity in both adults and child psychology, with a focus on psychological care in a rural area. Didactics are provided as well as supervision of clinical care. Clinical care is primarily located in the Marshall Department of Psychiatry and Behavioral Medicine outpatient offices, but clinical opportunities also exist in medical outpatient settings and inpatient psychiatry hospital settings. | {
"pile_set_name": "Pile-CC"
} |
Sabbar Kashur wanted to be a person, a person like everybody else. But as luck would have it, he was born Palestinian. It happens. His chances of being accepted as a human being in Israel are nil. Married and a father of two, he wanted to work in Jerusalem, his city, and maybe also have an affair or a quickie on the side. That happens too.
He knew that he had no chance with the Jews, so he adopted another name for himself, Dudu. He didn't have curly hair, but he went by Dudu just the same. That's how everyone knew him. That's how you know a few other Arabs too: the car-wash guy you call Rafi, the stairwell cleaner who goes by Yossi, the supermarket deliveryman you know as Moshe.
What's wrong? Is it only fearsome Shin Bet interrogators like "Capt. George" and "Abu Faraj" who are allowed to adopt names from other peoples? Are only Israelis who emigrate allowed to invent new identities? Only the Yossi from Hadera who became Joe in Miami, the Avraham from Bat Yam who became Abe in Los Angeles?
Open gallery view Palestinian Sabbar Kashur, who was convicted of raping a woman after impersonating a Jew Credit: Emil Salman
No longer a youth, Sabbar/Dudu worked as a deliveryman for a lawyer's office, rode his scooter around Jerusalem and delivered documents, affidavits and sworn testimonies, swearing to everyone that he was Dudu. Two years ago he met a woman by chance. Nice to meet you, my name is Dudu. He claims that she came on to him, but let's leave the details aside. Soon enough they went where they went and what happened happened, all by consent of the parties concerned. One fine day, a month and a half after an afternoon quickie, he was summoned to the police on suspicion of rape.
His temporary lover discovered that her Dudu wasn't a Dudu after all, that the Jew is (gasp! ) an Arab, and so she filed a complaint against the impostor. Her body was violated by an Arab. From then on Kashur was placed under house arrest for two years, an electronic cuff on his ankle. This week his sentence was pronounced: 18 months in jail.
Judge Zvi Segal waxed dramatic to the point of absurdity: "It is incumbent on the court to protect the public interest from sophisticated, smooth, sweet-talking offenders who can mislead naive victims into paying an unbearable price: the sanctity of their bodies and souls." Sophisticated offenders? It is doubtful that Dudu even knew he was one. Sweet talk? He says that even his wife calls him Dudu.
The court relied, as usual, on precedents: the man who posed as a senior Housing Ministry official and promised his lover an apartment and an increased National Insurance pension, and the man who posed as a wealthy neurosurgeon who promised free medical care and other perks. Dudu had nothing to offer but his good name, Dudu, and still his fate was sealed, just like those who promise apartments and perks. Not only fraud, but rape, almost like the convicted serial rapist Benny Sela.
Supreme Court Justice Elyakim Rubinstein had, after all, defined the test of conviction for rape on "false pretenses": "if in the view of an ordinary person this woman would have agreed to have sexual relations with a man who did not have the identity he invented."
In tune with the public, Kashur's judges assumed, rightly, that the woman would not have gotten into bed with Dudu were it not for the identity he invented. She also might not have gotten into bed with him if he had told her in vain that he was available, that he was younger than he really is or even that he is madly in love with her. But people are not prosecuted for that, certainly not on rape charges.
Now the respected judges have to be asked: If the man was really Dudu posing as Sabbar, a Jew pretending to be an Arab so he could sleep with an Arab woman, would he then be convicted of rape? And do the eminent judges understand the social and racist meaning of their florid verdict? Don't they realize that their verdict has the uncomfortable smell of racial purity, of "don't touch our daughters"? That it expresses the yearning of the extensive segments of society that would like to ban sexual relations between Arabs and Jews?
It was no coincidence that this verdict attracted the attention of foreign correspondents in Israel, temporary visitors who see every blemish. Yes, in German or Afrikaans this disgraceful verdict would have sounded much worse. | {
"pile_set_name": "OpenWebText2"
} |
module HaddockTySyn where
type T = Int -- ^ Comment on type synonym RHS
| {
"pile_set_name": "Github"
} |
Suit Claims Misleading Antioxidant Claims by 7UP Maker
An advocacy group claims in a lawsuit that the maker of 7Up is making misleading antioxidant claims about some of its soft drinks.
The Center for Science in the Public Interest filed the suit on behalf of a consumer who believed antioxidants came from fruit in 7Up Cherry Antioxidant, Mixed Berry Antioxidant, and Pomegranate Antioxidant, report Reuters, the Associated Press and a press release. In reality, the suit says, the antioxidant is in the form of added vitamin E.
“Despite the pictures of cherries, blackberries, cranberries, raspberries, and pomegranates on various 7UP labels,” the press release says, “the drinks contain no fruit or juice of any kind.”
The federal lawsuit (PDF), filed against the Dr Pepper Snapple Group in the Central District of California, alleges violations of California consumer and business fraud laws, as well as unjust enrichment.
Dr Pepper issued a statement saying the products meet labeling requirements by the Food and Drug Administration. The company is replacing the products in February with a new formulation that won’t contain antioxidants. | {
"pile_set_name": "Pile-CC"
} |
Blood flow estimation error with intravascular ultrasound due to in-plane component of flow.
Previously, we presented a real-time method to measure blood flow perpendicular to the image plane of an intravascular ultrasound (IVUS) imaging system using a slow-time FIR (finite impulse response) filter bank. Any in-plane flow introduces error in the flow measurement using the filter bank algorithm. Simulations show that for a flow angle of +/- 10 degrees and velocities between 200 mm/s and 300 mm/s, the energy within the lowest frequency band filter is 6.92 to 7.80 times higher than for perpendicular flow in the worst case. We present a variation of the FIR filter bank algorithm, applying filter coefficients in a tilted fashion to slow-time signals (i.e., combining slow-time and fast-time). An appropriate tilt, which depends on the flow angle and velocity, corrects for the increased energy under the frequency bands. In this case, the energy under the lowest frequency band filter for an angle of +/- 10 degrees and velocities ranging from 200 mm/s to 300 mm/s is 2.09 to 2.94 times higher than for perpendicular flow, yielding greater than a factor of three improvement in the worst case over the original slow-time method. Moreover, the average energy over the vessel determined with the appropriate tilt is within 2-3% of the true value. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Crash and Reboot When Running mame.exe (MAME Emulator)
I downloaded the latest version of the MAME Emulator (version 0.142 - mame0142b.exe) from the address below recently:
http://mamedev.org/release.html
Unfortunately, when I execute the mame.exe file from the command line it just crashes (screen goes black for a second, then PC reboots by itself - no error is shown). I've tried running it without any ROMs, but still got the same problem.
I have the latest drivers installed (275.33) for my NVIDIA GeForce 6100 nForce 405. I am using Windows XP Home SP 3.
Could you please advise how to get the emulator to run without crashing?
Here is the error I received (after disabling automatic restart):
Technical Information:
STOP: 0x0000008E (0xC0000005, 0xBD1B1642, 0xB1078658, 0x00000000)
nv4_disp.dll - Address BD1BD1642 base at BD012000, DateStamp 4dd7387f
A:
I recently had this problem too with MAMEUI32 and MAME.
The cause of the fault in my case was with MAME's DirectX9 video mode. MAMEUI32 (and I assume MAME) offers the following display modes:
GDI, DirectDraw, DirectX8, DirectX9.
Only DirectX9 (i believe the default mode) reset my computer. All others work. Personally, I preferred the DirectDraw setting. I use this along with the non-hardware stretch setting, as this - though blocky - is kinder to my eyes.
If you plan to download the latest MAMEUI however (.143), note it suffers from long load-times. There are discussions on-line to help circumvent this. However, I am sticking to my old .130 version which works well.
A:
A video driver bug is the most likely culprit. Try running mame in a window instead of fullscreen with the switch -window. You could also try -video gdi.
| {
"pile_set_name": "StackExchange"
} |
People get the chance to record the song that means most to them in a heartwarming new show
The 60s were in their infancy when George ‘Joey’ Spruce led his band off-stage at The Cavern Club in Liverpool and exchanged a few words with the nervous singer preparing to go on. ‘We’d done a few songs I’d written myself, and he said how good they were. I said, “Have you written any yourself?” And he said, “We have, but they’re not that good,”’ recalls Joey, laughing.
Little wonder, given that the young man was Paul McCartney. Yes, that Paul McCartney. ‘I mean, those songs then went on to become some of the most famous in the world,’ says Joey, now 75. ‘But at the time none of us had any idea.’
The Beatles became legends of course, Joey’s band less so. Earl Preston And The TTs are still fondly remembered by a certain generation in their native Liverpool, but worldwide fame eluded them. Joey and the surviving members of his band got an unexpected chance to relive their glory days, however, when they were asked to take part in a new TV show that sees unlikely singers cut their very own record in a recording studio.
This Is My Song, a heartwarming two-parter, gives members of the public a chance to make a record that is special to them, for whatever reason. All sorts of stories – some tearjerkers – are told in the process. One of the most uplifting ones comes from Charles Michael Duke, 23. He was born with cystic fibrosis, and had just had a double lung transplant after three years on the waiting list. Seeing him sing Ella Henderson’s Yours, backed by a full choir, will have you reaching for the tissues.
Then there’s Matt Bond, 26, who plays bass guitar in the indie band Blue River. He takes the lead spot as a singer for the first time with a rendition of Basket Case by Green Day. And what’s his motivation? He has a pronounced stammer when speaking – but not when singing, and he wanted to raise awareness of the problem.
For Joey Spruce though, the appearance was a trip down memory lane. ‘I hadn’t been in a recording studio for years – and never one like this,’ he says. ‘At first the other lads were a bit Charles in the vocal booth, recording his special track funny about doing it, but I said to them, “When are we, at our age, likely to be invited on TV again?”’
Joey was pretty nervous though. He’s been through the mill health-wise recently, fighting prostate cancer, and hadn’t sung for five years until taking part in this project. ‘My confidence took a real hit because of my illness,’ he admits. ‘I was a bag of nerves, but I’m glad I did it. It was fantastic to be back with the guys, with that mic in front of me. And to have an actual copy of the record we cut too. It’s a lovely thing to have.’
The show is touching , with the surviving band members laying down instrumental tracks and vocals for Will You Still Love Me Tomorrow. All their wives are allowed into the studio for the final performance – and the tears flow all round. ‘It was magic,’ says Joey. ‘What a thing for the grandchildren to watch.’
Joey (centre) recording vocals, with three of his bandmates from Earl Preston And The TTs. Right: the band in 1963 | {
"pile_set_name": "Pile-CC"
} |
Discipleship1, 358:is a gap in the bridge where the soul is and you jump from the lower to the higher Triad. ThisEducation, 99:and I am unable to really aid your thought if I jump you forward two hundred years into a | {
"pile_set_name": "Pile-CC"
} |
Author: AEA
Interview questions Geoff Hill: Some archaeologists are after Cleopatra, others are more into Coleoptera! This blog entry will host Geoff Hill, a PhD student at Queen’s University Belfast, who has kindly shared some insights from his young career as an more »
We are delighted to announce the availability of the AEA Conference Fund to members of the AEA (of at least six months standing) to assist attendance at the York conference (6-8 November 2015). Priority will be given to those with more »
John Evans (1941-2005) was an inspirational environmental archaeologist, responsible for advancing the discipline and fostering many of today’s top researchers in the field. To honour the memory of John and his achievements within environmental archaeology, the Association for Environmental Archaeology more »
The 36th Annual Association for Environmental Archaeology Conference, 2015 will take place in York, UK. This special conference will be a celebration of the career and research of Terry O’Connor. Terry who retired earlier in 2015, has been an influential figure in more »
The AEA are supporting a session taking place on the Sunday of the Theoretical Roman Archaeology Conference this year (Sunday 29th March), on “Integrating Environmental and Theoretical Roman Archaeology”. TRAC 2015 is taking place at the University of Leicester, and more »
The AEA has been invited to collaborate with the Archaeological Reference Resources Project. The aim of the project is to enable English Heritage and the wider archaeological community to gain a better understanding of what Reference Resources are being used in the more »
AEA student blog. Interview with Julia Best: As part of this blog’s mission to provide young researchers with a glimpse into current research and career development in the field of Environmental Archaeology, we would like to introduce you to Julia more »
We are pleased to announce that the Association is one of the supporters of the up coming conference on the Environmental Archaeology of European Cities. Which will be held at the Royal Belgian Institute of Natural Sciences, Brussels, May 27-29th, more »
There are also a limited number of grants for members to attend the AEA conference in Plymouth, 7th-9th November. (Preference given to those with little or no access to other sources of funding. Please apply as soon as possible. Application form
Welcome to the AEA student blog! The Association for Environmental Archaeology encourages interaction between researchers in the field, and this includes young researchers who are interested in learning more about opportunities for development and networking. This blog will give you more » | {
"pile_set_name": "Pile-CC"
} |
Business Networking
Toggle menu
The Networking Scorecard Mobile App
13Nov2017
The Networking Scorecard Mobile App
Network on the Go with the “Networking Like a Pro” Networking Scorecard Mobile App
It’s easy to feel like networking is a waste of time —but that just means you’re doing it wrong. In this new edition of “Networking Like a Pro”, networking experts Dr. Ivan Misner and Brian Hilliard reveal key networking techniques to help you grow your business. Now, the power of networking smarter comes to your smartphone.
In this comprehensive app, your mobile device now becomes your networking tool. You will discover strategies that go beyond collecting business cards and turn networking into a profitable resource for your business. Dive into this app based on the book. Discover how the most successful networkers leverage their brand, expertise, and customers to achieve greatness in life.
In the book, “Networking Like a Pro”, you will learn how to attract the right people with a carefully crafted “Unique Selling Proposition” to gain your most valuable customers with referrals from networking partners. Plus, discover how to make your best first impression with the “12 x 12 x 12 Rule”. Learn how to decide which networking events and activities will best fit your needs. Finally, build and expand your network with a calculated follow-up strategy. Finally, learn to avoid behaviors that damage your reputation and push potential partners away.
Access resources, worksheets and templates from Dr. Misner, Brian Hilliard, BNI, and Asentiv designed to help you get the most out of your network.
And most importantly, measure if you are Networking Like a Pro!
In business, you achieve what you measure. Now you can take all of the “Networking Like a Pro” action items from the book with you on the go. The Networking Scorecard™ App provides you with a mobile solution to measuring your networking efforts. If you’re ready to build connections that turn relationships into profitable customers, this mobile app is for you! | {
"pile_set_name": "Pile-CC"
} |
Pirates Add Five, DFA Duke, LaRoche, Delwyn
Duke was designated for assignment to clear space for the Rule 5 additions.
The Pittsburgh Pirates have added five players to the 40-man roster to protect them from the upcoming Rule 5 draft, and designated Zach Duke, Andy LaRoche, and Delwyn Young for assignment. The five players added were Jeff Locke, Daniel Moskos, Tony Watson, Kyle McPherson, and as reported here earlier, Michael Crotta.
The moves to clear space are a surprise, at least in terms of timing. With guys like Brian Burres and Chris Leroux on the 40-man roster, you would think that the Pirates would remove those options before getting rid of Duke and LaRoche. Duke and LaRoche were at risk of being non-tendered prior to the December 2nd deadline, and the Pirates now have 10 days to try and trade each player, so their...
To continue reading the rest of this article, subscribe to Pirates Prospects. Subscribers get access to every article on the site, along with all of our exclusive live coverage of the Pirates' minor league system, all for a very low monthly or yearly rate.
If you're already a member, you can log in below. If you think you're receiving this message in error, please e-mail tim@piratesprospects.com.
Tim is the owner and editor in chief of Pirates Prospects. He started the site in January 2009, and turned it into his full time job during the 2011 season. Prior to starting Pirates Prospects, Tim worked with AccuScore.com, providing MLB, NHL, and NFL coverage to various national media outlets, including ESPN Insider, USA Today, Yahoo Sports, and the Wall Street Journal. He also writes the annual Prospect Guide, which is sold through the site. Tim lives in Bradenton, where he provides live coverage all year of Spring Training, mini camp, instructs, the Bradenton Marauders, and the GCL Pirates. | {
"pile_set_name": "Pile-CC"
} |
The present invention relates to Very Large Scale Integrated (VLSI) semiconductor circuit devices and particularly to a macro structural arrangement and method for generating macros for VLSI semiconductor integrated circuits.
VLSI semiconductor circuit devices typically define complex systems including an extremely great number of circuits and multiple functional macros. The term circuit designates an entity consisting of one or two cells or areas of silicon containing circuit components. The term macro designates an entity consisting of many cells arranged for a particular function, such as a memory or a programmable logic array (PLA).
Due to the complexity and the extremely great number of circuit components or cells that must be contained on one semiconductor substrate in a VLSI device or chip, a custom design approach is not practical. The custom design approach, as is known in the art, may be defined as a technique to obtain maximum utility of the area of the semiconductor substrate, or chip, for the circuits implemented on a particular substrate, or chip, by individually designing the component locations and metalization connections for each circuit. In the custom design approach, the chip designer is unconstrained and has essentially total freedom to optimize the design to meet the density and performance requirements of the application. However, these advantages are outweighed by the inherent deficiencies of the required design time and design expense.
Various different design approaches have been proposed and utilized in the art to reduce the deficiencies of the custom design approach. One effective approach implemented by the assignee of the present application is a master-image approach that is described in Donze et al., "Masterimage Approach to VLSI Design", IEEE Computer publication December 1983 pp. 18-25 and further described in Donze et al, "PHILO-A VLSI DESIGN SYSTEM", IEEE-ACM Nineteenth Annual Automation Design Proceedings, 1982 (ISSN 0146-7123, Library of Congress No. 76-150348). The disclosures of the above-identified publications are incorporated herein by reference. The PLA macro generation program described in these publications enables the chip designer to generate a variable-size PLA macro by varying the horizontal direction with the vertical direction fixed. The selected size PLA macro is designed prior to the physical design of the chip and stored as an entity in a design library.
The master image computer design system utilizes the library of predesigned circuits and functional macros. An overall chip image for a particular VLSI device is generated utilizing selected circuits and macros from the library that are placed on the chip image and then wired automatically to generate a physical description necessary to build the masks for the desired system. Automatic placement and wiring programs consist of placement, global wiring and detailed wiring routines. A delay calculator/optimizer program is used in conjunction with these routines for optimizing performance characteristics for the desired system.
Static random access memories (RAMS) are widely used in VLSI semiconductor devices. Present master image computer design systems generate semiconductor chip designs utilizing available versions of RAM macros having fixed sizes. Many of the predesigned RAM macros have been designed by custom design technique with high circuit density in order to minimize semiconductor area and to provide high performance characteristics for the memories. This custom RAM macro design approach, while providing individual, fixed size RAM macros with the advantages of high integration density and high speed, does not facilitate the generation or design of an individual RAM macro with a selected storage capacity. To the contrary, generating a design or physical description for a particular RAM macro having a particular desired storage capacity is normally a very time consuming and difficult task. Accordingly, chip designers typically select one of the available RAM macros from the library that has sufficient size for his particular application. | {
"pile_set_name": "USPTO Backgrounds"
} |
NOT FOR PUBLICATION FILED
UNITED STATES COURT OF APPEALS DEC 21 2018
MOLLY C. DWYER, CLERK
U.S. COURT OF APPEALS
FOR THE NINTH CIRCUIT
PATRICK BERGSRUD, No. 17-17181
Plaintiff-Appellant, D.C. No. 2:14-cv-01592-RFB-GWF
v.
MEMORANDUM*
BANK OF AMERICA, N.A., FKA
Countrywide Home Loans Servicing LP, as
Successor by merger to BAC Home Loans
Servicing, LP; et al.,
Defendants-Appellees.
Appeal from the United States District Court
for the District of Nevada
Richard F. Boulware II, District Judge, Presiding
Submitted December 17, 2018**
Before: WALLACE, SILVERMAN, and McKEOWN, Circuit Judges.
Patrick Bergsrud appeals from the district court’s summary judgment in his
diversity action challenging a foreclosure sale. We have jurisdiction under 28
U.S.C. § 1291. We review de novo. Bourne Valley Court Tr. V. Wells Fargo
*
This disposition is not appropriate for publication and is not precedent
except as provided by Ninth Circuit Rule 36-3.
**
The panel unanimously concludes this case is suitable for decision
without oral argument. See Fed. R. App. P. 34(a)(2).
Bank, NA, 832 F.3d 1154, 1157 (9th Cir. 2016). We affirm.
The district court properly granted summary judgment for defendant Bank of
America, N.A. on Bergsrud’s claims to set aside the foreclosure sale and quiet title
because Bergsrud filed this action after the statute of limitations to challenge
procedural defects to the sale had run, and assuming without deciding that these
deadlines were subject to equitable tolling, Bergsrud failed to establish that
equitable tolling should apply. See Nev. Rev. Stat. § 107.080(5) and (6) (an action
to void a trustee’s sale must commence within 90 days of the date of the sale, or
120 days of the date of actual notice of the sale where the person entitled to notice
did not receive proper notice); City of N. Las Vegas v. State Local Gov’t Emp.-
Mgmt. Relations Bd., 261 P.3d 1071, 1077 (Nev. 2011) (standard under Nevada
law for equitable tolling).
The district court properly granted summary judgment on Bergsrud’s
wrongful foreclosure claim because Bergsrud failed to raise a genuine dispute of
material fact as to whether the property was not in default at the time of the
foreclosure sale. See Collins v. Union Fed. Sav. & Loan Ass’n, 662 P.2d 610, 623
(1983) (elements of a wrongful foreclosure claim under Nevada law).
We do not consider matters raised for the first time on appeal, or matters not
specifically and distinctly raised and argued in the opening brief. See Padgett v.
2 17-17181
Wright, 587 F.3d 983, 985 n.2 (9th Cir. 2009).
AFFIRMED.
3 17-17181
| {
"pile_set_name": "FreeLaw"
} |
/* Reference mpz functions.
Copyright 1997, 1999, 2000, 2001, 2002 Free Software Foundation, Inc.
This file is part of the GNU MP Library test suite.
The GNU MP Library test suite is free software; you can redistribute it
and/or modify it under the terms of the GNU General Public License as
published by the Free Software Foundation; either version 3 of the License,
or (at your option) any later version.
The GNU MP Library test suite is distributed in the hope that it will be
useful, but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General
Public License for more details.
You should have received a copy of the GNU General Public License along with
the GNU MP Library test suite. If not, see http://www.gnu.org/licenses/. */
/* always do assertion checking */
#define WANT_ASSERT 1
#include <stdio.h>
#include <stdlib.h> /* for free */
#include "gmp.h"
#include "gmp-impl.h"
#include "longlong.h"
#include "tests.h"
/* Change this to "#define TRACE(x) x" for some traces. */
#define TRACE(x)
/* FIXME: Shouldn't use plain mpz functions in a reference routine. */
void
refmpz_combit (mpz_ptr r, unsigned long bit)
{
if (mpz_tstbit (r, bit))
mpz_clrbit (r, bit);
else
mpz_setbit (r, bit);
}
unsigned long
refmpz_hamdist (mpz_srcptr x, mpz_srcptr y)
{
mp_size_t xsize, ysize, tsize;
mp_ptr xp, yp;
unsigned long ret;
if ((SIZ(x) < 0 && SIZ(y) >= 0)
|| (SIZ(y) < 0 && SIZ(x) >= 0))
return ULONG_MAX;
xsize = ABSIZ(x);
ysize = ABSIZ(y);
tsize = MAX (xsize, ysize);
xp = refmpn_malloc_limbs (tsize);
refmpn_zero (xp, tsize);
refmpn_copy (xp, PTR(x), xsize);
yp = refmpn_malloc_limbs (tsize);
refmpn_zero (yp, tsize);
refmpn_copy (yp, PTR(y), ysize);
if (SIZ(x) < 0)
refmpn_neg (xp, xp, tsize);
if (SIZ(x) < 0)
refmpn_neg (yp, yp, tsize);
ret = refmpn_hamdist (xp, yp, tsize);
free (xp);
free (yp);
return ret;
}
/* (0/b), with mpz b; is 1 if b=+/-1, 0 otherwise */
#define JACOBI_0Z(b) JACOBI_0LS (PTR(b)[0], SIZ(b))
/* (a/b) effect due to sign of b: mpz/mpz */
#define JACOBI_BSGN_ZZ_BIT1(a, b) JACOBI_BSGN_SS_BIT1 (SIZ(a), SIZ(b))
/* (a/b) effect due to sign of a: mpz/unsigned-mpz, b odd;
is (-1/b) if a<0, or +1 if a>=0 */
#define JACOBI_ASGN_ZZU_BIT1(a, b) JACOBI_ASGN_SU_BIT1 (SIZ(a), PTR(b)[0])
int
refmpz_kronecker (mpz_srcptr a_orig, mpz_srcptr b_orig)
{
unsigned long twos;
mpz_t a, b;
int result_bit1 = 0;
if (mpz_sgn (b_orig) == 0)
return JACOBI_Z0 (a_orig); /* (a/0) */
if (mpz_sgn (a_orig) == 0)
return JACOBI_0Z (b_orig); /* (0/b) */
if (mpz_even_p (a_orig) && mpz_even_p (b_orig))
return 0;
if (mpz_cmp_ui (b_orig, 1) == 0)
return 1;
mpz_init_set (a, a_orig);
mpz_init_set (b, b_orig);
if (mpz_sgn (b) < 0)
{
result_bit1 ^= JACOBI_BSGN_ZZ_BIT1 (a, b);
mpz_neg (b, b);
}
if (mpz_even_p (b))
{
twos = mpz_scan1 (b, 0L);
mpz_tdiv_q_2exp (b, b, twos);
result_bit1 ^= JACOBI_TWOS_U_BIT1 (twos, PTR(a)[0]);
}
if (mpz_sgn (a) < 0)
{
result_bit1 ^= JACOBI_N1B_BIT1 (PTR(b)[0]);
mpz_neg (a, a);
}
if (mpz_even_p (a))
{
twos = mpz_scan1 (a, 0L);
mpz_tdiv_q_2exp (a, a, twos);
result_bit1 ^= JACOBI_TWOS_U_BIT1 (twos, PTR(b)[0]);
}
for (;;)
{
ASSERT (mpz_odd_p (a));
ASSERT (mpz_odd_p (b));
ASSERT (mpz_sgn (a) > 0);
ASSERT (mpz_sgn (b) > 0);
TRACE (printf ("top\n");
mpz_trace (" a", a);
mpz_trace (" b", b));
if (mpz_cmp (a, b) < 0)
{
TRACE (printf ("swap\n"));
mpz_swap (a, b);
result_bit1 ^= JACOBI_RECIP_UU_BIT1 (PTR(a)[0], PTR(b)[0]);
}
if (mpz_cmp_ui (b, 1) == 0)
break;
mpz_sub (a, a, b);
TRACE (printf ("sub\n");
mpz_trace (" a", a));
if (mpz_sgn (a) == 0)
goto zero;
twos = mpz_scan1 (a, 0L);
mpz_fdiv_q_2exp (a, a, twos);
TRACE (printf ("twos %lu\n", twos);
mpz_trace (" a", a));
result_bit1 ^= JACOBI_TWOS_U_BIT1 (twos, PTR(b)[0]);
}
mpz_clear (a);
mpz_clear (b);
return JACOBI_BIT1_TO_PN (result_bit1);
zero:
mpz_clear (a);
mpz_clear (b);
return 0;
}
/* Same as mpz_kronecker, but ignoring factors of 2 on b */
int
refmpz_jacobi (mpz_srcptr a, mpz_srcptr b)
{
ASSERT_ALWAYS (mpz_sgn (b) > 0);
ASSERT_ALWAYS (mpz_odd_p (b));
return refmpz_kronecker (a, b);
}
/* Legendre symbol via powm. p must be an odd prime. */
int
refmpz_legendre (mpz_srcptr a, mpz_srcptr p)
{
int res;
mpz_t r;
mpz_t e;
ASSERT_ALWAYS (mpz_sgn (p) > 0);
ASSERT_ALWAYS (mpz_odd_p (p));
mpz_init (r);
mpz_init (e);
mpz_fdiv_r (r, a, p);
mpz_set (e, p);
mpz_sub_ui (e, e, 1);
mpz_fdiv_q_2exp (e, e, 1);
mpz_powm (r, r, e, p);
/* Normalize to a more or less symmetric range around zero */
if (mpz_cmp (r, e) > 0)
mpz_sub (r, r, p);
ASSERT_ALWAYS (mpz_cmpabs_ui (r, 1) <= 0);
res = mpz_sgn (r);
mpz_clear (r);
mpz_clear (e);
return res;
}
int
refmpz_kronecker_ui (mpz_srcptr a, unsigned long b)
{
mpz_t bz;
int ret;
mpz_init_set_ui (bz, b);
ret = refmpz_kronecker (a, bz);
mpz_clear (bz);
return ret;
}
int
refmpz_kronecker_si (mpz_srcptr a, long b)
{
mpz_t bz;
int ret;
mpz_init_set_si (bz, b);
ret = refmpz_kronecker (a, bz);
mpz_clear (bz);
return ret;
}
int
refmpz_ui_kronecker (unsigned long a, mpz_srcptr b)
{
mpz_t az;
int ret;
mpz_init_set_ui (az, a);
ret = refmpz_kronecker (az, b);
mpz_clear (az);
return ret;
}
int
refmpz_si_kronecker (long a, mpz_srcptr b)
{
mpz_t az;
int ret;
mpz_init_set_si (az, a);
ret = refmpz_kronecker (az, b);
mpz_clear (az);
return ret;
}
void
refmpz_pow_ui (mpz_ptr w, mpz_srcptr b, unsigned long e)
{
mpz_t s, t;
unsigned long i;
mpz_init_set_ui (t, 1L);
mpz_init_set (s, b);
if ((e & 1) != 0)
mpz_mul (t, t, s);
for (i = 2; i <= e; i <<= 1)
{
mpz_mul (s, s, s);
if ((i & e) != 0)
mpz_mul (t, t, s);
}
mpz_set (w, t);
mpz_clear (s);
mpz_clear (t);
}
| {
"pile_set_name": "Github"
} |
[Anxiety disorders in children and adolescents].
Anxiety disorders are the most common psychiatric illnesses in children and adolescents. They are associated with significant distress and impairment. Most of the children and adolescents with anxiety disorders are not detected and only a minority receives adequate treatment. Anxious children and adolescents often follow a chronic course of disease with elevated risk of depressive disorders, substance abuse and even suicide. Risk factors for anxiety disorders are complex and consist of intricate interplay of multiple factors, including genetic makeup and environmental risks. Effective, evidence-based treatments for anxiety disorders in children and adolescents consist of cognitive-behavioral therapy and pharmacotherapy with serotonin specific reuptake inhibitors. Further research is needed to design high-quality screening tools for anxiety disorders in the primary care setting. | {
"pile_set_name": "PubMed Abstracts"
} |
Predictors of asymptomatic Clostridium difficile colonization on hospital admission.
Clostridium difficile (CD) is the leading cause of health care-associated diarrhea and can result in asymptomatic carriage. Rates of asymptomatic CD colonization on hospital admission range from 1.4%-21%. The objective of this study was to evaluate host and bacterial factors associated with colonization on admission. The Consortium de recherche québécois sur le Clostridium difficile study provided data for analysis, including demographic information, known risk factors, and potential confounding factors, prospectively collected for 5,232 patients from 6 hospitals in Quebec and Ontario over 15 months from 2006-2007. Stool or rectal swabs were obtained for culture on admission. Pulsed-field gel electrophoresis was performed on the isolates. The presence of antibody against CD toxins A and B was measured. There were 212 (4.05%) patients colonized with CD on admission, and 5,020 patients were not colonized with CD. Multivariate logistic regression analysis showed that hospitalization within the last 12 months, use of corticosteroids, prior CD infection, and presence of antibody against toxin B were associated with colonization on admission. Of patients colonized on admission, 79.4% had non-NAP1, non-NAP2 strains. There are identifiable risk factors among asymptomatic CD carriers that could serve in their detection and provide a basis for targeted screening. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
MYSQL: Get result twice based on if statement
i'm trying to get from each department from the dept table, the number of rich AND poor employees from the employee table.
So far I was able to get one of each but can't seem to figure how to get both rich and poor written on two rows for each dept.
SELECT Depts.Department, IF (Employees.Salary>100000, 'Rich', 'Poor'),
COUNT(*) FROM `Employees`, `Depts`
WHERE Depts.Dept = Employees.Dept
GROUP BY Depts.Department
thanks for any help
A:
including your IF logic in GROUP BY
SELECT Depts.Department, IF (Employees.Salary>100000, 'Rich', 'Poor'),
COUNT(*) FROM `Employees`, `Depts`
WHERE Depts.Dept = Employees.Dept
GROUP BY Depts.Department, IF (Employees.Salary>100000, 'Rich', 'Poor')
| {
"pile_set_name": "StackExchange"
} |
Project Description
A set of libraries which extend the NUnit constraint framework to support deeper comparisons and report detailed differences useful to test debugging.
In NUnit there are a set of classes that support the Assert.That(actual, ...) style of assertions. This library builds and extends those classes. Where the base classes do a very good job of letting you compare simple values, such as a string, or a number,
they are less optimal for anything more complex.
If you want to compare non-ordered collections, you'll only get a pass/fail for the description, rather than a list of what items didn't match. This library provides a way to get detailed, even nested detail about what failed. For example:
XDocument {} should have matched the expected value, but did not.
property Root XElement {letter} should have matched the expected value, but did not.
method Nodes Collections did not match
XElement {salutation} should have matched the expected value, but did not.
method Nodes Collections did not match
XText {} should have matched the expected value, but did not.
property Value String lengths are both 12. Strings differ at index 1.
Expected: "Expected Text"
But was: "Actual Text"
In addition, as you can see above, it's not limited to comparing the same type of object, which is useful when comparing a legacy interface or domain object to a replacement which must have similar behavior.
Using the library is fairly straightforward since it uses the existing Assert.That constructs to create additional constraints and then can evaluate these on demand.
This class compares two Xml Attributes from two separate but Xml implementations. As you can see defining the way to compare them involves defining a set of constraints, using the same classes you would have used with Assert.That and adding these to this custom
classes constraint list. Optionally as well you can provide "name" values for each object to improve descriptions of a mismatch and speed of comparisons. | {
"pile_set_name": "Pile-CC"
} |
import tensorflow as tf
import numpy as np
writer = tf.python_io.TFRecordWriter("trainArray.tfrecords")
for _ in range(100):
randomArray = np.random.random((1,3))
array_raw = randomArray.tobytes()
example = tf.train.Example(features=tf.train.Features(feature={
"label": tf.train.Feature(int64_list=tf.train.Int64List(value=[0])),
'img_raw': tf.train.Feature(bytes_list=tf.train.BytesList(value=[array_raw]))
}))
writer.write(example.SerializeToString())
writer.close()
| {
"pile_set_name": "Github"
} |
New Zealand troops behaved according to the relevant rules of engagement in Afghanistan in 2010 and were not responsible for civilian casualties, contrary to claims that have resurfaced lately, the New Zealand Defence Force (NZDF) said Tuesday in a statement.
MOSCOW (Sputnik) — The armed forces were responding to the allegations made in "Hit & Run," a book released earlier in the day in New Zealand that suggested six civilians died and 15 were injured during a raid by New Zealand, US and Afghan troops of two Afghan villages in 2010.
According to the The Guardian newspaper, the NZDF said an investigation into the 2010 events had already been conducted, and now the NZDF stood by its 2011 statement, which said that the probe had "concluded that the allegations of civilian casualties were unfounded."
"The NZDF is confident that New Zealand personnel conducted themselves in accordance with the applicable rules of engagement," the NZDF said, as quoted by the newspaper.
According to media reports, the book's authors, Nicky Hager and Jon Stephenson, used multiple interviews of the villages' residents, as well as the soldiers of New Zealand and Afghan armed forces.
The book reportedly alleged that the attack was a retaliation for the death of New Zealand's Lt. Tim O'Donnell and that the soldiers did not help wounded civilians. | {
"pile_set_name": "OpenWebText2"
} |
This application is a Continuation of U.S. patent application Ser. No. 11/882,211, filed on Jul. 31, 2007 now U.S. Pat. No. 7,733,280, which is a Continuation of International Application Number PCT/US2006/004779, filed on Feb. 13, 2006, which claims the benefit of the filing date of U.S. Provisional Application Ser. No. 60/651,627, filed on Feb. 11, 2005, which is incorporated by reference herein. | {
"pile_set_name": "USPTO Backgrounds"
} |
type=item
items=minecraft:rotten_flesh
texture=./l2.png
nbt.display.Name=ipattern:*Revenant Horror II*
weight=2 | {
"pile_set_name": "Github"
} |
In a speech to the Polish people Thursday, President Donald Trump credited his leadership for eliciting "billions and billions of dollars more" in NATO spending from member countries.
“Americans know that a strong alliance of free, sovereign and independent nations is the best defense for our freedoms and for our interests. That is why my administration has demanded that all members of NATO finally meet their full and fair financial obligation,” he said in Warsaw. “As a result of this insistence, billions of dollars more have begun to pour into NATO. In fact, people are shocked. But billions and billions of dollars more are coming in from countries that, in my opinion, would not have been paying so quickly.”
Related: Donald Trump in Poland Takes on North Korea, Russia
Let our news meet your inbox. The news and stories that matters, delivered weekday mornings. This site is protected by recaptcha
Trump's not wrong to say that NATO spending is up. But there's no evidence to support the president's claim that he's responsible. According to NATO's 2017 estimates released last week, member nations have been committing steadily more to defense spending since 2014. Spending is up so far this year — but it was up last year, too, and the year before that.
How NATO works
NATO is an intergovernmental military alliance between 29 nations, which, crucially, have all vowed to consider an attack on one member nation an attack on all — as they did after the September 11 attacks. To ensure a hearty defense on the part of all nations, the treaty requests members spend 2 percent of their GDP on defense spending.
It’s a spending “guideline” not a “financial obligation,” but the president is correct that few nations meet the 2 percent guideline (just six are expected to this year, up from five last year). America spends the most, with 3.58 percent of its GDP, according to NATO’s 2017 estimates.
Billions more...since at least 2014
After years of defense expenditures declining globally, NATO members who were not meeting the spending guideline vowed to try and increase their defense spending at a 2014 summit in Wales. Members already committing 2 percent or more vowed to try and keep it up. At the time, the group credited new threats including Russian aggression and a destabilized Middle East as a reason to refocus efforts.
The White House did not respond to a request to substantiate the president's claim that “as a result of this insistence, billions of dollars more have begun to pour into NATO."
As for NATO’s specific coffers, just $1.54 billion goes to the NATO organization specifically, funding its headquarters and military force with a strict funding agreement approved by the group. For that, America, Germany, and France bear the biggest burdens, in that order. | {
"pile_set_name": "OpenWebText2"
} |
Demaryius Thomas became must-see TV by gluing his eyes to the TV. His size needs no embellishment — 6-foot-3 and 227 pounds as of Thursday — but high-profile big receivers litter the NFL’s landfill.
Stardom for Thomas hinged on practice. When he was playing for Georgia Tech, the team passed kidney stones easier than it passed the ball downfield. In a sport of sudden improvisations and breathtaking athleticism, Thomas needed precision.
He needed to learn to run routes.
“I watched video of Calvin Johnson, Larry Fitzgerald and Brandon Marshall, big guys who do it well,” Thomas said Thursday at Broncos headquarters of his viewing sessions with former position coach and current offensive coordinator Adam Gase. “I wanted to try to be better than them. I love the physical part of the game. But I wanted to be a receiver, not just a big guy playing receiver.”
Gase worked tirelessly with Thomas, going through patterns after practice. He said Thursday that Thomas reveled in it. Thomas’ evolution can be found in statistics. He caught 54 passes, including six for touchdowns, in his first two NFL seasons. He hauled in 186 receptions, including 24 for touchdowns, the past two years.
This coming season, Emmanuel Sanders will flank him in the slot — “Sanders is too fast. He’s quick and fast at the same time,” Thomas said — and the Broncos high-powered offense will have a dash of nitromethane at its disposal, potentially creating more opportunities for Thomas.
“Our thing is that we try to stay with what we do. You don’t want to get too far out of the box,” Gase said before adding, “but at the same time, you try to experiment a little bit.”
It’s tempting for the Broncos to use Thomas even more. Lost in the carnage of the Super Bowl loss to the Seahawks, Thomas set a Super Bowl record with 13 catches.
“It was tough. I didn’t even know about the record until later that night,” he said. “My main focus was on the game, because we went out and we didn’t show up at all. Hopefully we can put ourselves in the same situation and play better.”
Thomas’ performance in Super Bowl XLVIII created appreciation and pause. He suffered an injury to his left shoulder late in the game, but did not separate it.
“It was tough,” he said Thursday. “I got knocked around. … But I am fine. I am great. If I had to play (the next week), I could have.”
Numbers linger around Thomas beyond those on the back of his trading card. Eric Decker, a good friend, is no longer a Bronco, in part because of the talent of the Thomases. Demaryius Thomas and Julius Thomas become unrestricted free agents after the 2014 season. The Broncos want to keep them. Demaryius stands in line for a substantial raise. He will make $3.275 million this year. Denver could place the franchise tag on him after the season, which would cost no less than $12.3 million.
A long-term contract creates salary cap friendliness, but there has been no dialogue at this point. The Broncos have a history of making an aggressive attempt to sign core players before training camp, with all-pro offensive tackle Ryan Clady a recent example.
There are seven NFL wide receivers whose contracts average $10 million per season — and six with $20 million guaranteed. Thomas is better than most of them. But, unlike the Cowboys’ Dez Bryant this week, Thomas downplays money talk.
“I never think about that. I don’t even know if Decker (now with the Jets) was talking about it (last year). All we talked about was being able to play with each other again. He wanted to come back, but it just didn’t work out,” Thomas said. “You really never think about the big payday, or anything like that. We like playing together, and I like playing football.”
As in years past, Thomas relaxed in February, letting his body heal from “the 16-game grind.” He continues to use a nutritionist and is considering playing at 223 pounds this season.
A former quiet kid, he entered his news conference Thursday looking like a human stop sign with red pants and red shoes. It was a bit of a taunt, given that so few can slow him down.
“It’s a combination of size, speed, ability to do things after the catch with the ball, go track the ball,” Denver defensive coordinator Jack Del Rio said of Thomas. “There are a lot of big, talented guys, but not everybody can run precise routes and understand how to get off press and get off jams and read coverages and all those things. He’s worked hard at all that and he’s a really good player for us to go against every day.”
Troy E. Renck: trenck@denverpost.com or twitter.com/troyrenck | {
"pile_set_name": "OpenWebText2"
} |
Vector NTI Advance® 11.5.4
Version 11.5.4 includes the following features:
Workflow support for new GeneArt® Seamless Cloning and High-Order Genetic Assembly and Parts Assembly
Improved workflow for querying TaqMan® Gene Expression Assays online
Applied Biosystems® 3500 System file format support
Primer template alignment display and reporting
Update to the NCBI query format
Feature and performance improvements including local database storage capabilities
Important: You should back up your local database regularly, and always before updating Vector NTI Advance® software.
Try Vector NTI Advance® 11.5.4 for 30 days
Click the 'Download' button to get started. Then click the ‘get my trial license key’ to get your license key. Paste this Trial License Number in the corresponding field and click on the ‘Apply’ button. This update will install directly and seamlessly on top of v11.5.x and will recognize your existing local database automatically.
Following downloading and installation, this software is fully functional with a trial license key for 30 days.
Vector NTI® Vector Archives
These Vector NTI Advance® Archive files contain fully annotated Invitrogen™ vector sequences and maps. Simply download and save the files to your computer, then drag-and-drop them into your Vector NTI Advance® Local Database to import and use these vectors. | {
"pile_set_name": "Pile-CC"
} |
Category: Cataract
Optometrists are getting more and more involved in the care of post-operative cataract patients, both in hospital and in community practice. I have recently authored an article looking at this area in order to give some clinical tips on how to carry out these assessments. This is now published in the August edition of Optometry […]
A reasonable part of my current hospital role is involved in carrying out cataract assessment clinics, for those patients referred into the hospital for consideration of cataract surgery. These referrals mainly come from our community optometry colleagues, which I hasten to add are generally of a high standard, and occasionally also from GPs. I thought […] | {
"pile_set_name": "Pile-CC"
} |
Differential cardiovascular regulatory activities of the alpha 1B- and alpha 1D-adrenoceptor subtypes.
The regulation of cardiac and vascular function by the alpha 1B- and alpha 1D-adrenoceptors (ARs) has been assessed in two lines of transgenic mice, one over-expressing a constitutively active alpha 1B-AR mutation (alpha 1B-ARC128F) and the other an alpha 1D-AR knockout line. The advantage of using mice expressing a constitutively active alpha 1B-AR is that the receptor is tonically active, thus avoiding the use of nonselective agonists that can activate all subtypes. In hearts from animals expressing alpha 1B-ARC128F, the activities of the mitogen-activated protein kinases, extracellular signal-regulated kinase, and c-Jun N-terminal kinase were significantly elevated compared with nontransgenic control animals. Mice over-expressing the alpha 1B-ARC128F had echocardiographic evidence of contractile dysfunction and increases in chamber dimensions. In isolated-perfused hearts or left ventricular slices from alpha 1B-ARC128F-expressing animals, the ability of isoproterenol to increase contractile force or increase cAMP levels was significantly decreased. In contrast to the prominent effects on the heart, constitutive activation of the alpha 1B-AR had little effect on the ability of phenylephrine to induce vascular smooth muscle contraction in the isolated aorta. The ability of phenylephrine to stimulate coronary vasoconstriction was diminished in alpha 1D-AR knockout mice. In alpha 1D-AR knockout animals, no negative effects on cardiac contractile function were noted. These results show that the alpha1-ARs regulate distinctly different physiologic processes. The alpha 1B-AR appears to be involved in the regulation of cardiac growth and contractile function, whereas the alpha 1D-AR is coupled to smooth muscle contraction and the regulation of systemic arterial blood pressure. | {
"pile_set_name": "PubMed Abstracts"
} |
Stone tools represent one of the most commonly preserved
stylized artifacts in Polynesian sites, and adzes in particular have been used
since the turn of the century to assess relationships among island settlements.
Initially typological in nature (Duff 1959; Figueroa and Sanchez 1965; Emory
1968), these studies have increasingly looked at the process of stone tool
manufacture, especially for adzes (Leach and Leach 1980; Leach and Witter 1987,
McCoy 1990), and at the petrographic and chemical characteristics of the stone
itself as markers of resource use patterns (Cleghorn et al. 1985; Ayres
and Beardsley 1988; Ayres et al. 1997; Weisler 1990, 1993, 1997;
Beardsley et al. 1991, 1996; n.d.; Lass 1994). Finished tools as well as
the various byproducts of their manufacture all represent important indicators
of the procurement and distribution systems of interest to archaeologists.
The Rapanui (Easter Island) Stone Adz Project
Rapanui's significance in anthropological study of cultural
evolution and adaptation is also closely linked to and archaeologically
reflected in the unusual elaboration of stone working on the island. Its fame is
largely tied to the production and transportation of stone statues; however,
understanding the basic stone tools used in day to day life is necessary to
resolve questions about many facets of prehistoric technology, production, and
social and political organization, as well as the manufacture of the stone
images.
Hard basaltic rock from quarries on Rapanui used to
manufacture adzes and axes for shaping wood and stone in the traditional
technology represents the focal point of this research. Tool-quality stone
samples, debitage, chips from adz bits, and broken adzes, are available from
archaeological sites around the island for comparison to the lithic source
material in quarries. In addition to adzes, high quality stone also was used
sometimes for producing stone fishooks and knives. We are developing data on a
sample set of stone tool manufacturing materials from selected archaeological
sites and stone quarries. This study includes a set selected for detailed
geochemical analysis. We plan to analyze additional samples for refining the
data base and for documenting artifact distributional patterns.
THE ISSUES
This paper explores issues of the social and economic
organization of lithic procurement. Such organization affects how we interpret
regional exchange networks, socially bounded territories, and elite
redistributive efforts. High quality, flakable basalt used for carefully shaped
adzes, chisels and other tools represents an important material resource in
regional procurement and distribution. Knowledge of source locations and
chemical composition data, though incomplete, are becoming more widely available
for Pacific Island contexts.
Spatial and technofunctional analyses of lithic materials are
in their infancy for Rapanui, but we expect they will be a major avenue to
understanding past life on the island.
Neither obsidian or fine grained basalt is known
ethnographically to be an integral resource in maintaining the status hierarchy;
that is, their use by the elite in redistribution is not documented. It remains
for archaeology to develop a coherent and comprehensive model for resource use
that will allow us to establish if this was the case for prehistoric Rapanui
society.
A Kin-Based Geographic Model shows a distribution that
is primarily a function of acquisition and exchange networks based on family or
simple reciprocal ties. In this model households acquired stone through exchange
networks similar to those through which other nonlocal, patchy resources were
acquired. On Rapanui, these diverse resources would include obsidian, white
trachyte, red scoria, coral, as well as perhaps localized plant resources such
as totora reed. This distributional pattern is not necessarily based on a
formal redistributive process or ranked status hierarchy.
The Centralized Redistribution model is one where the
movement of stone is facilitated and controlled by an elite or group. This is
characteristic of chiefdoms and of the use of scarce resources.
THE PRIMARY SOURCE DATA
The quarry site complex, Rua Tokitoki Quarry, is located
inland from La Perouse Bay on Rapanui's north coast and is in the eastern, Hotu
Iti section of the island. The site or series of exposures covers an area of
approximately 0.4 square kilometers and ranges in elevation from approximately
40 to 75 m. Outcrops and a number of pits, apparently for extraction of fine
quality stone, and extensive debitage piles are visible.
The pits providing access to buried lava are as much as 8-10 m
across, 2-3 m deep and are surrounded by the flakes and other refuse from
flaking hard lava to produce tool blanks. Based on the number and size of quarry
areas and the debitage from production, it is likely that thousands of stone
adzes were prepared here.
Sociopolitical Context
The La Perouse quarry complex falls within the traditional
Tupahotu "tribal" area within the larger entity called Hotu Iti (Routledge
1919) and also the "Matanui" group (Hotus et al. 1988). Our
hypothesis is that the Tupahotu were directly involved in adz and other tool
production and that they served as the source producers of these tools designed
to be exchanged with other groups on the island. This hypothesis can be tested
as more distributional data become available on the spatial patterns of the
tool-quality rock found as adzes or as debitage.
ANALYTICAL RESULTS
Twelve groupings containing multiple samples were
distinguished based on the macroscopic and microscopic examinations of 100
samples taken from 11 sites found in 9 survey quadrangles (Quad). These ranged
from very coarse material (Group 4) with distinctive petrographic features to
very fine materials with black/dark groundmass that differ only slightly from
one group or subgroup to another (See Table 1). Of these, Group 2 includes the
quarry materials sampled from Rua Tokitoki and identifies the important
geographical spread of this distinctive and prime adz quarry material. Groups 6
and 9 have the widest geographical distribution. The small set of Quad 3 samples
from the island's southwest corner shows the most distinctive set of
materials--50% of the samples belong to GRP 9--and none are from Rua Tokitoki.
CONCLUSIONS
The basalt adz-quality materials on Rapanui have considerable
potential for provenance determination at the quarry level or at the
"Group" level. As with all fingerprinting efforts based on elemental
or other data, sampling and subpopulation boundary problems are significant
issues. This pilot study has not yet addressed intra-quarry variability at Rua
Tokitoki--this will require substantial additional field observation and
sampling--however, the Rua Tokitoki material is sufficiently distinctive that it
can be differentiated petrographically from other materials. While not all group
definitions are confirmed, in all, at least 15 distinct source materials have
been distinguished. The study does demonstrate that further study could
successfully differentiate several source areas for adz-quality stone and
identify a small number of geographical locations where distinct stone was
acquired.
Tool stone distribution is significant for any discussion of
lithic provenance issues related to use of stone for purposes other than flake
stone tools, including building, statuary, and varied uses of non-basaltic rock
such as volcanic glass, pumice, scoria, trachyte, and coral rock. Each of these
uses represents a somewhat different set of issues for provenance determination
and interpretation, but taken together we would expect to get overlapping
patterns of resource extraction and use that would provide a stronger basis for
hypotheses regarding social interaction and stone as commodity.
STONE ADZES
A set of stone adzes, including small versions, called
chisels, that represent woodworking tools from Easter Island. These tools were
hafted to an L-shaped handle to form the complete tool and reflect the
long-standing practice of carving on the island. These are primarily for shaping
wood, but some adzes and pick-like tools were used for carving and finishing
stone used in building and sculpture. The two longest specimens show side views;
the others illustrate the back or "base" view of the tool. Several
methods of manufacture are represented, in order of application, percussion
flaking, pecking, and grinding; fully finished tools (toki) are typically
ground. Types from left to right: 4D, 2A, 4D, 3H? (upper), 2A (lower left),
2A/3D (lower right). Specimens originally examined in the Father Sebastian
Englert Museum, Rapa Nui.
adzset2.jpg
STONE FISHHOOKS
Stone artifacts showing a sequence of stone fishhook
manufacture from initial roughout with the initial stages of drilling the center
to finished hook form. The finished hook (matau) in the lower right was
recovered from the sea and is coral encrusted (from Hanga Papara, Cat. 361).
Methods of manufacture include, in order of use, percussion flaking, drilling,
and grinding.
While it is unusual to use material as hard as stone to grind
out a fishhook, this technique is also known elsewhere in Polynesia.
Comparison--through element geochemistry, petrographic, and other analyses
underway--of raw material refuse, debitage, from adze, knife and fishhook
manufacture may aid in determining where islanders in the past obtained the high
quality stone they selected for producing these tools.
Specimens originally examined in the Father Sebastian Englert
Museum, Rapa Nui.
hook3d.jpg
smhook.jpg
STONE KNIVES
Distinctive stone knives from Easter Island. These tools are
carefully flaked into the correct form and then ground to finish the surface and
the cutting edge (on the left in the lower specimens). These implements are made
most often of thin, laminated volcanic stone. Specimens originally seen in the
Father Sebastian Englert Museum, Rapa Nui. Ayres types: K1b and a (first three
from left); K2 (tanged); and top, K3 (variant).
RUA TOKITOKI
The general location of the Rua TokiToki area basalt quarries
on Easter Island's north coast. Major geological boundaries are indicated by
shaded areas to reflect the complex geological history of this region and the
source of the lava from a small subsidiary vent on Maunga Terevaka's lower east
slope. This produced the distinctive stone used for adz production. Geological
data after Gonzalez-Ferran et al. (1968) and Baker 1967, 1993; Baker et al.
1974), Ayres et al. (1998, n.d.).
Microphotograph of thin section of adze stone material from a
workshop site (RR) on the South Coast. Un-aligned plagioclase of varied sizes
dominates along with augite, occasional very large plagioclase crystals and rare
olivine. This contrasts with the Rua Tokitoki material in composition and size
characteristics.
we3rr2.jpg
Plot showing relationship of the rare-earth element Lanthanum
(La) in parts per million (ppm) compared to percent sodium (Na20) in rock
quarried from the Rua Tokitoki area ("Quarry") and used for
manufacturing flake stone tools, stone adzes in particular. The distinctness of
the quarry area and stone from other sources on the island is indicated by the
spatial separation of the samples. Material from one occupation site, EI35-8,
shows another distinct source. (Gordon Goles and William S. Ayres).
1972 Easter Island's Position in
the Prehistory of Polynesia. Journal of the Polynesian Society 81(1):
57-69.
Figueroa, Gonzalo, and E. Sanchez
1965 Adzes from certain Islands of
Eastern Polynesia. In Reports of the Norwegian Expedition to Easter
Island and the East Pacific, Vol. 2.Miscellaneous Papers. edited
by T. Heyerdahl and E.N. Ferdon, Jr., pp. 169-224. Stockholm: School of
American Research and Kon Tiki Museum. | {
"pile_set_name": "Pile-CC"
} |
Q:
Android app crashes on intent
My app is working fine, I have a main menu, but on the main menu when I hit "play" , my app crashing, here is the logcat when i'm pressing the button:
07-07 08:35:34.505: E/AndroidRuntime(4072): FATAL EXCEPTION: main
07-07 08:35:34.505: E/AndroidRuntime(4072): Process: com.example.theball, PID: 4072
07-07 08:35:34.505: E/AndroidRuntime(4072): java.lang.RuntimeException: Unable to start activity ComponentInfo{com.example.theball/com.example.theball.MainActivity}: android.view.InflateException: Binary XML file line #30: Error inflating class com.android.internal.widget.ActionBarContainer
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2205)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:2255)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.ActivityThread.access$800(ActivityThread.java:142)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1203)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.os.Handler.dispatchMessage(Handler.java:102)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.os.Looper.loop(Looper.java:136)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.ActivityThread.main(ActivityThread.java:5118)
07-07 08:35:34.505: E/AndroidRuntime(4072): at java.lang.reflect.Method.invokeNative(Native Method)
07-07 08:35:34.505: E/AndroidRuntime(4072): at java.lang.reflect.Method.invoke(Method.java:515)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:794)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:610)
07-07 08:35:34.505: E/AndroidRuntime(4072): at dalvik.system.NativeStart.main(Native Method)
07-07 08:35:34.505: E/AndroidRuntime(4072): Caused by: android.view.InflateException: Binary XML file line #30: Error inflating class com.android.internal.widget.ActionBarContainer
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.LayoutInflater.createView(LayoutInflater.java:620)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.LayoutInflater.createViewFromTag(LayoutInflater.java:696)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.LayoutInflater.rInflate(LayoutInflater.java:755)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.LayoutInflater.inflate(LayoutInflater.java:492)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.LayoutInflater.inflate(LayoutInflater.java:397)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.LayoutInflater.inflate(LayoutInflater.java:353)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.android.internal.policy.impl.PhoneWindow.generateLayout(PhoneWindow.java:3242)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.android.internal.policy.impl.PhoneWindowEx.generateLayout(PhoneWindowEx.java:20)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.android.internal.policy.impl.PhoneWindow.installDecor(PhoneWindow.java:3305)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.android.internal.policy.impl.PhoneWindow.setContentView(PhoneWindow.java:334)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.android.internal.policy.impl.PhoneWindow.setContentView(PhoneWindow.java:328)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.Activity.setContentView(Activity.java:1993)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.example.theball.MainActivity.onCreate(MainActivity.java:44)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.Activity.performCreate(Activity.java:5275)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1087)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2169)
07-07 08:35:34.505: E/AndroidRuntime(4072): ... 11 more
07-07 08:35:34.505: E/AndroidRuntime(4072): Caused by: java.lang.reflect.InvocationTargetException
07-07 08:35:34.505: E/AndroidRuntime(4072): at java.lang.reflect.Constructor.constructNative(Native Method)
07-07 08:35:34.505: E/AndroidRuntime(4072): at java.lang.reflect.Constructor.newInstance(Constructor.java:423)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.LayoutInflater.createView(LayoutInflater.java:594)
07-07 08:35:34.505: E/AndroidRuntime(4072): ... 26 more
07-07 08:35:34.505: E/AndroidRuntime(4072): Caused by: java.lang.OutOfMemoryError
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.graphics.BitmapFactory.nativeDecodeAsset(Native Method)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.graphics.BitmapFactory.decodeStream(BitmapFactory.java:587)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.graphics.BitmapFactory.decodeResourceStream(BitmapFactory.java:422)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.graphics.drawable.Drawable.createFromResourceStream(Drawable.java:840)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.content.res.Resources.loadDrawable(Resources.java:2150)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.content.res.TypedArray.getDrawable(TypedArray.java:602)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.View.<init>(View.java:3565)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.view.ViewGroup.<init>(ViewGroup.java:470)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.widget.FrameLayout.<init>(FrameLayout.java:101)
07-07 08:35:34.505: E/AndroidRuntime(4072): at android.widget.FrameLayout.<init>(FrameLayout.java:97)
07-07 08:35:34.505: E/AndroidRuntime(4072): at com.android.internal.widget.ActionBarContainer.<init>(ActionBarContainer.java:52)
07-07 08:35:34.505: E/AndroidRuntime(4072): ... 29 more
Here is my MainActivity:
package com.example.theball;
import android.annotation.SuppressLint;
import android.app.Activity;
import android.content.Context;
import android.content.Intent;
import android.content.pm.ActivityInfo;
import android.graphics.Canvas;
import android.graphics.Point;
import android.graphics.drawable.ShapeDrawable;
import android.graphics.drawable.shapes.OvalShape;
import android.hardware.Sensor;
import android.hardware.SensorEvent;
import android.hardware.SensorEventListener;
import android.hardware.SensorManager;
import android.os.Bundle;
import android.view.Display;
import android.widget.ImageView;
public class MainActivity extends Activity implements SensorEventListener {
private SensorManager sensorManager;
private Sensor accelerometer;
@SuppressWarnings("unused")
private long lastUpdate;
AnimatedView animatedView = null;
ShapeDrawable mDrawable = new ShapeDrawable();
public static int x;
public static int y;
public static final int width = 50;
public static final int height = 50;
public boolean firstDraw = true;
private int screen_width;
private int screen_height;
@Override
protected void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
// setContentView(R.layout.activity_main);
setRequestedOrientation (ActivityInfo.SCREEN_ORIENTATION_PORTRAIT);
sensorManager = (SensorManager) getSystemService(SENSOR_SERVICE);
accelerometer = sensorManager
.getDefaultSensor(Sensor.TYPE_ACCELEROMETER);
lastUpdate = System.currentTimeMillis();
animatedView = new AnimatedView(this);
setContentView(animatedView);
}
@Override
protected void onResume() {
super.onResume();
sensorManager.registerListener(this, accelerometer,
SensorManager.SENSOR_DELAY_GAME);
}
@Override
protected void onPause() {
super.onPause();
sensorManager.unregisterListener(this);
}
@Override
public void onAccuracyChanged(Sensor arg0, int arg1) {
// TODO Auto-generated method stub
}
@Override
public void onSensorChanged(SensorEvent event) {
// TODO Auto-generated method stub
if (event.sensor.getType() == Sensor.TYPE_ACCELEROMETER) {
x -= (int) event.values[0];
y += (int) event.values[1];
if(x <= 0 || x >= screen_width || y <= 0 || y >= screen_height) {
Intent myIntent = new Intent(this, SplashScreen.class);
startActivity(myIntent);
}
}
}
public class AnimatedView extends ImageView {
Display display = getWindowManager().getDefaultDisplay();
Point size = new Point();
static final int width = 50;
static final int height = 50;
@SuppressLint("NewApi")
public AnimatedView(Context context) {
super(context);
// TODO Auto-generated constructor stub
display.getSize(size);
screen_width = size.x;
screen_height = size.y;
mDrawable = new ShapeDrawable(new OvalShape());
mDrawable.getPaint().setColor(0xffffAC23);
mDrawable.setBounds(0, 0, screen_width, screen_height);
}
@Override
protected void onDraw(Canvas canvas) {
mDrawable.setBounds(x, y, x + width, y + height); // left top right bottom
if(firstDraw) {
x = screen_width / 2;
y = screen_height / 2;
firstDraw = false;
}
mDrawable.draw(canvas);
invalidate();
}
}
}
Here is my android manifest:
<?xml version="1.0" encoding="utf-8"?>
<manifest xmlns:android="http://schemas.android.com/apk/res/android"
package="com.example.theball"
android:versionCode="1"
android:versionName="1.0" >
<uses-sdk
android:minSdkVersion="18"
android:targetSdkVersion="19" />
<application
android:allowBackup="true"
android:icon="@drawable/ic_launcher"
android:label="@string/app_name"
android:theme="@style/CustomActionBarTheme" >
<activity
android:name="com.example.theball.SplashScreen"
android:label="@string/app_name"
android:screenOrientation="portrait"
android:theme="@android:style/Theme.Black.NoTitleBar" >
<intent-filter>
<action android:name="android.intent.action.MAIN" />
<category android:name="android.intent.category.LAUNCHER" />
</intent-filter>
</activity>
<activity android:name="com.example.theball.MainActivity" />
<activity android:name="com.example.theball.help"/>
</application>
</manifest>
TY :) if you need something more just ask :)
A:
this is happening because of setContentView(animatedView); in the MainActivity.java.
It is causing OutOfMemoryError
So if you are using an emulator then increase your RAM size or otherwise try to reduce the size of the images etc you are using.
| {
"pile_set_name": "StackExchange"
} |
---
abstract: 'We study a variant of a problem considered by Dinaburg and Sinaĭ on the statistics of the minimal solution to a linear Diophantine equation. We show that the signed ratio between the Euclidean norms of the minimal solution and the coefficient vector is uniformly distributed modulo one. We reduce the problem to an equidistribution theorem of Anton Good concerning the orbits of a point in the upper half-plane under the action of a Fuchsian group.'
address:
- 'Department of Mathematical Sciences, University of Aarhus, Ny Munkegade Building 530, 8000 Aarhus C, Denmark'
- 'School of Mathematical Sciences, Tel Aviv University, Tel Aviv 69978, Israel'
author:
- 'Morten S. Risager'
- Zeév Rudnick
title: On the statistics of the minimal solution of a linear Diophantine equation and uniform distribution of the real part of orbits in hyperbolic spaces
---
[^1]
Statement of results {#sec:statements}
====================
For a pair of coprime integers $(a,b)$, the linear Diophantine equation $ax-by=1$ is well known to have infinitely many integer solutions $(x,y)$, any two differing by an integer multiple of $(b,a)$. Dinaburg and Sinaĭ [@DinaburgSinaui:1990a] studied the statistics of the “minimal” such solution $v'=(x_0,y_0)$ when the coefficient vector $v=(a,b)$ varies over all primitive integer vectors lying in a large box with commensurate sides. Their notion of “minimality” was in terms of the $L^\infty$-norm $|v'|_\infty:=\max(|x_0|,|y_0|)$, and they studied the ratio $|v'|_\infty/|v|_\infty$, showing that it is uniformly distributed in the unit interval. Other proofs were subsequently given by Fujii [@Fujii:1992a] who reduced the problem to one about modular inverses, and then used exponential sum methods, in particular a non-trivial bound on Kloosterman sums, and by Dolgopyat [@Dolgopyat:1994a], who used continued fractions.
In this note, we consider a variant of the question by using minimality with respect to the Euclidean norm $|(x,y)|^2:=x^2+y^2$ and study the ratio $|v'|/|v|$ of the Euclidean norms as the coefficient vector varies over a large ball. In this case too we find uniform distribution, in the interval $[0,1/2]$. However, the methods involved appear quite different, as we invoke an equidistribution theorem of Anton Good [@Good:1983a] which uses harmonic analysis on the modular curve.
A lattice point problem
-----------------------
We recast the problem in slightly more general and geometric terms. Let $L\subset \C$ be a lattice in the plane, and let ${\operatorname{area}}(L)$ be the area of a fundamental domain for $L$. Any primitive vector $v$ in $L$ can be completed to a basis $\{v,v'\}$ of $L$. The vector $v'$ is unique up to a sign change and addition of a multiple of $v$. In the case of the standard lattice $\Z[\sqrt{-1}]$, taking $v=(a,b)$ and $v'=(x,y)$, the condition that $v$, $v'$ give a basis of $\Z[\sqrt{-1}]$ is equivalent to requiring $ay-bx=\pm 1$. The question is: If we pick $v'$ to minimize the length $|v'|$ as we go through all possible completions, how does the ratio $|v'|/|v|$ between the lengths of $v'$ and $v$ fluctuate? It is easy to see (and we will prove it below) that the ratio is bounded, indeed that for a minimizer $v'$ we have $$\frac{|v'|}{|v|} \leq \frac 12 +O(\frac 1{|v|^4})\;.$$ We will show that the ratio $|v'|/|v|$ is uniformly distributed in $[0,1/2]$ as $v$ ranges over all primitive vectors of $L$ in a large (Euclidean) ball.
We refine the problem slightly by requiring that the lattice basis $\{v,v'\}$ is oriented positively, that is ${\operatorname{Im}}(v'/v)>0$. Then $v'$ is unique up to addition of an integer multiple of $v$. For the standard lattice $\Z[\sqrt{-1}]$ and $v=(a,b)$, $v'=(x,y)$ the requirement is then that $ay-bx=+1$. Define the [*signed*]{} ratio by $$\rho(v):=\pm |v'|/|v|$$ where we chose $|v'|$ minimal, and the sign is $+$ if the angle between $v$ and $v'$ is acute, and $-$ otherwise.
\[unif dist of rho\] As $v$ ranges over all primitive vectors in the lattice $L$, the signed ratio $\rho(v)$ is uniformly distributed modulo one.
Explicitly, let $L_{prim}(T)$ be the set of primitive vectors in $L$ of norm $|v|\leq T$. It is well known that $$\#L_{prim}(T) \sim \frac 1{\zeta(2)}
\frac{\pi}{{\operatorname{area}}(L)} T^2, \quad T\to \infty$$ Theorem \[unif dist of rho\] states that for any fixed subinterval $[\alpha,\beta]\in (-1/2,1/2]$, $$\frac 1{\#L_{prim}(T)} \{v\in L_{prim}(T): \alpha<\rho(v)<\beta \}
\to \beta-\alpha$$ as $T\to \infty$.
Equidistribution of real parts of orbits
----------------------------------------
We will reduce Theorem \[unif dist of rho\] by geometric arguments to a result of Anton Good [@Good:1983a] on uniform distribution of the orbits of a point in the upper half-plane under the action of a Fuchsian group.
Let $\G$ be discrete, co-finite, non-cocompact subgroup of $\slr$. The group $\slr$ acts on the upper half-plane $\H=\{z\in \C:
{\operatorname{Im}}(z)>0\}$ by linear fractional transformations. We may assume, possibly after conjugation in $\slr$, that $\infty$ is a cusp and that the stabilizer $\G_{\!\infty}$ of $\infty$ in $\G$ is generated by $$\pm {\left(\begin{array}{cc}
1 & 1 \\
0 & 1
\end{array}\right) }$$ which as linear fractional transformation gives the unit translation $z\mapsto z+1$. (If $-I\notin \G$ there should be no $\pm$ in front of the matrix). The group $\G=\sl$ is an example of such a group. We note that the imaginary part of $\g(z)$ is fixed on the orbit $\G_{\!\infty}\g z$, and that the real part modulo one is also fixed on this orbit. Good’s theorem is
\[equidistribution\] Let $\G$ be as above and let $z\in\H$. Then ${\operatorname{Re}}(\G z)$ is uniformly distributed modulo one as ${\operatorname{Im}}(\g z)\to 0$.
More precisely, let $$(\GinfmodG)_{\varepsilon,z}=\{\g\in\GinfmodG : {\operatorname{Im}}{\g z}>\varepsilon\}\;.$$ Then for every continuous function $f\in C(\R\slash \Z)$, as $\varepsilon\to 0$, $$\frac 1{ \#(\GinfmodG)_{\varepsilon,z}}
\sum_{\g\in(\GinfmodG)_{\varepsilon,z}}f({\operatorname{Re}}{\g z})
\to\int_{\R\slash\Z}f(t)dt \;.$$
Though the writing in [@Good:1983a] is not easy to penetrate, the results deserve to be more widely known. We sketch a proof of Theorem \[equidistribution\] in appendix \[sec:spectral\], assuming familiarity with standard methods of the spectral theory of automorphic forms.
[**Acknowledgements:**]{} We thank Peter Sarnak for his comments on an earlier version and for alerting us to Good’s work.
A geometric argument {#sec:Geom}
====================
We start with a basis $\{v,v'\}$ for the lattice $L$ which is oriented positively, that is ${\operatorname{Im}}(v'/v)>0$. For a given $v$, $v'$ is unique up to addition of an integer multiple of $v$. Consider the parallelogram $P(v,v')$ spanned by $v$ and $v'$. Since $\{v,v'\}$ form a basis of the lattice $L$, $P(v,v')$ is a fundamental domain for the lattice and the area of $P(v,v')$ depends only on $L$, not on $v$ and $v'$: ${\operatorname{area}}(P(v,v'))={\operatorname{area}}(L)$.
Let $\mu(L)>0$ be the minimal length of a nonzero vector in $L$: $$\mu(L)=\min\{ |v|:0\neq v\in L\}\;.$$
Any minimal vector $v'$ satisfies $$\label{upper bd on v'}
|v'|^2\leq (\frac{|v|}2 )^2 + (\frac {{\operatorname{area}}(L)} {|v|})^2 \;.$$ Moreover, if $|v|>2{\operatorname{area}}(L)/\mu(L)$ then the minimal vector $v'$ is unique up to sign.
To see , note that the height of the parallelogram $P$ spanned by $v$ and $v'$ is ${\operatorname{area}}(P)/|v| =
{\operatorname{area}}(L)/|v|$. If $h$ is the height vector, then the vector $v'$ thus lies on the affine line $h+\R v$ so is of the form $h+tv$. After adding an integer multiple of $v$ we may assume that $|t|\leq 1/2$, a choice that minimizes $|v'|$, and then $$|v'|^2 = t^2|v|^2+ |h|^2\leq \frac 14 |v|^2 +
(\frac{{\operatorname{area}}(L)}{|v|})^2 \;.$$
We now show that for $|v|\gg_L 1$, the minimal choice of $v'$ is unique if we assume ${\operatorname{Im}}(v'/v)>0$, and up to sign otherwise: Indeed, writing the minimal $v'$ as above in the form $v'=h+tv$ with $|t|\leq 1/2$, the choice of $t$ is unique unless we can take $t=1/2$, in which case we have the two choices $v'=h\pm
v/2$. To see that $t=\pm 1/2$ cannot occur for $|v|$ sufficiently large, we argue that if $v'=h+v/2$ then we must have $2 h=2v'-v\in
L$. The length of the nonzero vector $2h$ must then be at least $\mu(L)$. Since $|h|={\operatorname{area}}(L)/|v|$ this gives $2{\operatorname{area}}(L)/|v|\geq \mu(L)$, that is $$|v|\leq \frac{2{\operatorname{area}}(L)}{\mu(L)}$$ Hence $v'$ is uniquely determined if $|v|>2{\operatorname{area}}(L)/\mu(L)$.
Let $\alpha=\alpha_{v,v'}$ be the angle between $v$ and $v'$, which takes values between $0$ and $\pi$ since ${\operatorname{Im}}(v'/v)>0$. As is easily seen, for any choice of $v'$, $\sin\alpha_{v,v'}$ shrinks as we increase $|v|$, in fact we have:
\[lem:angle\] For any choice of $v'$ we have $$\label{upper bd on alpha}
\sin \alpha \leq \frac{{\operatorname{area}}(L)}{\mu(L)}\frac 1{|v|} \;.$$
To see , note that the area of the fundamental parallelogram $P(v,v')$ is given in terms of $\alpha$ and the side lengths by $${\operatorname{area}}(P) =|v| |v'|\sin \alpha$$ and since $v'$ is a non-zero vector of $L$, we necessarily have $|v'|\geq \mu(L)$ and hence, since ${\operatorname{area}}(P)={\operatorname{area}}(L)$ is independent of $v$, $$0<\sin \alpha \leq \frac{{\operatorname{area}}(L)}{\mu(L)|v|}$$ as claimed.
Note that if we take for $v'$ with minimal length, then we have a lower bound $\sin\alpha \geq 2{\operatorname{area}}(L)/|v|^2 +O( 1/|v|^6)$ obtained by inserting into the area formula ${\operatorname{area}}(L)=|v||v'|\sin\alpha$.
Given a positive basis $\{v,v' \}$, we define a measure of skewness of the fundamental parallelogram as follows: Let $\Pi_v(v')$ be the orthogonal projection of the vector $v'$ to the line through $v$. It is a scalar multiple of $v$: $$\Pi_v(v')= {\operatorname{sk}}(v,v') v$$ where the multiplier ${\operatorname{sk}}(v,v')$, which we call the [*skewness*]{} of the parallelogram, is given in terms of the inner product between $v$ and $v'$ as $$\label{exp ecc}
{\operatorname{sk}}(v,v') = \frac{\langle v',v\rangle}{|v|^2} \;.$$ Thus we see that the skewness is the real part of the ratio $v'/v$: $${\operatorname{sk}}(v,v') = {\operatorname{Re}}(v'/v) \;.$$
If we replace $v'$ by adding to it an integer multiple of $v$, then ${\operatorname{sk}}(v,v')$ changes by $${\operatorname{sk}}(v,v'+nv) = {\operatorname{sk}}(v,v') + n \;.$$ In particular, since $v'$ is unique up to addition of an integer multiple of $v$, looking at the fractional part, that is in $\R/\Z$, we get a quantity ${\operatorname{sk}}(v)\in (-1/2,1/2]$ depending only on $v$: $${\operatorname{sk}}(v) : ={\operatorname{sk}}(v,v') \mod 1 \;.$$ This is the least skewness of a fundamental domain for the lattice constructed from the primitive vector $v$.
The signed ratio $\rho(v) = \pm |v'|/|v|$ and the least skewness ${\operatorname{sk}}(v)$ are asymptotically equivalent: $$\rho(v) =
{\operatorname{sk}}(v)\left(1+O(\frac 1{|v|^2})\right) \;.
$$
In terms of the angle $0<\alpha<\pi$ between the vectors $v$ and $v'$, we have $$\label{relation between ecc and alpha}
{\operatorname{sk}}(v,v') = \frac{|v'|}{|v|}\cos\alpha \;.
$$ Our claim follows from this and the fact $\cos\alpha = \pm 1+O(1/|v|^2)$, which follows from the upper bound of Lemma \[lem:angle\].
Thus the sequences $\{\rho(v)\}$, $\{{\operatorname{sk}}(v)\}$ are asymptotically identical, hence uniform distribution of one implies that of the other. To prove Theorem \[unif dist of rho\] it suffices to show
\[unif dist of ecc\] As $v$ ranges over all primitive vectors in the lattice $L$, the least skewness ${\operatorname{sk}}(v)$ become uniformly distributed modulo one.
This result, for the standard lattice $\Z[\sqrt{-1}]$, was highlighted by Good in the introduction to [@Good:1983a]. Below we review the reduction of Theorem \[unif dist of ecc\] to Theorem \[equidistribution\].
Proof of Theorem \[unif dist of ecc\]
-------------------------------------
Our problems only depend on the lattice $L$ up to scaling. So we may assume that $L$ has a basis $L=\{1,z\}$ with $z=x+iy$ in the upper half-plane. The area of a fundamental domain for $L$ is ${\operatorname{area}}(L)={\operatorname{Im}}(z)$. Any primitive vector has the form $v=cz+d$ with the integers $(c,d)$ co-prime.
Now given the positive lattice basis $v=cz+d$ and $v'=az+b$, form the integer matrix $\g=\begin{pmatrix} a&b\\ c&d\end{pmatrix}$ , which has $\det(\g)=+1$ since $\{v,v'\}$ form a positive basis of the lattice. Thus we get a matrix in the modular group $\G=SL_2(\Z)$. Then with $\g$ applied as a Möbius transformation to $z$, the length of $v$ can be computed via $${\operatorname{Im}}(\g z) = \frac{{\operatorname{Im}}(z)}{|cz+d|^2}=\frac{{\operatorname{area}}(L)}{|v|^2}$$ The signed ratio between the lengths of $v$ and $v'$ (when $v'$ is chosen of minimal length) is $$\rho{(v)} = \pm |\gamma z| \;.$$ where the sign is $+$ if ${\operatorname{Re}}(\g z)>0$ and $-$ otherwise. Moreover, we have $${\operatorname{sk}}(v,v') = {\operatorname{Re}}(\g z)$$ Indeed, $${\operatorname{Re}}(\g z) = \frac{ac(x^2+y^2) +(ad+bc)x +bd}{|cz+d|^2}$$ which is ${\operatorname{sk}}(v,v')$ in view of . Consequently, the uniform distribution modulo one of ${\operatorname{sk}}(v)$ as $|v|\to\infty$ is then exactly the uniform distribution modulo one of ${\operatorname{Re}}(\g z)$ as $\g$ varies over $\GinfmodG$ with ${\operatorname{Im}}(\g z )\to 0$, that is Theorem \[equidistribution\].
A sketch of a proof of Good’s theorem {#sec:spectral}
=====================================
To prove Theorem \[equidistribution\], we use Weyl’s criterion to reduce it to showing that the corresponding “Weyl sums” satisfy $$\label{character asymptotics}
\sum_{\g \in(\GinfmodG)_{\varepsilon,z}}e(m{\operatorname{Re}}{\g
z})=\delta_{m=0}\frac{t_\G}{\vol{(\GmodH)}}\frac 1\varepsilon
+o(1/\varepsilon)$$ as $\varepsilon\to 0$. Here $t_\G$ equals $2$ if $-I\in \G$ and $1$ otherwise. In turn, will follow, by a more or less standard Tauberian theorem (see e.g. [@PetridisRisager:2004a p. 1035-1038]) from knowing the analytic properties of the series $$V_m(z,s):=\sum_{\g\in\GinfmodG}{\operatorname{Im}}(\g z)^se(m{\operatorname{Re}}(\g z)) \;.$$ studied also in [@Good:1981b; @Neunhoffer:1973a] Here $e(x)=\exp(2\pi i x)$. The series is absolutely convergent for ${\operatorname{Re}}(s)>1$, as is seen by comparison with the standard non-holomorphic Eisenstein series $V_0(z,s)=E(z,s)$ of weight $0$ (See [@Selberg:1989a]). For general $m$ the series is closely related to the Poincaré series $$U_m(z,s) = \sum_{\g\in\GinfmodG}{\operatorname{Im}}(\g z)^s e(m\g z)$$ studied by Selberg [@Selberg:1965a]. For a different application of the series $V_m(z,s)$, see [@Sarnak:2001a].
The analytic properties from which we can conclude Theorem \[equidistribution\] are given by
\[continuation\] The series $V_m(z,s)$ admits meromorphic continuation to ${\operatorname{Re}}(s)>1/2.$ If poles exist they are real and simple. If $m\neq 0$ then $V_m(z,s)$ is regular at $s=1$. If $m=0$ the point $s=1$ is a pole with residue $t_\G/\vol{(\GmodH)}$. Moreover, $V_m(z,s)$ has polynomial growth on vertical strips in ${\operatorname{Re}}(s)>1/2$.
[**Sketch of proof.**]{} The claim about continuation of $V_0(z,s)=E(z,s)$ is well-known and goes back to Roelcke [@Roelcke:1956a] and Selberg [@Selberg:1963a]. To handle also $m\neq 0$ we may adopt the argument of Colin de Verdière [@Colin-de-Verdiere:1983a Th' eorème 3] and of Goldfeld and Sarnak [@GoldfeldSarnak:1983a] to get the result. This is done as follows: Consider the hyperbolic Laplacian $$\Delta=-y^2\left(\frac{\partial^2 }{\partial x^2}+
\frac{\partial^2 }{\partial y^2}\right) \;.$$ If we restrict $\Delta$ to smooth functions on $\GmodH$ which are compactly supported it defines an essentially self-adjoint operator on $L^2(\GmodH,d\mu)$ where $d\mu(z)=dxdy/y^2$, with inner product
$${\left \langle f,g \right\rangle}=\int_{\GmodH}f(z)\overline{g(z)}d\mu(z).$$
We will also denote by ${\Delta}$ the self-adjoint closure. Let $h(y)$ be a smooth function which equals 0 if $y<T$ and 1 if $y>T+1$ where $T$ is sufficiently large. One may check that when ${\operatorname{Re}}(s)>1$ $$V_m(z,s)-h(y)y^se(mx)$$ is square integrable. This is an easy exercise using [@Kubota:1973a Theorem 2.1.2]. The series $V_m(z,s)$ satisfies $$\label{straightforward}
(\Delta-s(1-s))V_m(z,s)=(2\pi m)^2V_m(z,s+2) \textrm{ when } {\operatorname{Re}}(s)>1,$$ since $f_s(z)=y^s e^{2\pi i m {\operatorname{Re}}z}$ satisfies this equation and because the Laplacian commutes with isometries, so does $V_m(z,s)$, being a sum of translates of $f_s$. Therefore $$\begin{aligned}
\nonumber (\Delta-s(1-s))&(V_m(z,s)-h(y)y^se(mx))\\ =(2\pi m)^2& (V_m(z,s+2)-h(y)y^{s+2}e(mx))\\ \nonumber &-h''(y)y^{s+2}e(mx)-2h'(y)y^{s+1}e(mx)\end{aligned}$$ is also square integrable, since the last two terms are compactly supported. We can therefore use the resolvent $({\Delta}-s(1-s))^{-1}$ to invert this and find $$V_m(z,s)- h(y)y^se(mx)=({\Delta}-s(1-s))^{-1}((2\pi m)^2V_m(z,s+2)-H(z,s))$$ where $$H(z,s)=(2\pi
m)^2h(y)y^{s+2}e(mx))+h''(y)y^{s+2}e(mx)+2h'(y)y^{s+1}e(mx)$$ This defines the meromorphic continuation of $V_m(z,s)$ to ${\operatorname{Re}}(s)>1/2$ by the meromorphicity of the resolvent (see e.g [@Faddeev:1967a]). The singular points are simple and contained in the set of $s\in \C$ such that $s(1-s)$ is an eigenvalue of ${\Delta}$. Since ${\Delta}$ is self-adjoint, these lie on the real line (when ${\operatorname{Re}}(s)>1/2$). The potential pole at $s=1$ has residue a constant times $$\int_{\GmodH}(2\pi m)^2V_m(z,3)-H(z,1)d\mu$$ The contribution from $h''(y)y^{s+2}e(mx)+2h'(y)y^{s+1}e(mx)$ is easily seen to be zero if $T$ is large enough using $\int_0^1
e(mx)dx=0$ when $m\neq 0$. To handle the rest we may unfold to get $$\begin{aligned}
(2\pi m)^2&\int_{\GmodH}(V_m(z,3)-h(y)y^3e(mx))d\mu(z)\\& = (2\pi
m)^2\int_0^\infty\int_0^1(y^3-h(y)y^3)e(mx)y^{-2}dxdy=0 \end{aligned}$$ so $V_m(z,s)$ is analytic at $s=1$. The claim about growth in vertical strips is proved as in [@PetridisRisager:2004a Lemma 3.1].
It is possible to extend the main idea of the proof of Proposition \[continuation\] to prove the meromorphic continuation of $V_m(z,s)$ to $s\in \C$. But since our main aim was to prove Theorem \[equidistribution\] we shall stop here.
[10]{}
Yves Colin de Verdi[è]{}re. Pseudo-laplaciens. [II]{}. , 33(2):87–113, 1983.
Efim I. Dinaburg and Yakov G. Sina[ĭ]{}. The statistics of the solutions of the integer equation [$ax-by=\pm
1$]{}. , 24(3):1–8, 96, 1990.
Dimitry Dolgopyat. On the distribution of the minimal solution of a linear [D]{}iophantine equation with random coefficients. , 28(3):22–34, 95, 1994.
Ludvig D. Faddeev. The eigenfunction expansion of [L]{}aplace’s operator on the fundamental domain of a discrete group on the [L]{}obačevskiĭ plane. , 17:323–350, 1967.
Akio Fujii. On a problem of [D]{}inaburg and [S]{}inaĭ. , 68(7):198–203, 1992.
Dorian Goldfeld and Peter Sarnak. Sums of [K]{}loosterman sums. , 71(2):243–250, 1983.
A. Good. Beiträge zur [T]{}heorie der [D]{}irichletreihen, die [S]{}pitzenformen zugeordnet sind. , 13(1):18–65, 1981.
Anton Good. On various means involving the fourier coefficients of cusp forms. , 183(1):95–129, 1983.
Tomio Kubota. . Kodansha Ltd., Tokyo, 1973.
H. Neunh[ö]{}ffer. Über die analytische [F]{}ortsetzung von [P]{}oincaréreihen. , pages 33–90, 1973.
Yiannis N. Petridis and Morten S. Risager. Modular symbols have a normal distribution. , 14(5):1013–1043, 2004.
Walter Roelcke. Analytische [F]{}ortsetzung der [E]{}isensteinreihen zu den parabolischen [S]{}pitzen von [G]{}renzkreisgruppen erster [A]{}rt. , 132:121–129, 1956.
Peter Sarnak. Estimates for [R]{}ankin-[S]{}elberg [$L$]{}-functions and quantum unique ergodicity. , 184(2):419–453, 2001.
Atle Selberg. Discontinuous groups and harmonic analysis. In [*Proc. Internat. Congr. Mathematicians (Stockholm, 1962)*]{}, pages 177–189. Inst. Mittag-Leffler, Djursholm, 1963.
Atle Selberg. On the estimation of [F]{}ourier coefficients of modular forms. In [*Proc. Sympos. Pure Math., Vol. VIII*]{}, pages 1–15. Amer. Math. Soc., Providence, R.I., 1965.
Atle Selberg. . Springer-Verlag, Berlin, 1989. With a foreword by K. Chandrasekharan.
[^1]: The first author was funded by a Steno Research Grant from The Danish Natural Science Research Council. The second author was supported by the Israel Science Foundation (grant No. 925/06).
| {
"pile_set_name": "ArXiv"
} |
Goth around the world can rejoice, there is finally a vodka to match the color of their souls. ;-)
Surprisingly, for a drink of this color, it not only looks very cool in a glass it actually tastes quite good with a nice bite a...Goth around the world can rejoice, there is finally a vodka to match the color of their souls. ;-)
Surprisingly, for a drink of this color, it not only looks very cool in a glass it actually tastes quite good with a nice bite and a spicy aftertaste, without any medicinal flavor you often get with cheaper or novelty vodkas. Good on the rocks, this somber liquor is made for layering in mixed drinks, such as this one:
Black Widow: Fill highball glass with ice, pour in 3oz chilled cranberry juice, layer 3oz Blavod on top.
Just in time for Halloween. Cheers!
We featured this vodka at our Blogger Prom in the Jungle Juice Prom Punch created by mixologist Liquid Muse Natale Bovis-Nelsen. It was so tasty! Natalie is picky about the spirits that she uses in her cocktail and only uses high-...We featured this vodka at our Blogger Prom in the Jungle Juice Prom Punch created by mixologist Liquid Muse Natale Bovis-Nelsen. It was so tasty! Natalie is picky about the spirits that she uses in her cocktail and only uses high-quality ingredients, so that says a lot about Pinky right there. Nice to know that you shouldn't discount it just because it's pink.
Yes. It's true. College students are usually broke, and that's why the 1.75 plastic bottle is the most opted for vodka of choice. Apparently, it's the #2 selling vodka in the U.S., so hop on the bangwagon and taste what college s...Yes. It's true. College students are usually broke, and that's why the 1.75 plastic bottle is the most opted for vodka of choice. Apparently, it's the #2 selling vodka in the U.S., so hop on the bangwagon and taste what college students around the country have learned to stomach for lack of better funds.
I'm shivering in fear.
One thing i always regret about Vegas is not bringing enough alcohol. You do get free drinks, but they are a bit dinky, and you gotta be spending money to get them, so me? I bring my own alcohol. I will be stopping by Bevmo and al...One thing i always regret about Vegas is not bringing enough alcohol. You do get free drinks, but they are a bit dinky, and you gotta be spending money to get them, so me? I bring my own alcohol. I will be stopping by Bevmo and also (shh!) Costco. Great deals = Love
Mouth blown, this glass cocktail shaker is made of beautiful amber glass which is sandblasted down to white around the slightly raised fantail goldfish design on the base and then cleaned and polished to achieve this stunning look...Mouth blown, this glass cocktail shaker is made of beautiful amber glass which is sandblasted down to white around the slightly raised fantail goldfish design on the base and then cleaned and polished to achieve this stunning look. | {
"pile_set_name": "Pile-CC"
} |
Q:
Reload page without ssl (https to http)
I have a secured site using ssl. I have a php file that checks the login and if you are not logged in it brings up a login form, once you log in the page refreshed and the login is checked again and when it passes it loads the page content. What i am trying to do is have it load the login in https then when the javascript gets the ok from ajax that the login was successful, the page is reloaded with just http to reduce the load time and latency of the page (these are large pages and any little thing will help). I need to do this dynamically, so i can not just give it a redirect url.
A:
To solve this problem you can use this untested psuedo code loaded at the top of every page you require a login on.
if(loggedin()&&$_SERVER[SERVER_PORT]==443)
{
//if user is logged in but they are still on the https site, redirect to the http site
header("Location:http://$_SERVER[HTTP_HOST]$_SERVER[SCRIPT_NAME]?$_SERVER[QUERY_STRING]");
}
elseif(!loggedin()&&$_SERVER[SERVER_PORT]!=443)
{
//if the user is not logged in and they are not on the secure site, send them to the login page on the secure site
header("Location:https://$_SERVER[HTTP_HOST]/login.php");
}
| {
"pile_set_name": "StackExchange"
} |
AP Photo/Matthias Rietschel
AMD told analysts on its first quarter earnings call that it's not worried about second-hand graphics chips flooding the market as the interest in crypto dies down.
Cryptocurrency mining made up 10% of the company’s first quarter revenue, the CFO said.
Shares surged more than 9% following its expectations-topping earnings results.
Follow AMD’s stock price in real-time here.
AMD (Advanced Micro Devices) got a big boost as its graphics chips, once popular only among gamers, were being gobbled up by would-be cryptocurrency miners at the height of this winter’s crypto craze.
But as crypto prices have declined in 2018, so too has demand for GPU’s for mining, worrying some Wall Street analysts that used cards might flood the secondary market and hurt AMD’s sales of new chips.
The company’s CEO, however, says this isn’t a worry.
“We don't see a significant risk of secondhand GPUs coming into the market," chief executive Lisa Su said on a conference call following AMD’s expectation-topping first quarter earnings on Wednesday.
"We do see a bit of volatility and that's why we are putting into our forecast for the second quarter and the second half a little bit lower blockchain demand, but that's more than made up for by the other new products and the way the new products are ramping in the business."
The price of bitcoin hit a peak of $19,843 in January, and resulting interest in mining with AMD chips contributed to 10% of first quarter revenue for the company, CFO Devinder Kumar said on the call.
Even without help from crypto, the company doesn't seem to be worried about a dropoff anytime soon. AMD also raised its revenue forecast for the second quarter to $1.725 billion, a 50% increase over the same quarter in 2017, in the release.
But the road ahead will be difficult as prices continue to slide: Bitcoin is now down 55% from its peak, new “application-specific” mining computers are being introduced to the market, and ethereum — the second-largest cryptocurrency by market cap — could switch to a less intensive mining process within six months.
"A crash in cryptocurrency mining, and a sudden sale of grey market graphics cards could lower average selling prices and volumes of new graphics cards for several quarters,” UBS warned clients earlier this month.
Shares of AMD climbed more than 9% following its earnings report Wednesday and are down 2.8% for the year so far.
Markets Insider
NOW WATCH: Wall Street's biggest bull explains why trade war fears are way overblown | {
"pile_set_name": "OpenWebText2"
} |
Q:
Do i really have to eat this much for building muscles?
The calorie calculator tells me to eat 2700.
My friends/forums tell me to eat 3000-5000 to bulk up.
I'm student who us very lightly active. Most of the time I read or sitting at the desk.
I do go to the gym 5 times a week. And now I do take 2600 cal and 200gram protein daily. But I'm getting fatter and the belly is growing.
If I sink it down to 2100 cal, will this affect my muscle growth? What should I do? How much to eat? I need maximum muscle growth and minimum body fat.
23yo. Male. 1 year experience. I do run every night for 2-5km.
5 days per week for weight lifting. 174 cm. 82 kg.
A:
Calorie calculators can't tell you exactly how many calories you need to eat -- they're making a lot of assumptions about your metabolism, activity level, etc. While tools like the Harris Benedict Formula are useful, they are generalizations -- everyone is different. Not to mention, your activity level and metabolic rate will vary from week to week due to all kinds of stimulus you may not be able to control (stress levels, weather, relationships, sleep, and so on). You should use a calorie calculator as a baseline and do your own study from there.
The easiest way to do this is to buy a skin fold caliper (~$8 on amazon) and start a spreadsheet. Use the calipers to measure your bodyfat, and weigh yourself every day or week. Keep track of how many calories you're eating using something like fitday (or tallying the calories yourself). Keep this data logged and make adjustments on a weekly basis.
You can dial in your daily caloric needs by observing for a couple of weeks. If your weight and bodyfat don't fluctuate over the duration, you can average the number of calories you ate to determine your daily needs. At that point, you can increase your calorie consumption by about 300-500 per day for the duration of your bulk. If you find you are putting on too much body fat, you can tweak these numbers.
I realize that reading "couple of weeks" can be off-putting because we want a solution right now. But remember that there is no instant gratification in fitness. You can't get a six pack overnight, nor can you squat 405 overnight. Be scientific, be patient, and your results will reflect your effort.
A:
There are many reasons that bulking diets fail but here are a few of the most common reasons:
1. Calories are not high enough and putting on muscle mass fails.
2. Calories are too high and macros are wrong. This in turn leads to putting on fat as well as muscle.
3. You are bulking, not cheating. Cheat days can be factored in, but your food choices should still be healthy. All diets, whether cutting or bulking, need to be monitored. This means that watching your insulin spikes and the type of carb you consume.
4. You are what you eat, it’s that simple. To simplify, you eat crap and you will look like crap.
Harris Benedict Formula for Calorie Calculations
“The Harris Benedict equation is a calorie formula using the variables of height, weight, age, and gender to calculate basal metabolic rate (BMR). This is more accurate than calculating calorie needs based on total body weight alone. The only factor it omits is lean body mass and thus the ratio of muscle-to-fat a body has. Remember, leaner bodies need more calories than less leaner ones. Therefore, this equation will be very accurate in all but the very muscular (Harris-Benedict will under-estimate calorie needs) and the very fat (Harris-Benedict will over-estimate calorie needs).”
That being said, there are is no concrete number of daily calorie intake your body needs, however using this formula will give you can idea of what you do need.
Harris Benedict Formula for Men - Step 1
BMR = 66 + (13.7 X weight in kilos) + (5 X height in cm) - (6.8 X age in years)
Example:
You are 25 years old
You are 6 feet tall
Your weight is 220 pounds
Your BMR is 66 + (1370) + (914) - (170) = 2180 calories
Harris Benedict Formula for Men - Step 2
To determine your total daily calorie needs (aka TDEE) multiply your BMR by the appropriate activity factor, as follows:
If you are Sedentary - little or no exercise
Calorie-Calculation = BMR X 1.2
- If you are Lightly Active (light exercise/sports 1-3 days/week)
Calorie-Calculation = BMR X 1.375
- If you are Moderately Active (moderate exercise/sports 3-5 days/week)
Calorie-Calculation = BMR X 1.55
- If you are Very Active = BMR X 1.725 (hard exercise/sports 6-7 days/week)
Calorie-Calculation = BMR X 1.725
- If you are Extra Active (very hard daily exercise/sports & physical job or 2X day training)
Calorie-Calculation = BMR X 1.9
Total Calorie Needs Example
If you are lightly active, multiply your BMR (2180) by 1.375 = 2997
Your total daily calorie requirement is therefore 2997 calories.
This is the total number of calories you need in order to maintain your current weight.
If you want to gain body weight, you must consume more calories than you burn, pretty straightforward. So now we know that you need extra calories to gain weight. So what should these calories be comprised of?
The BASICS-
1. Carbs - carbohydrates are a very helpful macronutrient when you are trying to gain lean mass. Meals should be comprised of slow burning complex carbs that are low on the glycemic chart. Some good examples of low glycemic carbs are brown rice, yams, and oatmeal. Others may include whole wheat bread, whole wheat pasta.
Protein - For bulking a good rule of thumb is 4g-6g of protein per kilogram of lean bodyweight. You should take in a good portion of your protein in the source of real meals, avoid intaking too many shakes. Examples of food with high protein bioavailability is egg whites, lean steak, and chicken breast.
Fats - EFA’s (Essential Fatty Acids) are extremely important in any diet. Examples of good sources of fat are flax oil, nuts, salmon, olive oil.
The separation of Carbs and Fats - It is often when you eat items and with what you eat them that is more important than what you are eating. Remember that when you take in certain carbs you can spike your insulin levels. If you are taking in fats when your insulin is spiked you are allowing the basic laws of physiology to act out, and you allow for a higher propensity for fat storage. Separation is key. The sample diet will give a good example of how to separate them.
Supplements - Glutamine: Helps prevent catabolism. Best used in dosages of 10grams daily, 5 grams before cardio and 5 grams at another interval, but not after workout as it fights for absorption with the glutamine peptides in whey. Creatine: Unlike while cutting, creatine can be used while bulking since the water retention from its use will not be an issue since you are “bulking”. In the body, creatine is synthesized from the amino acids glycine, arginine and methionine. Taking supplemental doses of creatine monohydrate can increase muscle creatine and phosphocreatine (PC) concentrations by up to 40%. These increases can lead to improvements in muscle energy production and recuperation.
Cheating - Cheating is essential. Why? Remember, the body runs on homeostasis and it likes to keep balance. After eating so well after a week, your body begins to adjust and lean mass gain / fat burning over time will not be as rapid. The other extremely important aspect is mental sanity. So many diets crash and fail because people don’t give themselves a chance to breath. Shoot for a cheat meal, not an all out binge. A fast food value meal can be 2,000 calories. Eat that 3 times on one day, and you’ve consumed 6,000 calories. And that’s not good in any case.
Cardio - Cardio works the most important muscle of all – your heart. Not only that but doing cardio 3 times a week will help keep the fat you will gain in this diet to a minimum. The proper cardio for burning fat is done by staying in your target heart rate for fat burning which is 65-70% of your max heart rate for a period of 45-60 minutes.
Sample Diet:
Based on the Harris Benedict formula above, our friend here needs 2997 calories a day to maintain his current weight. So in order for him to gain 1 pound a week, we need to increase his calories to right around 3500 a day since that will yield 3500 calories over his maintenance numbers needed for the week.
Meal 1: Pro/Carb
8 Egg Whites, 1 Scoop Of Whey Protein, 1 cup oatmeal
50g protein / 54g carbs / 5g fat
Meal 2: Pro/Fat
Lean Ground Beef, ¼ cup swiss cheese, green veggies
55g protein / 2g carbs / 20g fat
Meal 3: Pro/Carb
Chicken Breast, 1 and a half cup Brown Rice
55g protein / 64g carbs / 3g Fat
Meal 4: Pro/Fat
2 Cans of Tuna, 1 Tbsp Full Fat Mayonnaise, Veggies
60g protein / 2g carbs / 13g Fat
Meal 5: PWO Nutrition
2 Scoops Whey Protein / 80g of Dextrose
40g protein / 80g carbs / 0g fat
Meal 6: PPWO
Boneless Skinless Chicken Breast, ½ cup Brown Rice (Measured Uncooked)
50g protein / 70g carbs / 3g fat
Meal 7: Pro/Fat
Lean Protein of your choice, 2 Tbsp Natural Peanut Butter
50g protein / 5g carbs / 18g fat
Meal 8: Before Bed
3 Scoops of Whey Protein, 1.5 Tbsp. Flax Seed Oil
60g protein / 3g carbs / 21g Fat
That turns into approximately 420 grams protein, 250 grams Carbs, and 83 grams of fat. This is roughly 3500 calories
| {
"pile_set_name": "StackExchange"
} |
A neighbour, who asked not to be named, said: “A police officer came to my house and asked if we had noticed anything suspicious in the last 10 days, so I think that the body has been there for a while. There have been forensic people in and out since yesterday.” | {
"pile_set_name": "OpenWebText2"
} |
The Arkansas swamp continues to bleed, while the spotlight shines on the Clinton Foundation. Part 1 of the Arkansas Swamp covered dozens of arrests, indictments, guilty pleas, and a key chart indicating potential upcoming arrests, from the ongoing investigations taking place in Little Rock, Arkansas. One sung like a bird, while another strong-armed others to remain silent, and yet another set out for murder-to-hire. It is important to review Part 1 to understand the magnitude of the Arkansas swamp, and the potential squeeze it may be putting on the Clinton Foundation. Their investigations have already connected senators, legislators, lobbyists, non-profits, and companies, spanning four states, with the primary focus in Arkansas. Some may believe that the Clintons haven’t been involved in Arkansas dealings for quite some time – they would be mistaken.
Deputy AG Llyod Warford, head of the Medicaid Fraud Control Unit in Little Rock, made it very clear that there are ongoing investigations on a Federal level as well. This is what he had to say when asked if more indictments are coming:
I’m reasonably certain there will be more people charged, either by us or the feds. While our investigation is separate from the federal investigation , we have communicated with them about our targets and their targets , and to some extent there’s been some cooperation.
When Warford was asked if they were investigating any legislators, he said “yes” and confirmed those legislators had not yet been charged. Again, they have four million documents being held in a vault that they created, in addition to 200 GB of data they pulled out of DHS. Warford also confirmed that his unit is investigating Medicaid fraud schemes at other behavioral health providers besides Preferred Family Healthcare. This is important information to make a mental note of.
Before getting to the testimony heard on December 13th, by financial analysts John Moynihan and Larry Doyle on the Clinton Foundation, and how the Arkansas swamp investigations connect to the Clintons, there are a few key events that have taken place over the past couple of weeks.
More Arrests, Convictions & Lawsuits
FIRST CASE
Henry Wilkins IV, former Arkansas State Senator and Jefferson County Judge, who pleaded guilty in April to conspiring to commit offences against the United States, was scheduled for sentencing on December 7th after already having been delayed. It was then postponed again, until January 30, 2019, based on a sealed motion granted by Chief US District Judge Brian Miller in Little Rock. Both the government and Wilkins’ attorneys filed a joint motion to postpone sentencing. Why would sentencing be postponed for a man who pleaded guilty eight months prior? What’s in that newly sealed motion? Are they still working on a plea deal, and possibly gathering additional information to their ongoing investigation? Henry Wilkins IV comes from three generations of family members in the political arena, and the connections to the Bill and Hillary Clinton are significant, as seen later in this article.
SECOND CASE
On November 5th Harold “H.L.” Moody, a special events coordinator for Pulaski County Youth Services, was arrested on two counts of receipt of child pornography, three counts of distribution of child pornography, and a single count of conspiring to advertise child pornography. He also smoked methamphetamine while at his desk during regular work hours. Moody had that job for nearly two years before his arrest and was previously a DNC political consultant. He was a communications director for the Democratic Party of Arkansas for a year-and-a-half, and prior to that, he was chairman of the Pulaski Democratic Party for two years.
The nature of the photographs and videos Moody is accused of distributing, contain images of babies and young children being raped. According to agent Bennett’s testimony, she observed Moody as initially viewing the images, then distributing them, and had escalated to hosting sessions whereby people in a secure chatroom were streaming live videos of infants being raped. Despite all of this, Moody’s attorney stated that if the judge allowed him to remain free while awaiting trial in January, there were two business owners who offered to let Moody work for them. Those businesses were not disclosed. There is a connection to this case described further down in this article.
THIRD CASE
Attorneys for Jim Parsons, a former Ecclesia College board member, is suing Preferred Family Healthcare and its subsidiaries Decision Point, Dayspring Behavioral Health Services, and Wilbur D. Mills Treatment Center, for ill-gotten state taxpayer money. His attorneys filed the illegal exaction lawsuit on November 27, 2018. This is an interesting case, as it names additional names that are not listed in past arrests or indictments, and could very well be some of the players listed in indictments as “Person” or “Employee” (see key chart in Part 1). The suit also lists executives and board members or lobbyists. The suit lists $52.8 million from state taxpayers between 2011 and 2016, distributed by Arkansas DHS’s Medicaid programs.
Some of the names listed in this suit, that are not already listed in previous arrests or indictments, are Mark Kastner, Lisa Fairley, Gary McMurtry, Patricia Wallace, Stan Melton, John Benson, Wendell Parish, Robert Berry, and Anthony Henderson. The lawsuit doesn’t involve Ecclesia College, another Arkansas case covered in Part 1, however, Parsons is suing the college in Washington County Circuit Court, seeking the return of funds that were involved in that kickback scheme as well.
FOURTH CASE
Another conviction in a Philadelphia case recently took place on December 3rd, which just so happens to include D.A. Jones, a lobbyist who waved his right to a grand jury and pleaded guilty in December, 2017 for conspiring with a former Arkansas state legislator and Preferred Family Healthcare to spend nearly $1 million on illegal political activity and kickbacks to conspirators. This case is covered in the Arkansas Swamp Part 1. Kenneth Smukler of Pennsylvania was convicted of making and concealing illegal campaign contributions in two Congressional primary elections. Smukler worked for Congressman Bob Brady, who was running against Philadelphia Municipal Judge Jimmie Moore, and orchestrated a payment of $90,000 with Moore’s campaign manager Carolyn Cavaness, and campaign consultant D.A. Jones, to pay Moore off, so he would drop out of the primary election. They have all pleaded guilty in this case, except Brady. Brady was being investigated as of November 2017, announced in January he would not run for reelection, and as of November 2018, despite testimony from all involved stating that Brady was complicit, litigators seemed to have run out the clock on the statute of limitations. Carolyn Cavaness is a former Hillary Clinton staffer.
Thus far, the Arkansas swamp arrests, indictments, and guilty pleas, travel across several state lines, including Arkansas, Pennsylvania, Missouri, and Oklahoma. These are bundles of corrupt political webs, directly impacting legislation, elections, and taxpayer dollars, that form a much bigger network.
Critical Testimony on The Clinton Foundation
December 13, 2018 was a day of anticipation for many that were waiting to hear from US Attorney John Huber about his findings on the Clinton Foundation. However, US Representative Mark Meadows, and financial analysts John Moynihan, and Larry Doyle all suggested he was not present at the hearing due to ongoing investigations into the Clinton Foundation. Interestingly, Moynihan and Doyle stated they sent documents to Huber’s office three times because his office stated they “misplaced” the documents. Meanwhile, they are confident that the FBI in Little Rock is in fact investigating the Clintons, and even have photos of the IRS and FBI loading a 757 plane with boxes of Clinton Foundation documents. When taking all of this information into consideration, it suggests that the investigation into the Clinton Foundation may have always resided with the FBI in Little Rock, and Huber may not even be involved in those specific investigations. It’s difficult to say at this point. One thing is for certain, it has been kept very quiet and without leaks.
On the same day as the hearing, It was later reported that Huber had been attending a media round table in Utah with FBI Special Agent in Charge Eric Barnhart, to alert the public to victims of child exploitation, and discussed other topics on gangs, drug activity, and violent crimes. Both Barnhart and Huber reported that offenders are likely to commit the same crimes after being released from even lengthy prison terms and the best treatment efforts. Huber stated that his office takes on some of the worst cases you can imagine, and one particular case involved 600 images of child pornography. He had this to say about it:
600 images of child pornography translate to 600 victims who have been raped, sodomized, and otherwise exploited for sexual gratification. That’s why these crimes are serious… this isn’t looking at a dirty magazine… this is harming children, exploiting them and passing on those images and videos. It’s supply and demand, and there’s a great demand. I don’t know what we do as a society to cure that problem, to lessen that problem, but it is a growing demand and it’s ever present, and our children are, unfortunately, the fodder and the currency in that world.
The House Oversight Subcommittee hearing on the Clinton Foundation proceeded without Huber. Tom Fitton from Judicial Watch, Associate Professor of Law Phillip Hackney, and outside whistleblowers and financial analysts Larry Doyle and John Moynihan, were all in attendance to testify. Doyle and Moynihan had been meticulously working on the Clinton Foundation financials and taxes for three years, and had submitted documents to the FBI in Little Rock, as well as several jurisdictions on both local and state levels. Their testimony provided some key information. As of December 20th, the transcript and video currently remain on c-span, but may one day be scrubbed. Corey’s Digs has preserved the video, should it ever need to be resurrected.
Key takeaways from the testimony of Moynihan and Doyle, per c-span transcript (type errors included):
• “We sent our appeal in with a FOE COE – photo copy of the FBI and IRS removing boxes from the Clinton Foundation after they brought a 757 down and taken the materials out of the Clinton Foundation in Little Rock, Arkansas. We sent that to demonstrate that your letter coming from Atlanta doesn’t reconcile with what’s going on in Little Rock.”
• “It was an open and ongoing investigation he couldn’t comment on. That would indeed indicate there’s an investigation.”
• “He stated (Clinton Foundation CFO Andrew Kessel) very specifically, and it took us both off guard, I’ve been doing this a long time, but when someone says, I know where all the bodies are buried.”
• “Overall it might have been 40% by our calculations, ended up going to programs, and 60% was administrative.” (This refers to the amount of CF funds that went to administrative, which is generally 15% for non-profits.)
• “Mr. Doyle, you said from $400 million to $2.5 billion might be subject to taxation. So you’re saying, worst case is in your opinion $400 million were improperly used in a charitable foundation named the ‘Clinton Foundation’, is that correct?” Doyle: “Yes.”
• “They were brokering money and brokering pharmaceuticals. They were an agent of money through these donors. They would take a fee, and broker the money and broker relationships with pharmaceutical companies. By the same token, they were brokering the pharmaceuticals and taking some.”
• “Our conclusions, in the interest of time, are this – foreign agent. The Foundation began acting as an agent of foreign governments throughout its life and continues to do so. As such, they should have registered under FARWA. The auditors acknowledged this fact and conceded in formal submissions that it did not operate as an agent.”
• Meadows: All right, so who approved the 501-C-3 status for the Foundation? Moynihan: Would have been the IRS. Meadows: Do you have the document? Moynihan: We have it. We’ve got the determination letters. Meadows: It was approved for what? Building a library or? Moynihan: The initial approval was simply for library. Meadows: Who modified it? Moynihan: We saw no modifications to the articles of incorporation. …. In order to go forward the application has a schedule G that asks you if CHAI is a successor organization to a previous one, so you have the library, then you have this CHAI running unapproved. You gotta get approved….. They go and make an application, and on the form schedule G, when it’s asked, is this a successor operation, they specifically and affirmatively answered no. That is a misrepresentation because it’s the same people doing the same thing.
Clinton Health Matters Initiative Operating in Arkansas During Ongoing Investigations
In November 2012 the Clintons launched ‘Clinton Health Matters Initiative’ in partnership with GE, Tenet Healthcare Corporation, and Verizon, to focus on health issues in underserved communities. According to their 5-year plan, they state, “the Clinton Foundation announced that Central Arkansas (Pulaski County) would be the site of the second Community Health Transformation community. From its inception, CHMI designed this work with both a national and regional focus in Central Arkansas, with the support of core strategic partners and the Clinton Presidential Center. CHMI will serve as a convener of key local stakeholders, across sectors to implement a locally developed blueprint for action, based on each community’s unique health indicators.” Verizon was to address the health gaps by providing remote and home patient monitoring technologies as a key component to CHMI.
Other regions within CHMI’s Community Health Transformation (CHT) portfolio include Adams County, Mississippi; Northeast Florida (Jacksonville); Greater Houston, Texas; Knox County, Illinois; and San Diego County, California. In 2018, CHMI completed its five-year engagement in the Coachella Valley, California.
This partnership may raise eyebrows, considering the decades-long investigations and corruption within these organizations. Tenet Healthcare Corporation has been under numerous investigations dating back to 2000, resulting in almost $2 billion in fines and settlements over kickbacks, Medicaid and Medicare fraud, and likely more with the recent charges on October 3, 2016 for defrauding the US while making illegal payments in exchange for patient referrals, with a fine of $513 million. Then again, on February 1, 2017, a former executive was charged for alleged role in $400 million scheme to defraud Medicaid programs and patients of Tenet hospitals.
Meanwhile, GE was just hit with new investigations from SEC and the Justice Department in October, adding to the SEC investigation from January over GE’s accounting tactics as well as a $6.2 billion insurance loss. In 2009, the SEC charged GE with accounting fraud which resulted in a $50 million settlement charge. There are also multiple lawsuits against GE in the courts, including shareholders against GE.
Over on the Verizon front, there’s been a lot of heat on them for throttling firefighters’ data connections during the wildfire crisis in California. The fire department had purchased an unlimited data plan from Verizon, but once they hit 25GB usage, Verizon began throttling their speed to 1/200 or less. Even after Verizon was alerted that it was affecting their ability to provide emergency service, they continued to slow data speeds until the fire department purchased a more expensive plan to speed up the service.
The Clinton Foundation has been under scrutiny for over a decade and is allegedly under investigation in Little Rock right now, according to multiple source, which was first reported by John Solomon at The Hill in January 2018. This partnership consists of four organizations, three of which have been under investigations spanning well over a decade, and some of whom have already been charged for fraud multiple times.
Clinton Health Matters Initiative is another “initiative” operating as a fictitious name under the Clinton Foundation, and was never filed correctly with the IRS. Therefore, from 2012-2017 it was operating illegally, working in health areas that was far outside the scope of what the Clinton Foundation was approved for by the IRS. The CEO, Alex Chan, of Clinton Health Matters Initiative, is also the CEO of the Clinton Foundation. The regional director Tionna Jenkins, previously served a three-year appointment to the U.S. Department of Health & Human Services Regional Equity Council.
Their five-year plan goes on to state: Arkansas’s rate of total uninsured residents declined by 50 percent between 2013 and 2016 and the rate of uninsured children in Arkansas dropped in 2016 to four percent. This is due in part to the implementation of the Affordable Care Act’s Medicaid expansion – also known as the private option and now rebranded as “Arkansas Works” – which was approved by the state legislature in 2013.
Medicaid is a key component in their work, and also happens to be a key component with the investigations and indictments rolling out in the Arkansas Swamp, all of which is separate from ongoing Federal investigations that have a lid on them. There are 35 states that have implemented the “Medicaid expansion,” which allows for Americans earning up to 138 percent of the federal poverty level to qualify for Medicaid under Obama’s Patient Protection and Affordable Care Act.
States were given this option to expand Medicaid, but what makes Arkansas unique, is that they accept the federal money provided through the ACA to buy private insurance for about 250,000 eligible low-income residents, through the marketplace. This was an approved plan by the federal government in September 2013. They were the first state to work with the Obama administration on creating this unique plan, and then-Gov. Beebe was pleased to get it passed, despite the fact that it would be much costlier for the federal government who was willing to pay 100 percent of the costs for the Medicaid expansion up until 2017.
In December, Iowa followed suit with utilizing the funds for residents to purchase private insurance, and in March of 2015, New Hampshire did the same. In 2014, under Governor Corbett, Pennsylvania obtained a waiver to expand Medicaid for buying private insurance as well, but Governor Wolf transitioned it back to traditional Medicaid expansion in 2015.
That said, there are a few states, including Arkansas, that are now instituting work requirements for Medicaid adults, which is creating a lot of issues in the courts. A federal judge in Kentucky temporarily blocked the requirement from taking effect, and two of the groups that challenged Kentucky’s work requirement are now trying to put a halt to Arkansas’ requirement.
The timeline of this Medicaid expansion is rather interesting, when comparing it to both the Clinton’s new initiative, as well as the investigations, especially taking into consideration the amount of Medicaid fraud charges that seem to be exploding over the past several years. The Medicaid timeline is broken down below.
To put CHMI’s reach in perspective, they partner with more than 200 stakeholders from the public, private, and philanthropic sectors and strategic partners from the health and wellness community. Together, they created a five-year strategy to improve health and wellness in Central Arkansas, known as a “Blueprint for Action.” Here is a very short list of those partnering with the Clinton Foundation, GE, and Verizon in this initiative:
• Pulaski County Youth Services
• Arkansas Department of Human Services (DCFS), Department of Youth Services
• New Futures for Youth
• Planned Parenthood
• Winthrop Rockefeller Institute
• Loop Capital Markets
• Ben Noble, Noble Strategies, LLC (Tyson foods, Riceland Foods, Inc.)
• American Red Cross
• Governor’s Office, Governor Mike Beebe
• Little Rock Mayor’s Office and Mayor Riley McKinzie of Wrightsville, AR
• Little Rock Police Department
• Pulaski County Sheriff’s Office
• Alliance for a Healthier Generation
• Mexican Consulate, University of Arkansas for Medical Sciences
• Arkansas Department of Health and Department of Education
• Little Rock School District
• University of Arkansas at Little Rock
• AT & T, Verizon Wireless and Comcast
• Numerous hospitals, schools, churches, commissions and foundations
This begs the question, how is it CPAs, attorneys, financial analysts, and a seemingly large number of the American people are fully aware that this “initiative” is operating illegally, yet these folks continue to do work with them?
In 2013, they held a roundtable breakfast, and had this to say about it: “In addition to the key stakeholder interviews and engagement strategy, a corporate roundtable breakfast was held in 2013 in parallel with our efforts to collect information through the interviews and health outcomes data. CHMI, in partnership with then-Governor Mike Beebe; Dr. Joe Thompson, Arkansas Surgeon General; Dr. Joe Bates, senior public health advisor; and Grant Tennille, executive director, of the Arkansas Economic Development Commission hosted this breakfast to introduce CHMI to the Arkansas corporate and business community to support the work of existing public private partnerships and garner both national and local connections that address immediate needs in the region.”
One such partner is ‘Arkansas Impact Philanthropy’ (AIP)
In December 2015, the Winthrop Rockefeller Foundation, Clinton Foundation, and the Council on Foundations co-hosted a meeting at the Clinton Presidential Center on the local relevance of the United Nations’ Sustainable Development Goals, in alignment with the Blueprint’s goal for Central Arkansas. In October 2016, they joined again, along with the Arkansas Community Foundation, to host the Bold Ideas Gathering (BIG), bringing together 50 leaders from 26 philanthropic organizations to form Arkansas Impact Philanthropy. Their focus is to work together to address access to health care, quality education, and family-supporting jobs.
Since their inception, foundations such as Tyson Foundation, Mary Reynold Babcock Foundation, Winthrop Rockefeller Foundation, Walmart Foundation, Carl and Florence King Foundation, Arkansas Community Foundation, and Delta Dental are just a handful of the foundations working together on this joint project. The Arkansas Community Foundation is a statewide foundation that was founded in 1976 with an initial investment of $258,000 from the Winthrop Rockefeller Foundation, which they continue to give grants to today. Just this October, the Winthrop Rockefeller Charitable Trust gifted $100 million to the University of Arkansas, who is also working with CHMI. Winthrop Rockefeller moved to Arkansas in 1953, served as the 37th governor from 1967-1971, and passed away in 1973 at the age of 60.
Another Partner is The Arkansas Center for Health Improvement (ACHI)
In addition to the University and state departments, they are partnered with the Clinton Foundation as listed under ‘partner organizations’ document from 2013. ACHI refers to themselves as a “nonpartisan, independent, health policy center that serves as a catalyst to improve the health of Arkansas.” They implement local, state, and federal programs to improve health in Arkansas communities and schools. They work in partnership with many initiatives, including Alliance for a Healthier Generation founded by the American Heart Association and the Clinton Foundation, the Clinton Health Matters Initiative, numerous health clinics, Walmart, food programs and other initiatives.
Timeline on Medicaid Program in Arkansas
The Arkansas Medicaid expansion program has operated under federal government waivers under the Patient Protection and Affordable Care Act. Democratic President Barack Obama signed the
November 2012 The Clintons created Clinton Health Matters Initiative in Arkansas. Just as with CHAI, it is a fictitious name that was never filed properly under the Clinton Foundation.
December 2012 The Obama administration suggested that states could use premium support in their Medicaid expansions. Health and Human Services stated, “Under Medicaid and CHIP statutory options, states can use federal and state Medicaid and CHIP funds to deliver Medicaid and CHIP coverage through the purchase of private health insurance.” The federal government would pay 100% of the Medicaid expansion through 2017 .
April 23, 2013 then-Gov. Beebe worked with Arkansas legislatures to craft an alternative private option. Rather than expanding Medicaid, they would use the federal Medicaid expansion fund to help those eligible to buy private insurance coverage. Arkansas lead this plan, and a few other states later followed suit.
September 25, 2013 Obama and Clinton took the stage to promote ‘Obamacare.’
September 27, 2013 The federal government approved the Medicaid expansion plan in Arkansas to allow them to use the funding for over 230,000 residents to utilize the marketplace to seek private insurance plans.
December 31, 2014 Over 213,000 had already enrolled in the private option.
January 14, 2015 Attorney General Leslie Rutledge’s administration’s first full day at the Little Rock attorney general’s office, which included a mass firing of 32 staff from Dustin McDaniel’s last day on the 12th. Rutledge hired seven new staff members, with additional vacancies to be filled, including Lloyd Warford who was made deputy attorney general in charge of the Medicaid Fraud Control Unit. The same Warford overseeing the investigations itemized in Arkansas Swamp part 1.
February 5, 2015 Gov. Asa Hutchinson recommends extending it, while creating a task force to look for alternative actions beyond 2016.
December 29, 2015, They rebrand the plan to be called ‘Arkansas Works’.
February 18, 2016 Former Deputy Director of Arkansas Department of Human Services Steven B. Jones was sentenced to 30 months in prison for engaging in a bribery scheme involving two mental health companies that provided inpatient and outpatient services to juveniles, owned by Theodore Suhl. Jones and former probation officer, Phillip Carter accepted multiple cash payments and “other things of value” from Suhl. Numerous other cases involving legislative fraud, wire fraud, and Medicaid fraud followed with senators, lobbyists, legislatures, clinics, and non-profits.
April 2017 Bill Clinton praised Arkansas Medicaid expansion, at the CHMI summit in Little Rock.
In Early 2018 Arkansas became the third state to receive approval from HHS to implement a work requirement for Medicaid adults.
March 2018, the Arkansas Democrat Gazette reported: After months of uncertainty, the Arkansas House of Representatives on Wednesday approved a measure giving spending authority of $8.2 billion to the state Division of Medical Services and clearing the way for the continuance of the state’s Medicaid expansion in the coming fiscal year.
September 2018 Arkansas Times published an article revealing some of the unsealed text messages from the Preferred Family Healthcare case involving numerous now-former-senators, lobbyists and legislators, that indicate:
References to vote trading that seemed to indicate votes for the Arkansas Works Medicaid expansion were won by trading for votes in favor of behavioral health spending advocated by Rusty Cranford, who’s pleaded guilty to multiple kickback and illegal contribution schemes to build the Preferred Family Healthcare behavioral health colossus. It was fueled by millions in state Medicaid money.
Clinton Connections to Investigations That Raise Questions
Former Gov. Mike Beebe
Then-Gov. Mike Beebe received $26,000 in campaign funds from executives with Preferred Family Healthcare, their family members, or related subsidiaries between 2010 and 2016. He is on the list of 12 politicians whom received campaign contributions over $4k from them. It is not known as to whether or not he was aware of the corruption at that time. Beebe served as Arkansas’s 45th Gov. from 2007 – 2015.
In 2013, the Clinton Foundation stated that they were working in partner with Gov. Beebe with their CHMI program.
One of Beebe’s most notable successes in his administration was passing the state’s Medicaid expansion program, then called the private option, in a Republican-controlled legislature. Beebe told the crowd his White House go-to was Vice President Joe Biden.
Henry Wilkins IV
Former state senator, state representative, and Jefferson County Judge Henry Wilkins IV pleaded guilty on April 30, 2018 to accepting over $80,000 in bribes in exchange for influencing Arkansas state legislation and transactions, including steering approximately $245,000 in Arkansas General Improvement funds to his co-conspirators, and to devising a scheme to conceal the bribe payments as donations to St. James United Methodist Church in Pine Bluff, where Wilkins also served as a pastor. While serving the Arkansas General Assembly from 2010-2014, Wilkins admits to accepting a series of bribes from lobbyists and non-profit organizations, in exchange for filing shell bills, sponsoring full bills, and voting in favor of specific legislation.
One of the non-profits was Preferred Family Healthcare (PFH), which entailed Wilkins working with PFH executives, former AR state senator Jonathan Woods, lobbyists Rusty Cranford and Eddie Cooper, and consultant Donald Andrew Jones, all of whom have pleaded guilty.
Wilkins was also involved with the Former Executive Director of Non-Profit, Jerry Walsh who pleaded guilty on July 19, 2018 to conspiring to divert over $380,000 from South Arkansas Youth Services (SAYS). The scheme involved steering the non-profit’s funds to Henry Wilkins and the lobbying firm of convicted lobbyist Rusty Cranford, in exchange for the senator agreeing to influence Arkansas officials regarding state contracts with DHS and DYS.
Henry Wilkins IV comes from a family that has been in politics for three generations. Henry Wilkins son Wesley worked as an administrative assistant at the attorney general’s office until January 2015, when the Rutledge administration moved in and dismissed 32 staff, including 15 lawyers and 7 new hires, in a mass firing. Wesley Wilkins was one of the employees let go. His father, the late Henry “Hank” Wilkins III was a state legislator who was friendly with Bill Clinton, and introduced his daughter Cassandra’s husband, Rodney Slater, to Bill Clinton decades ago. In 1982 Slater began campaigning for Bill Clinton to regain the governor’s seat, and the following year, became the assistant to governor Clinton from 1983-1987. From 1987-1993 he was a member of the Arkansas State Highway Commission, as well as director of governmental affairs for Arkansas State University.
Both Cassandra Wilkins, Henry Wilkins IV’s sister, and her husband Rodney Slater followed Bill Clinton straight to the White House. In 1993 Clinton appointed Slater to the director of the federal highway administration, and in 1994 appointed Cassandra to senior advisor to the social security commissioner. In 1997 Clinton appointed Slater to be the secretary of transportation, and in 1998 Slater passed the Transportation Equity Act for the 21st Century (TEA-21), making a record $200 billion investment in surface transportation. The Clintons threw a big party at the White House that year, with a guest list that included British Prime Minister Tony Blair, Sir Elton John, Barbra Streisand, John Kennedy Jr. and his wife Carolyn, Tom Hanks, Steven Spielberg, Warren Buffet, other celebrities and big names, and a host of politicians including Linda Chesterfield, Cassandra Wilkins and Rodney Slater.
Cemex, the largest cement company in the world (according to Cemex), benefited greatly from the Transportation Equity Act that was passed. In Cemex’s 1999 annual report, they stated that this Act could increase government outlays for highways and bridges by more than 40% over the next six years, and that the major impact should be seen during the first half of 2000.
In 2000, Cemex reported that their net sales in the US were $769 million, up 30% in cement sales and 21% in ready-mix sales, from 1999, and that the cement demand is expected to continue, stemming from the Transportation Equity Act for the 21st Century. The largest demand was seen in Arizona and California. In November, Cemex completed its acquisition of Southdown, Inc., the second-largest cement producer in the United States.
On Christmas Eve in 2000, Gov. Bill Janklow announced a deal to sell the state-owned South Dakota cement plant in Rapid City to GCC, which is partly owned by Cemex, to the tune of $252.3 million. Janklow called a special session of the state legislature for December 28th to approve the deal and stated it must be completed by the end of the calendar year because GCC made the deal conditional upon acceptance by December 31st.
Since Slater’s time at the White House, he has served on the board for Africare, a nonprofit providing development aid to countries in Africa, United Way, Delta Air Lines, and Verizon. He became a partner at the law firm Squire Patton Boggs LLP in 2001. Bill Clinton is very familiar with the Boggs family, and may or may not have been instrumental in Slater moving over to Squire Patton Boggs LLP upon leaving the White House. In 1997, then president Bill Clinton appointed 81-year-old Lindy Boggs as US Ambassador to the Vatican, where she served until 2001. David Dunn, from Squire Patton Boggs LLP is also a good friend of Hillary’s according to an email between herself, David Dunn and Cheryl Mills.
Rusty Cranford
Former executive and board member of Preferred Family Healthcare (PFH) and Arkansas Lobbyist, Rusty Cranford, operated three lobbying firms; The Cranford Coalition, The Capital Hill Coalition, Outcomes of Arkansas. Cranford was Indicted and pleaded guilty to one count of federal program bribery detailed in this plea agreement. Cranford bribed Arkansas elected officials in a multi-million-dollar scheme, plus embezzled millions of dollars from PFH, working with PFH executives, Jonathan Woods, Henry Wilkins IV, Eddie Wayne Cooper, and Donald Andrew Jones. He also worked with APPOINTED officials on legislation to help the charity, as well as steering grants and other sources of funding to the charity.
SECOND CASE: Cranford is also accused of giving kickbacks to Jonathan Woods and Micah Neal, in which they funneled $400,000 in state grants to AmeriWorks, a company of Cranford’s.
THIRD CASE: Murder-for-Hire – Cranford tried to arrange the murder of Donald Andrew Jones to prevent him from testifying about the kickbacks Cranford was receiving. Jones has pleaded guilty for his role in the bribery schemes, and his sentence is pending.
FOURTH CASE: Cranford was also involved with Jerry Walsh, the former executive director of South Arkansas Youth Services (SAYS), and Henry Wilkins former Arkansas state senator, to steer the funds from SAYS to Wilkins and Cranford in exchange for Wilkins agreeing to influence Arkansas officials regarding state contracts with DHS and DYS.
Linda Chesterfield
Rusty Cranford has direct ties to Arkansas state senator Linda Chesterfield, who was on Hillary’s 2016 campaign “Leadership Council” in Arkansas. The Arkansas Times reported that Chesterfield received an income of $12,500 from Preferred Family Healthcare (PFH), as “diversity outreach consultant” in 2016, and her response to that was, “I did an honest day’s work for an honest day’s pay, and no one has questioned me about this matter but you.” They state that she helped PFH receive state money on top of millions it received through Medicaid. Between 2010-2016 she also received $5,600 in campaign funds from either PFH executives, their family members, or their subsidiaries.
Carolyn Cavaness
Cavaness, who pleaded guilty for campaign fraud in Case #4 above, worked as a deputy finance director for Hillary Clinton’s 2008 presidential campaign before she went to work for Moore.
Harold “H.L.” Moody
As listed above under Case #2, Harold worked for Pulaski County Youth Services, where he was arrested on pornography charges involving live streaming chat rooms where infants were being raped. CHMI works with several youth services, including Pulaski County Youth Services. In addition, he was a communications director for the Democratic Party of Arkansas for a year-and-a-half, and prior to that, he was chairman of the Pulaski Democratic Party for two years. Some of Moody’s friends and associates include Chad Griffin who is head of the Human Rights Campaign (HRC), and Jason Wiest co-host of The Big Gay Radio Show and former deputy director of communications at the office of Gov. Mike Beebe, as shown in a video clip Harold Moody posted to his facebook page , along with hundreds of photos with politicians at political events.
In February 2016, the Hillary Clinton campaign in Arkansas, announced its “Leadership Council” which included Gov. Mike Beebe and wife Ginger, three spouses of regular columnists of the Arkansas Times, Rodney Slater, Linda Chesterfield, and Cassandra Wilkins Slater, just to name a few.
What does all of this mean for the Clintons and the Clinton Foundation?
To summarize, the Bill and Hillary Clinton are operating an illegal fictitious company under the Clinton Foundation, in partnership with GE and Tenet Healthcare Corporation, both of whom have been charged for fraud in the past and are currently under investigation again, together with Verizon, all with a focus on healthcare and Medicaid in Little Rock. They ran this program throughout Pulaski County for five years, from 2012-2017, during a time where investigations into Medicaid fraud and looking into behavioral health care facilities, with a strong focus on legislators (past and present), were taking place, and future arrests are eminent. There are also ongoing Federal investigations taking place simultaneously, in which it would appear as though the Clinton Foundation is one of those investigations.
They have connections to the Pulaski County Youth Services, where the former DNC consultant was recently arrested on pornography charges of streaming live chat rooms where infants were being raped. They also have connections to Henry Wilkins, Casandra Wilkins Slater, and many arms that extend from the Wilkins family. They have connections with Linda Chesterfield and Governor Beebe, both of whom accepted campaign money from Preferred Family Healthcare. Linda Chesterfield, on was on Hillary Clinton’s leadership council for her 2016 presidential campaign, and has connections with Rusty Cranford, the key central figure in Warford’s investigation. And finally, Linda Cavaness, who pleaded guilty to campaign fraud, used to be a deputy finance director for Hillary’s 2008 presidential campaign.
The Clinton Foundation, through Clinton Health Matters Initiative, had over 200 supporters working with them, from the police departments to the governor’s office, the department of human services where the deputy director pleaded guilty in February 2016 to bribery schemes and is serving a 30-month prison sentence, to the department of health and education, the university and school district, as well as the Winthrop Rockefeller Institute, Planned Parenthood, and Loop Capital Markets – just to name a few. All of these businesses and institutions are complicit in working with an illegally operating entity, Clinton Health Matters Initiative.
Add to this, the Wilkins case sentencing being pushed back several times in joint motions between his attorneys and government, all raises one very important question – are these investigations heading down a track that can only end at Clinton station, or perhaps the library?
Or consider a one-time donation
| {
"pile_set_name": "OpenWebText2"
} |
Q:
c++ std::forward on the container calling operator[]
In the book "Effective modern C++", at the item 3 there is written this piece of code:
template<typename Container, typename Index>
decltype(auto)
authAndAccess(Container&& c, Index i)
{
authenticateUser();
return std::forward<Container>(c)[i];
}
I don't understand why you call std::forward? If c is an rvalue reference, what does it change to call the operator[] on a rvalue instead on a lvalue? For me c[i] should be enough.
PS: I understand the purpose of std::forward when the variable is a parameter of a function as:
template<typename T, typename... Ts>
std::unique_ptr<T> make_unique(Ts&&... params)
{
return std::unique_ptr<T>(new T(std::forward<Ts>(params)...));
}
A:
It’s possible that operator[] for Container has been overloaded for rvalues and lvalues.
auto Container::opeartor[](int i) && -> Container::value_type&;
auto Container::opeartor[](int i) & -> Container::value_type&;
If so, we want to make sure that if c was initialized with an rvalue, we call the rvalue version of operator[] on c. It’s certainly not common to overload operator[] to behave differently for lvalues and rvalues, but it’s possible, so in truly generic code, we need to apply std::forward to c before forwarding it to operator[].
| {
"pile_set_name": "StackExchange"
} |
Opinion Issued May 12, 2005
In The
Court of Appeals
For The
First District of Texas
NO. 01-04-00195-CR
DAVID CHARLES HOLFORD, Appellant
V.
THE STATE OF TEXAS, Appellee
On Appeal from the 183rd District Court
Harris County, Texas
Trial Court Cause No. 973817
O P I N I O N
A jury convicted appellant David Charles Holford of capital murder and
assessed punishment at life imprisonment. On appeal, Holford contends that the trial
court erred in (1) charging the jury with ambiguous application paragraphs; (2) using
a disjunctive jury instruction with a general verdict; and (3) admitting autopsy
photographs into evidence. We hold that the trial court did not err in charging the
jury and did not abuse its discretion in admitting the photographs into evidence. We
therefore affirm.
Facts
David Holford and his co-defendant, Harold Vaughn,
were charged with the
robbery and murder of eighteen-year-old Trevor Cook. Cook dated Gina Powell, who
often visited his apartment. She sometimes would be accompanied by her friend
Sheila Bricht.
Cook sold drugs out of his apartment. He kept the bathroom closet, containing
his main supply of drugs, locked. Cook allowed clients to view his secondary stash
of drugs, which he kept in the kitchen. It was well-known that Cook often kept $1,000
or more worth of cocaine and large sums of cash in the apartment. Cook’s upstairs
neighbor, Ryan Wick, advised him to be more careful about showing people his money
and drugs.
Holford regularly visited Cook’s apartment to buy cocaine and play video
games. Vaughn sometimes accompanied Holford when visiting Cook’s apartment.
Vaughn was known for his aggressiveness, and he always carried a knife with him.
He also sometimes carried a one-and-one-half foot long, rusty red wrench with a spike
on it. Holford knew of Vaughn’s temper. Although Holford had received a monetary
settlement from a motorcycle accident in the summer of 2000, the money was under
his parents’ control, and he complained about limits on his spending.
In August 2001, Holford confided in one of his friends, Dan Dickerson, that he
was thinking about “jacking” Cook or taking Cook’s drugs and money. In early
January 2002, Vaughn complained of his financial problems to Holford. Holford
stated that he knew someone whom they could jack, but they would have to kill him.
On January 13, 2002, at approximately 3:00 p.m., Vaughn and Holford were
present when Cook transacted a drug deal with one of his friends, Ronald Hornburg.
Both Vaughn and Holford remained inside Cook’s apartment while the transaction
took place. Sometime between 3:30 and 4:00 p.m., Cook’s neighbor heard the sound
of Cook’s gate opening and closing and saw Vaughn emerge from inside the
apartment. A short time later, the neighbor heard more noises and saw both Holford
and Vaughn outside Cook’s apartment. Ten to fifteen minutes later, Wick heard some
loud knocking on Cook’s door, which continued for approximately twenty minutes.
Having unsuccessfully attempted to reach Cook since around noon that day,
Powell and Bricht arrived at Cook’s apartment at approximately 4:00 p.m. to return
Cook’s truck to his possession, which Powell earlier had borrowed. Cook did not
answer his door or his cell phone. Powell noticed that Cook’s bedroom window was
unlatched, which she found unusual. The screen over the window was loose and fell
to the floor with a mere touch. The women climbed through the window into the
apartment. Upon entering Cook’s apartment, the women noticed that his belongings
were in disarray and that his dog was acting in a disturbed manner. The women
discovered Cook lying on the living room floor in a pool of blood, and they called the
police. They then ran upstairs to inform Wick of Cook’s death and to obtain the
correct address for the apartment.
While Bricht waited outside for the police, Vaughn walked up with two fresh
scratches on his face, wearing one of Cook’s shirts. Vaughn entered the apartment and
viewed Cook’s body, but appeared unaffected by what he saw. After saying, “I’ve got
to get out of here,” Vaughn left.
Officers James Ramsey and Janet Nederland of the Houston Police Department
Homicide Division and Crime Scene Investigation unit, respectively, arrived and
inspected the apartment. The investigation revealed blood on a washcloth, which
DNA testing later matched to Vaughn. The investigation also revealed a broken
bathroom closet door. The contents of the closet had been removed.
When Holford’s friend, Dickerson, learned of Cook’s death, he conveyed the
information to Holford. Dickerson was shocked that Holford was unsympathetic; he
heard Holford say to Vaughn, in a hushed voice, “He heard about the move,” a phrase
denoting some illegal activity. The next day, Dickerson called the police and told
them that Vaughn and Holford were possible suspects.
Approximately a week after the murder, Christopher Vasquez, a friend of
Holford’s, went to Vaughn’s apartment, where he saw Cook’s Gucci hat and
approximately fifteen lines of cocaine on the coffee table. In mid-January 2002,
Holford tried to sell Cook’s Gucci hat for $100 to Frederick Morris, one of his friends.
Officer Ramsey secured arrest warrants for Holford and Vaughn, and executed
both of them at Vaughn’s apartment. A search of the apartment revealed a loaded
.380-caliber semi-automatic handgun, a Louis Vuitton wallet containing $843 in cash
and Vaughn’s identification, 22 butcher knives, two pocket knives, and Vaughn’s
tennis shoes with dried blood on both soles.
After arresting Vaughn and Holford, Officer Ramsey and his partner took the
men to the Stafford Police Station for questioning. There, Vaughn revealed that he
“got the best of Cook,” knocked him out, and then went into the kitchen to take
Cook’s drugs and money. Vaughn saw Holford cutting Cook’s throat and tying a
phone cord around Cook’s throat, but stated that he asked Holford to stop. Vaughn
conceded that he took $200 cash, drugs, clothing, and a .380 pistol from Cook. He
also admitted that he drove Holford home and returned to Cook’s apartment to retrieve
his cell phone.
Holford told the police that while he and Vaughn were inside Cook’s apartment,
he was looking out of a window and heard Vaughn strike Cook with a large wrench.
Holford claimed that he watched as Vaughn threw Cook around the apartment and
stabbed him with a knife. Holford claims that he then followed Vaughn into the
bedroom, telling Vaughn that they should get out of the apartment. Holford stated that
he watched Vaughn ransack the bedroom and take clothes and drugs from it.
Holford confessed to a fellow inmate that he and Vaughn went to Cook’s
apartment to rob him. He told the inmate that Vaughn hit Cook, grabbed him and used
a knife to cut his neck. While Vaughn used his knife, Holford hit Cook, causing Cook
to fall. Vaughn ran out the door while Holford continued to hit and kick Cook.
Holford told the inmate that he and Vaughn agreed that they would have to kill Cook
because Cook knew them and that they could not use a gun to do it because it would
be too loud.
An examination of Cook’s body revealed that he had dozens of blunt-force-trauma injuries on his face and body and a recently knocked-out tooth, and that he had
nearly been decapitated. Abrasions on Cook’s skin, including one above his left
eyebrow, were consistent with his having being struck by a wrench. A hole in Cook’s
right shoulder was consistent with the pointed end of the wrench’s having been driven
into the skin.
Holford wore shoes to his trial with soles that matched a bloody mark in Cook’s
kitchen. The footprint of these shoes also was consistent with stomp marks on Cook’s
body, made while Cook was still alive.
Jury Instructions
Holford’s first four points of error concern the trial court’s instructions to the
jury. In his first two issues, Holford contends that the trial judge gave ambiguous
application instructions regarding the law of parties. In his third and forth issues,
Holford contends that the disjunctive jury instruction denied him a unanimous verdict.
Standard of review
When reviewing a trial court’s jury instructions, we first determine whether the
jury charge was erroneous. Nguyen v. State, 811 S.W.2d 165, 167 (Tex.
App.—Houston [1st Dist.] 1991, pet. ref’d). Error occurs when a jury charge fails to
directly apply the law to the facts. Harris v. State, 522 S.W.2d 199, 202 (Tex. Crim.
App. 1975). An erroneous jury charge does not result in an automatic reversal of a
conviction. Tex. Code Crim. Proc. Ann. 36.19 (Vernon 1981); Almanza v. State,
686 S.W.2d 157, 171 (Tex. Crim. App. 1984). Not only must there be error, but a
resulting harm that requires reversal must exist. Id. In the present case, Holford did
not object to the court’s charge. Reversal thus requires an error that is so egregious
and created such harm that Holford was denied a fair and impartial trial. See id.
Application Paragraphs with the Law of Parties
The application paragraph of a jury charge tells the jury under what
circumstances it can find the defendant guilty. McFarland v. State, 928 S.W.2d 482,
515 (Tex. Crim. App. 1996) (overruled on other grounds by Mosely v. State, 983
S.W.2d 249 (Tex. Crim. App. 1998)). Here, Holford’s application paragraphs
included the possibility of finding guilt under the law of parties. Under the law of
parties, a person may be criminally responsible for the murder committed by another
person if “acting with intent to promote or assist” the murder, he solicits, encourages,
directs, aids, or attempts to aid the other person” to commit the murder. See Tex. Pen.
Code Ann. § 7.02(a)(2) (Vernon 2003).
Holford contends that the trial court instructed the jury with ambiguous
application paragraphs concerning the law of parties. Holford contends that wording
within these paragraphs permitted the jury to convict him as a party to capital murder
if he intended to aid only in the robbery, as opposed to the required intent to aid in the
murder of Cook. The two application paragraphs at issue are as follows:
If you find from the evidence beyond a reasonable doubt that on or about
the 13th day of January, 2002, in Harris County, Texas, Harold Louis
Vaughn, did then and there unlawfully, while in the course of committing
or attempting to commit the robbery of Trevor Cook, intentionally cause
the death of Trevor Cook by cutting Trevor Cook with a deadly weapon,
namely, a knife, and that the defendant, David Charles Holford, with the
intent to promote or assist the commission of the offense, if any,
solicited, encouraged, directed, aided or attempted to aid Harold Louis
Vaughn to commit the offense, if he did; or
. . . .
If you find from the evidence beyond a reasonable doubt that on or about
the 13th day of January, 2002, in Harris County, Texas, Harold Louis
Vaughn, did then and there unlawfully while in the course of committing
or attempting to commit the robbery of Trevor Cook, intentionally cause
the death of Trevor Cook by striking Trevor Cook with a deadly weapon
unknown to the Grand Jury, and that the defendant, David Charles
Holford, with the intent to promote or assist the commission of the
offense, if any, solicited, encouraged, directed, aided or attempted to aid
Harold Louis Vaughn to commit the offense, if he did;
. . . then you will find the defendant guilty of capital murder, as charged
in the indictment.
Holford mis-quotes these paragraphs in his brief. He erroneously substitutes the
phrase “the offense of robbery” in place of “the robbery.”
Both parties cite to Barnes v. State, 56 S.W.3d 221 (Tex. App.—Fort Worth
2001, pet. ref’d) as persuasive authority. The application paragraph in Barnes
instructed the jury that the defendant was guilty of the offense of capital murder if it
found “from the evidence beyond a reasonable doubt that on or about the 11th day of
October, 1997, in Tarrant County, Texas, Carlis Russell, did intentionally cause the
death of an individual, [C.H.], by shooting her with a deadly weapon, to-wit: a
firearm, and the said Carlis Russell was then and there in the course of committing or
attempting to commit the offense of robbery of [C.H.], and [appellant], acting with the
intent to promote or assist the commission of the offense of capital murder, if any,
solicited, encouraged, directed, aided or attempted to aid Carlis Russell in the
commission of the offense.” Id. at 235 (emphasis in original).
The Barnes court found that the trial court properly instructed the jury, by
requiring it to find that defendant assisted in the murder and not just in the robbery.
The court noted that the prepositional phrase “in the commission of the offense”
referred to the previous phrase “the offense of capital murder.” Id.
Here, as in Barnes, the charge describes the capital murder as necessarily
occurring “while in the course of committing or attempting to commit the robbery.”
Unlike Barnes, the charge does not refer to the robbery as “the offense.” Rather, the
charge requires the jury to find that Holford promoted or assisted Vaughn in
intentionally causing the death of Cook, while in the course of committing or
attempting to commit robbery. Read logically, the prepositional phrase “with the
intent to promote or assist the commission of the offense” refers to Cook’s murder,
that occurred “while in the course of committing or attempting to commit the
robbery.” Likewise, the clause “solicited, encouraged, directed, aided or attempted to
aid Harold Louis Vaughn to commit the offense” refers to Cook’s murder.
Furthermore, any error in the application paragraphs could not have caused
Holford “egregious harm,” a requirement because Holford did not object to the
instruction. To determine whether a defendant has sustained egregious harm from an
un-objected to instruction, we consider (1) the entire charge; (2) the state of the
evidence, including contested issues; (3) arguments of counsel; and (4) any other
relevant information. Hutch v. State, 922 S.W.2d 166, 171 (Tex. Crim. App. 1996).
In the present case, the jury charge read in its entirety clearly instructed the jury
that, before it could find Holford guilty under the theory of the law of parties, it had
to find that he participated and intended both the robbery and the murder. For
instance, the paragraph immediately preceding the application paragraphs cautioned
the jury that these elements were necessary:
Before you would be warranted in finding the defendant guilty of capital
murder,. . . you must find from the evidence beyond a reasonable doubt
that the defendant, David Charles Holford, with the intent to promote or
assist in the commission of the offense of robbery, if any, solicited,
encouraged, directed, aided, or attempted to aid Harold Louis Vaughn
in cutting or striking Trevor Cook, if he did, with the intention of thereby
killing Trevor Cook . . . .
(Emphasis added).
Second, counsel for both the State and Holford argued to the jury that in order
to convict Holford, it must find that Holford intended Cook’s murder. Finally, the
State presented ample evidence to convict Holford and Holford has not challenged the
sufficiency of that evidence. We hold that, even if the trial court erred in the wording
of the application paragraphs, the error is not egregious.
Disjunctive Jury Charge
In his third and forth issues, Holford contends that a disjunctive jury charge
with a general verdict form deprived him of a unanimous finding, because it is
possible that some of the jurors did not unanimously agree on the underlying theories
of the State’s case.
In reviewing a disjunctive jury charge, we first determine whether the separate
application paragraphs contain different criminal acts or whether they merely instruct
as to different means of committing a single offense. If the disjunctive paragraphs
contain different criminal acts, then the jury must be instructed that it cannot return a
guilty verdict unless it agrees unanimously that the defendant committed one of the
acts. Ngo v. State, No. PD-0504-04, 2005 WL 600353, *3 (Tex. Crim. App., March
16, 2005) (designated for publication) (holding that because defendant was charged
with three different criminal acts of credit card abuse, jury had to unanimously agree
that defendant did at least one of three different things: steal the credit card, knowingly
receive the stolen credit card, or fraudulently present stolen credit card with intent to
obtain benefit). If the disjunctive paragraphs merely inform of different means of
committing a single offense, then the jury does not have to unanimously agree on
which alternative means the defendant used to commit the offense. Kitchens v. State,
823 S.W.2d 256 (Tex. Crim. App. 1991). In determining whether the paragraphs are
separate criminal acts or separate means of committing one act, “[a] handy, though not
definitive, rule of thumb is to look to the statutory verb defining the criminal act.”
Ngo, 2005 WL at *4 n. 24.
The facts here are similar to those in Kitchens v. State, 823 S.W.2d 256 (Tex.
Crim. App. 1991). In Kitchens, the jury charge presented two alternative theories of
capital murder – one in the course of aggravated assault and the other in the course of
robbery. The Court of Criminal Appeals held that if alternative theories of the same
offense are submitted to the jury in the disjunctive, then the jury may return a general
verdict as long as the evidence is sufficient to support a finding under any of the
theories submitted. Id. at 258. No general requirement exists that the jury reach
agreement on the preliminary factual issues that underlie the verdict. Id. at 259.
Likewise, in Schad v. Arizona, 501 U.S. 624, 642–44, 111 S. Ct. 2491, 2502–03
(1991), the United States Supreme Court concluded that it is not unconstitutional to
instruct a federal jury that it could find a defendant guilty of felony murder or
premeditated murder within a single guilty verdict form.
No general requirement
exists as part of the due process clause that a jury agree on the preliminary facts
underlying a verdict. Id.
Here, Holford is charged with committing capital murder. The application
paragraphs permitted the jury to find Holford guilty upon finding that: (1) he
committed the capital murder; or (2) Vaughn committed the murder, and Holford was
criminally responsible for it under either the law of parties or as a conspirator. See
Tex. Pen. Code Ann. §§ 7.02(a)(2), 7.02(b). Only one statutory verb defines the
criminal act–causing the death of Cook during a robbery. Each of the disjunctive
paragraphs thus describes a different means of committing the same act. The
paragraphs instructing on conspiracy and law of parties include a transferred intent as
a potential means of committing the offense, but the transferred intent ultimately
relates to the same actus reus. Here, as in Schad and Kitchens, the actus reus of
Holford’s offense was murder. We hold that the trial court’s instructions require the
jurors to agree that Holford committed that single act (either directly or via transferred
intent), and thus the trial court did not err in failing to instruct the jury that it must
agree unanimously on the manner of Cook’s murder.
Holford attempts to distinguish Kitchens by contending that it did not involve
erroneous application paragraphs. We have held that the trial court did not err in its
submission of the application paragraphs, thus this distinction is without merit.
Moreover, Holford’s complaint about the application paragraphs does not attack the
use of the alternative theories of the means of the murder. Instead, he complains that
“offense” was ambiguous as to its antecedent.
The trial court instructed the jury to find Holford guilty if he committed one act
and one offense – the capital murder of Cook. The State’s case presented alternative
theories of the method Holford used to commit the offense, and the State offered
evidence to convict Holford based on each alternative. On appeal, Holford has not
challenged the sufficiency of that evidence in any respect. We hold that the trial court
did not err in submitting a disjunctive jury charge with a general verdict for the single
offense of capital murder. Admissibility of Autopsy Photographs
In his last issue, Holford contends that the trial court abused its discretion in
admitting three colored autopsy photographs: State’s Exhibit 305 (a photograph of the
decedent’s brain after the skull had been cut open) and State’s Exhibits 318 and 319
(photographs of the decedent’s lung).
Holford contends that the photographs were
not helpful to the jury in resolving any contested issues of fact. Moreover, he
contends that any probative value of the photographs substantially is outweighed by
their prejudicial impact on the jury.
Standard of Review
The trial court’s decision to admit or exclude evidence is reviewed for an abuse
of discretion. Montgomery v. State, 810 S.W.2d 372, 391 (Tex. Crim. App. 1991) (op.
on reh’g).
Standard to Admit Photographs
As a general rule, a photograph is admissible if it is relevant to a material issue
and is an accurate representation of its subject as of a given time. DeLuna v. State,
711 S.W.2d 44, 46 (Tex. Crim. App. 1986). Generally, relevant evidence may be
excluded if its probative value substantially is outweighed by the danger of unfair
prejudice. Tex. R. Evid. 403. We apply Rule 403 to these photographs and determine
whether they assist the jury with its decision of guilt and are relevant, legitimate and
logical to the testimony that they accompany. If helpful, photographs are admissible
unless “the emotional and prejudicial aspects substantially outweigh the helpful
aspects.” Erazo v. State, 144 S.W.3d 487, 491–92 (Tex. Crim. App. 2004).
State’s Exhibit 305, 318 and 319
Holford contends that State’s Exhibits 305, 318, and 319 could not have been
helpful to the jury because he did not dispute the severity of the injuries or the cause
of Cook’s death. Holford did not need to dispute these facts to make the photographs
probative. First, the autopsy photographs are material to the trial because they show
Cook’s injuries. See id. 144 S.W.3d at 494 (finding photographs could be helpful to
juries, in part, because they show wounds suffered by victim for whose death
defendants were on trial). Second, with Holford’s consent, the State presented the
direct examination of most of its witnesses simultaneously before both Holford’s and
Vaughn’s juries.
The medical examiner testified, and introduced his autopsy
photographs, before both juries. Therefore, in determining the relevancy of these
photographs, we look to the issues raised in both Holford’s and Vaughn’s trials.
The medical examiner used the photographs of the decedent’s lung (State’s
Exhibits 318 and 319) to illustrate that the stab wounds in Cook’s back were deep
enough to puncture his lung. He also used these photographs to illustrate the
discoloration caused by the blood inhaled into the lung, a sign that Cook was alive
when his throat was cut.
The medical examiner used the photograph of Cook’s brain inside the skull
(State’s Exhibit 305) to illustrate multiple areas of bleeding, bruising and
hemorrhaging on the undersurface of the decedent’s scalp, matching the injuries on
Cook’s head. He also used this photograph to illustrate that the brain was surrounded
by collections of blood, supporting his opinion that the trauma to Cook’s head could
have been the cause of his death. Evidence that trauma to Cook’s head was severe
enough to kill him was relevant because Vaughn told the police that although he
“knocked” Cook out, Holford cut Cook’s throat.
We conclude that the autopsy photographs were probative of the nature of the
injuries to Cook and that they were helpful to the jury in determining Holford’s and
Vaughn’s participation in Cook’s death. We next determine whether the prejudicial
effect of the three photographs substantially outweighs their relevance. Tex. R. Evid.
403. We consider the probative value of the evidence, the potential of the evidence
to impress the jury in some irrational, but nevertheless indelible way, the time that the
proponent needs to develop the evidence, and the proponent’s need for the evidence.
Erazo, 144 S.W.3d at 489. In the context of photographs, we also consider the number
of exhibits offered, their gruesomeness, their detail, their size, whether they are black
and white or color, whether they are close-up shots or of the whole body, whether the
body is naked or clothed, the availability of other means of proof, and other
circumstances unique to the individual case. Id. at 489 (citing Narvaiz v. State, 840
S.W.2d 415 (Tex. Crim. App. 1992)).
Autopsy photographs generally are admissible unless they depict mutilation of
the victim caused by the autopsy itself. Rojas v. State, 986 S.W.2d 241, 249 (Tex.
Crim. App. 1998). When photographs depict internal organs that have been removed
to portray the extent of the injury to the organs themselves, the photographs are not
considered to be depictions of mutilation of the victim by autopsy. Salazar v. State,
38 S.W.3d 141, 151–52 (Tex. Crim. App. 2001).
Here, the three photographs were admitted during the medical examiner’s
testimony. Such testimony constituted less than two out of the fifty-four pages of the
medical examiner’s direct testimony, and out of the six volumes of testimony in the
record–not an unreasonable amount of time.
The photographs are not particularly gruesome or emotionally charged, when
compared with photographs, admitted into evidence without objection, of the crime
scene, showing a nearly decapitated and badly beaten body in a pool of blood. The
autopsy photographs are not large: they are approximately three and one-half by five
inches in size. None of the photographs at issue show Cook’s entire body. The
photographs show only minimal damage caused from the autopsy. See Prible v. State,
No. AP-74487, 2005 WL 156555, at *10 (Tex. Crim. App. Jan. 26, 2005) (designated
for publication) (disembodied organs are not highly emotional, they are clinical).
The photographs are three in number. Although Cook’s death was one of the
more traumatic ones that the medical examiner had seen, the State introduced only
twenty-five photographs. The medical examiner testified that out of the numerous
photographs taken, he chose those which best show the injuries to Cook. He further
stated that they were necessary to show to the jury the nature of the decedent’s
injuries. We conclude that the probative nature of State’s Exhibits 305, 318, and 319
is not substantially outweighed by any prejudicial effect. The trial court thus did not
abuse its discretion in admitting the autopsy photographs into evidence.
Conclusion
We conclude (1) the application paragraphs of the charging instructions are not
ambiguous and, even if they are, the instructions did not result in egregious harm to
the defendant; (2) the disjunctive charging instructions did not deny Holford a
unanimous verdict; and (3) the trial court did not error in admitting autopsy
photographs into evidence. We therefore affirm the judgment of the trial court.
Jane Bland
Justice
Panel consists of Chief Justice Radack and Justices Higley and Bland.
Publish. Tex. R. App. P. 47.2(b).
| {
"pile_set_name": "FreeLaw"
} |
Introduction {#s1}
============
It is estimated that over 340 million new cases of sexually transmitted diseases (STDs) occur annually throughout the world, with the highest incidence in developing countries. Pelvic inflammatory disease, infertility, ectopic pregnancy, chronic pelvic pain, neonatal morbidity and mortality, and genital cancer all have been associated to some degree to STDs [@pone.0098862-World1]. Furthermore, an increasing risk of acquiring these infections may have a substantial impact on global susceptibility to HIV-1 transmission [@pone.0098862-Simms1]--[@pone.0098862-Van1].
Since 1993, the World Health Organization (WHO) has established a role for genital tract infections in human infertility [@pone.0098862-World2]. Most male STD pathogens seem to be involved in male reproductive tract problems, including genital injury, infections of semen, prostatitis, urethritis, epididymitis and orchitis [@pone.0098862-Brookings1]. There is possible involvement in female infertility, pregnancy complications and transmission from infected mothers to the fetus or newborn [@pone.0098862-Ochsendorf1]. According to recent findings 15--20% of infertile male subjects are affected by semen infection [@pone.0098862-Garolla1], and most data have been concordant with respect to the relevance of STDs to male infertility [@pone.0098862-Ochsendorf1], [@pone.0098862-Garolla1]. Several STDs in semen were associated with poor sperm quality [@pone.0098862-Bezold1] and decreased sperm concentration and motility [@pone.0098862-Ochsendorf1]. However, there are few studies evaluating these aspects, and additional epidemiological studies in different populations and clinical scenarios are needed to determine the real impact of STD pathogens on male infertility.
Semen STDs are prevalent in asymptomatic males over extended periods of time [@pone.0098862-Ochsendorf1]. Chronic or inadequately treated infections play a greater role in infertility than acute infections, although in many cases the exact etiological agents are unknown [@pone.0098862-World1]. An undiagnosed infection can have potentially significant implications for individual\'s and population health [@pone.0098862-Rusz1]. For this reason, some authors have proposed the implementation of screening programs for semen STD pathogens in infertility and STD clinics and in sperm banks [@pone.0098862-Olatunbosun1], [@pone.0098862-Peeling1].
Over the past three decades, diagnostics for STDs have depended nearly exclusively on traditional methods, such as culture, enzyme immunoassay, and fluorescent antibody staining, especially in developing word [@pone.0098862-Sankuntaw1]. The need for rapid, sensitive, versatile and low cost diagnostic tools for the screening of semen samples is evident.
Here we report a validated multiplex polymerase chain reaction (M-PCR) diagnostic method to simultaneous screen for *Chlamydia trachomatis*, *Neisseria gonorrhoeae*, *Mycoplasma genitalium*, *Trichomonas vaginalis*, herpes virus (HSV) types 1 and 2, and *Treponema pallidum* in semen. Human *Papillomavirus* (HPV) and genotypes also were detected by single PCR (sPCR) in the same semen samples. We anticipate that M-PCR will potentially impact diagnostics of STD in semen and contribute to diminish male infertility in the near future.
Materials and Methods {#s2}
=====================
Study population and semen specimens {#s2a}
------------------------------------
The study population was selected in the Sperm Analysis Section (SAS) of Clinical and Research Laboratory of State University of Maringá (UEM)/Brazil between January 2012 and June 2013. Semen analysis was requested as part of a work-up for conjugal infertility investigations after failing to conceive after one year of unprotected intercourse or as a post-vasectomy sterility control. Men who had reproductive system abnormalities (e.g., varicocele), symptoms of genitourinary infections, or those that had received antibiotics within the preceding 3 months or infertility therapy within the preceding year were excluded from the study. Considering this exclusion criteria, the semen samples analyzed between January 2011 and June 2012 (prior to the study period) by SAS/UEM, the sample size calculated for our study was fixed at least 72 semen samples (confidence interval of 95% and an error estimate of 5%; EPI INFO 7.0 software).
A total of 76 men were included in the present study with a mean age of 33.4 ± 7.2 years (range 19--51). The men signed a consent form, and this study was approved by the Committee for Ethics in Research Involving Humans at the State University of Maringá (UEM)/Paraná, Brazil (No. 162.209/2012).
Prior to semen collection and analysis, the men were asked to abstain from sexual intercourse or masturbation for 3--5 days. All samples for analysis were collected on site and into standard containers that had previously been shown not to have any cytotoxic effects on human spermatozoa [@pone.0098862-World3]. Immediately after semen collection, the samples were placed in an incubator and liquefied at 37°C for up to 30 minutes. Semen analysis was performed according to the World Health Organization [@pone.0098862-World3] criteria to determine the following variables: seminal volume, pH, sperm concentration, vitality, total progressive motility (category \[a + b\]), rapid progressive motility (category \[a\]) and morphology (normal forms) [@pone.0098862-World3]. Oligospermia was defined as sperm concentration \<20×10^6^/ml, asthenospermia as sperm motility \<50% (category \[a + b\]), necrospermia as sperm vitality \<50% and teratospermia as normal morphology \<30%.
Genomic DNA extraction {#s2b}
----------------------
DNA was extracted using an AxyPrep Body Fluid Viral DNA/RNA Miniprep Kit (Axygen, CA, USA) according to the manufacturer\'s instructions. The quality and quantity of purified DNA were measured by spectrophotometry (NanoDrop 2000 Spectrophotometer, Thermo Scientific, Wilmington, USA).
Multiplex-PCR for 7 STD pathogens in semen {#s2c}
------------------------------------------
We made selected adaptations to previously designed M-PCR assays to achieve simultaneous detection of the seven selected STDs [@pone.0098862-Sankuntaw1], [@pone.0098862-Souza1], [@pone.0098862-Muvunyi1]. Primers were characterized by compatible melting temperatures and yielded amplicons with sizes easily separable by agarose gel electrophoresis ([Table 1](#pone-0098862-t001){ref-type="table"}). The optimized protocol consisted of a reaction mixture of 25 µL containing 2.5 mM of each dNTP, 0.6 mM of MgCl~2~, 25 mM of each primer, 5 µL of extracted DNA (50 ng of total sample) and 1 U of Platinum Taq DNA polymerase (Invitrogen, CA, USA). The PCR conditions comprised thirty-five amplification cycles of denaturation for 10 minutes at 94°C, annealing for 1 minute at 62°C, extension for 1 minute at 72°C and final extension for 10 minutes at 72°C (Thermal cycler, Biosystem, CA, USA). The M-PCR products were electrophoresed on a 2.5% agarose gel stained with 1 µg/mL ethidium bromide. In a few cases in which the bands have not been viewed in the 2.5% agarose gel, we analyzed products using an 8% polyacrylamide gel. Positive controls for all studied STDs were derived from positive clinical samples detected by reference methods, including culture and/or single-target PCR (sPCR). For validation, sPCR was also performed for the seven microorganisms in all samples studied and for positive controls using the same primers as for the M-PCR. sPCR (gold standard) is generally more sensitive than M-PCR, and cross-reactivity, which can occur during M-PCR, is avoided [@pone.0098862-McIver1].
10.1371/journal.pone.0098862.t001
###### Oligonucleotide primers used in the M--PCR assay.
{#pone-0098862-t001-1}
Pathogens Primers Oligonucleotides (5′-- 3′) Amplicon size (bp)
----------- ----------------- ------------------------------------------------------ --------------------
CT Forward Reverse TCTTTTTAAACCTCCGGAACCCACTT GGATGGCATCGCATAGCATTCTTTG 361
TP Forward Reverse GGAGAAGTTTCACTTCGTGGA CTCGCGTCATCACCGTAGTA 291
HSV-2 Forward Reverse CATGGGGCGTTTGACCTC TACACAGTGATCGGGATGCT 249
MG Forward Reverse ACCTTGATGGTCAGCAAAACTT CCTTTGATCTCATTCCAATCAGTA 193
TV Forward Reverse CCAGAAGTGGGCTACACACC ATACCAAGGCCGGAAGCAC 170
NG Forward Reverse CGGCAGCATTCAATTTGTT AAAAAGCCGCCATTTTTGTA 162
HSV-1 Forward Reverse CTGTGGTGTTTTTGGCATCA GGTTGTGGAGGAGACGTTG 123
M--PCR, multiplex--PCR; CT, *C. trachomatis*; TP, *T. pallidum*; HSV--1/--2: herpes virus simplex; MG, *M. genitalium*; TV, *T. vaginalis*; NG, *N. gonorrhea*; bp, base pairs.
All clinical samples were also tested using human β-globin-specific primers GH20/PC04 as an internal control for amplification and DNA integrity under the same conditions as the M-PCR or sPCR reactions.
sPCR for HPV detection {#s2d}
----------------------
This method has been in use in our laboratory for several years and consists of HPV-PCR amplification carried out using primers MY09 (5\'CGTCCMAARGGAWACTGATC-3′) and MY11 (5′-GCMCAGGGWCATAAYAATGG-3′) as described previously [@pone.0098862-Manos1]. The reaction consisted of 2.5 mM of each dNTP, 1 U of Taq DNA polymerase (Invitrogen, Carlsbad, CA), 0.6 mM of MgCl~2~, 25 mM of each primer and 50 ng of extracted DNA for a final volume of 15 µL. PCR products were electrophoresed on a 1.0% agarose gel, stained with 1 µg/mL ethidium bromide, and photodocumented under UV light. The samples that gave a positive result by PCR were further analyzed by HPV genotyping. Co-amplification of the human β-globin gene was performed as an internal control using primers GH20 (5′-GAAGAGCCAAGGACAGGTAC-3′) and PC04 (5′-CAACTTCATCCACGTTCACC-3′) under the same conditions as the HPV-PCR. Two types of controls were also included in each reaction series: 'no-DNA' (negative control) and 'HPV-positive DNA' (positive control).
PCR-RFLP for HPV genotyping {#s2e}
---------------------------
HPV-positive samples were genotyped using a PCR-RFLP (Restriction Fragment Length Polymorphism) as described previously [@pone.0098862-Santiago1]. Ten microliters of each PCR sample were digested in a final volume of 15 µL with the restriction enzyme *Hpy*CH4 V (New England Biolabs, Ipswich, MA, USA) according to the manufacturer\'s instructions. Restriction fragments were resolved on 8% polyacrylamide gels. HPV genotypes were determined by analyzing each band with Labimage 1D software (Loccus Biotechnology, São Paulo, Brazil), and comparison of the molecular weights determined the genotypes following carcinogenic potential: HR-HPV (high-risk-HPV), UR-HPV (undetermined-risk-HPV) and LR-HPV (low-risk-HPV). The following types were determined for this genotyping method: HR (−16, −18, −31, −33, −35, −39, −45, −51, −52, −53, −56, −58, −59, −66, −68, −73 and −82), undetermined risk (UR- 26) and LR (−6, −11, −30, −34, −40, −42, −43, −44, −54, −55, −61, −62, −64, −67, −69, −70, −72, −74, −81, −83, −84 and −91) (International Agency for Research on Cancer-IARC).
Statistical analysis {#s2f}
--------------------
Statistical analysis was performed using EPI INFO 7.0 software (CDC, Atlanta, GA, USA). All the variables were expressed as absolute and relative frequencies. The Chi-square test and a crude odds ratio (OR) with 95% confidence interval (CI) were calculated. A *p* value \<0.05 was considered statistically significant.
Results {#s3}
=======
We evaluated 52 semen samples from men subjected to semen analysis due conjugal infertility (68.4%) and 24 due post-vasectomy control (31.6%). Overall, the men had a mean of 1.2 ± 1.9 children (range 0--5), and this value was 0.5 ± 0.9 (range 0--4) for those experiencing conjugal infertility.
The M-PCR assay clearly distinguished and identified all seven STDs in semen samples whether alone (1 STD) or in co-infections. Final results were regarded as true positives if the sPCR was positive (gold standard). The overall agreement of M-PCR results with sPCR was 99.2%, and the validation parameters were as follows: sensitivity and negative predictive value 100%, specificity 99.7%, positive predictive value 96.4%, and accuracy 99.8%. When individually analysed the agents *C. trachomatis, M. genitalium, N. gonorrhoeae, T. pallidum*, *T. vaginalis* and HSV-2, the M-PCR showed values of 100% for all parameters. For HSV-1, the M-PCR showed sensitivity and negative predictive values of 100%, specificity of 98.2%, positive predictive value of 75.0%, and accuracy of 98.3% ([Table 2](#pone-0098862-t002){ref-type="table"}). By M-PCR, 5 semen samples (6.6%) were detected with at least 2 simultaneous STD agents. [Figure 1](#pone-0098862-g001){ref-type="fig"} shows the M-PCR amplification fragments of positive semen samples for different STDs by 8% polyacrylamide gel.
{#pone-0098862-g001}
10.1371/journal.pone.0098862.t002
###### M--PCR validation results compared with single PCR (sPCR) for seven clinically important STDs pathogens in semen, including *Chlamydia trachomatis*, *Mycoplasma genitalium*, *Neisseria gonorrhoeae*, *Treponema pallidum, Trichomonas vaginalis*, HSV--2 and HSV--1.
{#pone-0098862-t002-2}
M--PCR parameters General results (%) CT (%) MG (%) NG (%) TP (%) TV (%) HSV-- 2 (%) HSV--1 (%)
------------------- --------------------- -------- -------- -------- -------- -------- ------------- ------------
Sensitivity 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Specificity 99.70 100.00 100.00 100.00 100.00 100.00 100.00 98.20
PPV 96.40 100.00 100.00 100.00 100.00 100.00 100.00 75.00
NPV 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
ACC 99.80 100.00 100.00 100.00 100.00 100.00 100.00 98.3
M--PCR, multiplex--polymerase chain reaction; sPCR, single polymerase chain reaction; STDs, sexually transmitted diseases; PPV, positive predictive value; NPV, negative predictive value; ACC, accuracy; CT, *C. trachomatis*; TP, *T. pallidum*; HSV--1/--2: herpes virus simplex; MG, *M. genitalium*; TV, *T. vaginalis*; NG, *N. gonorrhea*.
Considering the 7 STDs detected by M-PCR and HPV by sPCR, 1 or more STDs were detected in 42 semen samples (55.3%). The most prevalent STD detected was HPV (*n* = 29), representing 38.1% of the total samples and 69.0% of the semen positive for STDs. The second most prevalent was *T. vaginalis* (*n* = 10; 13.0% in total samples and 23.8% in semen with STD), followed by *C. trachomatis* (*n* = 6; 8.0% in total samples and 14.3% in semen with STD), HSV-1 and *T. pallidum* (*n* = 4; 5.3% in total semen samples and 9.5% of semen with STD, each), *M. genitalium* and *N. gonorrhoeae* (*n* = 3; 4.0% in total samples and 7.1% in semen with STD, each) and HSV-2 (*n* = 2; 2.6% in total samples and 4.8% in semen with STD) ([Table 3](#pone-0098862-t003){ref-type="table"}). Co-infections by 2 pathogens was in 17 out of 42 infected samples (40.5%) ([Table 4](#pone-0098862-t004){ref-type="table"}). Three simultaneous STD were detected in only 1 sample (2.4% of semen with STD and 1.32% of total samples).
10.1371/journal.pone.0098862.t003
###### Frequency of STDs and reason for performing the semen analysis.
{#pone-0098862-t003-3}
STD Total *n* (%) Conjugal infertility *n* (%) Post-- vasectomy *n* (%) OR (IC 95%) *P*
------------------ --------------- ------------------------------ -------------------------- ----------------- ------
HPV
(+) 29 (38.0) 20 (38.5) 9 (37.5) 1.1 (0.4--3.0) 0.78
(−) 47 (62.0) 32 (61.5) 15 (62.5)
HR--HPV
(+) 24 (32.0) 16 (30.8) 8 (33.3) 0.9 (0.3--2.7) 0.90
(−) 52 (68.0) 36 (69.2) 16 (66.7)
*C. trachomatis*
(+) 6 (8.0) 5 (9.6) 1 (4.2) 2.5 (0.3--23.6) 0.40
(−) 70 (92.0) 47 (90.4) 23 (95.8)
*T. vaginalis*
(+) 10 (13.0) 7 (13.5) 3 (12.5) 1.1 (0.3--4.9) 0.83
(−) 66 (87.0) 45 (86.5) 21 (87.5)
*M. genitalium*
(+) 3 (4.0) 2 (3.9) 1 (4.2) 0.9 (0.0--11.3) 0.90
(−) 73 (96.0) 50 (96.1) 23 (95.8)
HSV--1/--2
(+) 6 (8.0) 5 (9.6) 1 (4.2) 2.5 (0.3--23.6) 0.40
(−) 70 (92.0) 47 (90.4) 23 (95.8)
*T. pallidum*
(+) 4 (5.3) 4 (7.7) 0 (0) -- 0.10
(−) 72 (94.7) 48 (92.3) 24 (100.0)
*N. gonorrheae*
(+) 3 (4.0) 2 (3.9) 1 (4.2) 0.9 (0.0--11.3) 0.90
(−) 3 (96.0) 50 (96.1) 23 (95.8)
Total 76 52 24 -- --
STD, sexually transmitted diseases; HPV, human *Papillomavirus*; HR--HPV, high--risk human *Papillomavirus*; HSV--1/--2, herpes simplex virus; (+), positive; (−), negative.
10.1371/journal.pone.0098862.t004
###### Total simultaneous STDs detected by M-PCR and sPCR.
{#pone-0098862-t004-4}
Simultaneous STDs *n* Total semen samples *n* = 76 (%) Semen samples with STD *n* = 42 (%)
-------------------------------- ----- ---------------------------------- -------------------------------------
*C. trachomatis* + HSV--1 2 2.6 4.8
*T. pallidum* + *T. vaginalis* 1 1.3 2.4
HSV--2 + *T. vaginalis* 1 1.3 2.4
HSV--2 + *T. pallidum* 1 1.3 2.4
HPV + *T. vaginalis* 3 3.9 7.1
HPV + *C. trachomatis* 3 3.9 7.1
HPV + HSV--1 2 2.6 4.8
HPV + *M. genitalium* 2 2.6 4.8
HPV + *N. gonorrhoe* 1 1.3 2.4
HPV + *T. pallidum* 1 1.3 2.4
STDs; sexually trasnmitted disease; M-PCR, multiplex-polymerase chain reaction; sPCR, single polymerase chain reaction; HSV -1/-2, herpes vírus simplex.
In the semen of men with conjugal infertility, the most prevalent STD was HPV (*n* = 20/52; 38.5%), followed by *T. vaginalis* (n = 7/52; 13.5%), *C. trachomatis* and HSV-1/-2 (*n* = 5/52; 9.6% each). In the semen analyzed due to post-vasectomy, the most prevalent STD was also HPV (*n* = 9/24; 37.5%), followed by *T. vaginalis* (*n* = 3; 12.5%) ([Table 3](#pone-0098862-t003){ref-type="table"}). Men with *C. trachomatis* or HSV (types 1 and 2) semen infections had a 2.5-fold greater risk of presenting conjugal infertility (OR = 2.5, 95% CI = 0.3--22.7), although the association between these STDs and conjugal infertility was not statistically significant (*p* = 0.4 for both).
Among HPV positive semen (*n* = 29), 17 (58.6%) were infected by 2 or more genotypes simultaneously representing 22.5% of the total samples and 40.5% of the semen with STDs. [Figure 2](#pone-0098862-g002){ref-type="fig"} shows the sPCR amplification fragments of positive semen samples for HPV by 8% polyacrylamide gel. In regarding to carcinogenic HPV groups, 24 out of 29 (82.7%) were HR-HPV. HPV-16 (HR) was the most prevalent genotype detected (*n* = 13/29; 44.8%) and was found in 17.1% of the total samples and 30.9% of the semen with STDs. HPV-82 and HPV-43 (HR) were the second most prevalent (n = 5/29; 17.2% each), followed by HPV-72 (LR, *n* = 4/29; 13.8%), −58 (HR, *n* = 3/29; 10.3%); −54 (LR) and −66 (HR) (*n* = 2/29; 6.9% each). Other HPV genotypes detected in single or simultaneous infections were HPV-13,-18,-31,-44,-51,-52,-53,-59,-62,-69 and -81 (*n* = 1/29; 3.5% each). [Table 5](#pone-0098862-t005){ref-type="table"} shows the HPV genotypes detected in simultaneous semen HPV infections. According to Santiago et al. [@pone.0098862-Santiago1], their method with a single enzyme (HpyCH4V) application is simple enough for the detection of HPV in clinical samples but cannot be used to distinguish some HPV genotypes such as HPV 11/30, 18/68, 44/55, and 61/83/84, because these genotypes yield similar RFLP patterns. Chen et al. [@pone.0098862-Chen1] used the same enzyme (*Hpy*CH4V) for the initial RFLP and then used a second enzyme ((*Nla*III) to confirm the identification. We didn\'t find any of these genotypes in our analysis and the patter found by the single enzyme was very different and yielded us to well distinguish between all of them, using the 8% polyacrylamide gel as showed in [Figure 2](#pone-0098862-g002){ref-type="fig"}. So, as mentioned above there was not the requirement to apply another assay with the second enzyme to confirm our results.
{#pone-0098862-g002}
10.1371/journal.pone.0098862.t005
###### HPV genotypes distribution of 17 semem samples with two or more genotypes.
{#pone-0098862-t005-5}
Samples HPV genotypes *n* (%)
--------- --------------- ---------- -----------
1 −81 16, −66 1 (5.88)
2 \_ −51, −52 1 (5.88)
3 \_ 16, −82 1 (5.88)
4 \_ 16, −31 1 (5.88)
5 −54 −82 2 (11.80)
6 −72 −53 1 (5.88)
7 −72 −58 1 (5.88)
8 −43 −82 1 (5.88)
9 −44 −82 1 (5.88)
10 −43 −58 1 (5.88)
11 −43, −72 \_ 1 (5.88)
12 \_ −16, −59 1 (5.88)
13 \_ −16, −58 1 (5.88)
14 \_ −16, −56 1 (5.88)
15 −69 −16 1 (5.88)
16 −72 −16 1 (5.88)
17 −43 −16 1 (5.88)
HPV, human *Papillomavirus*; HR, high--risk human *Papillomavirus*; LR, low-risk human *Papillomavirus*.
In regarding to semen quality parameters, the following observations were made: a decrease of seminal volume in samples with 2 or 3 simultaneous STDs or *T. pallidum* alone (*p* = 0.01 and *p* = 0.02, respectively); semen with simultaneous *T. vaginalis* and HPV infections had a 10-fold greater risk of presenting teratospermia (OR = 10.55; 95% CI 0.8 to 13.3) (*p* = 0.03); a tendency toward a greater risk of semen alterations, although not statistically significant, between *T. vaginalis* and necrospermia (OR = 2.7; 95% CI 0.4 to 15.7) (*p* = 0.2), simultaneous *T. vaginalis* and HPV with oligospermia (OR = 2.8; 95% CI 0.2 to 3.3) (*p* = 0.3) and simultaneous HSV-1/-2 and HPV with teratospermia (OR = 4.6; 95% CI 0.2 to 8.2) (*p* = 0.2).
Discussion {#s4}
==========
To our knowledge, this is the first study to detect simultaneous bacterial and viral STD pathogens in semen using M-PCR in Brazil and Latin America. The method implemented, which represented an important advance over conventional techniques, allowed the detection of seven STDs in semen, many of which are difficult to identify using standard methods. The overall agreement of the M-PCR with sPCR was elevated (99.2%), and other validation parameters, including sensitivity, specificity, positive and negative predictive value and accuracy, were also excellent (ranging from 99.2% to 100%). Considering the agents individually, the M-PCR also showed excellent values for all the parameters and detected 5 semen samples (6.6%) with co-infections.
The M-PCR assay simplifies workflow, allowing for its use in routine diagnostic laboratories with basic molecular facilities [@pone.0098862-McKechnie1]--[@pone.0098862-Gdoura1]. Thus, this M-PCR assay has great potential to be applied in screening programs for semen pathogens in infertility and STD clinics and in sperm banks. Further investigations applying M-PCR in different populations and clinical situations may help elucidate the impact of STD pathogens on male infertility. All encompassed 7 STDs in addition to HPV were analyzed by M-PCR and sPCR. The overall prevalence of STDs in semen from asymptomatic men was determined to mount to 42 semen samples out of 52 (55.3%) and showed 1 or more pathogens.
HPV was the most prevalent STD pathogen in semen (*n* = 29; 38.1% of total semen and 69.0% of semen with STDs). Surprisingly, in 58.6% of semen samples 2 or more genotypes were detected simultaneously (22.5% of total semen and 40.5% of positive semen for STDs) and HR-HPV represented 82.7% of all the HPV genotypes detected. The most prevalent HPV genotype was HPV-16 (*n* = 13/29, 44.8%; *n* = 13/76, 17.1%), followed by HPV-82 and HPV-43, both of which are HR-HPV (*n* = 5/29; 17.2% each). The current vaccine protects against HR HPV-16 and -18, but in our study HPV-18 genotype is not the second most frequent HR but HPV-82 and -43, which could have implications for the effectiveness of the vaccine Brazilian men.
A recent study found HPV at a much lower prevalence (10%), but the population selected for this research included only asymptomatic sexually active young men [@pone.0098862-Chen1]. HPV infection is well-characterized in women. However, little attention has been given to the transmission of HPV through semen [@pone.0098862-Foresta1], [@pone.0098862-Kaspersen1] because the virus is primarily transmitted through direct epithelial contact [@pone.0098862-Elder1]. Normally, HPV infection in men is considered temporary, but little is known about the incubation time and possible viral manifestations [@pone.0098862-Foresta2].
The second most prevalent STD was *T. vaginalis* (*n* = 10; 13.0% in total semen samples and 23.8% in semen with STDs). Knowledge of *T. vaginalis* in men, including in semen, is limited mainly due to difficulties associated with diagnosis including poor sensitivity of available methods [@pone.0098862-Rein1], [@pone.0098862-Hobbs1]. Estimates of the prevalence of trichomoniasis range from 6--12% of asymptomatic men to 20% of men with urethritis [@pone.0098862-Hobbs2]. A study in females with trichomoniasis analyzed the urine and semen of their sexual partners and found that 72% of men were also positive for *T. vaginalis* despite the fact that the majority were asymptomatic [@pone.0098862-Hobbs1].
*C. trachomatis* was the third most common STD (*n* = 6; 8.0% in total semen samples and 14.3% semen with STD). The number of men infected by this pathoges was similar to another study that showed that although up to 13.3% of young men carry genital *C. trachomatis* infection, only half of these will present with any symptom and even fewer are likely to pursue treatment [@pone.0098862-LaMontagne1]. Thus, it has been suggested that undiagnosed *C. trachomatis* infection in either partner could potentially contribute to unexplained infertility [@pone.0098862-Cunningham1]. This bacterium can be located in any part of the male reproductive tract, including sexual glands, such as the prostate and seminal vesicles [@pone.0098862-MackernOberti1]. *C. trachomatis* infections of male sexual glands may cause severe complications that can threaten male fertility [@pone.0098862-Cunningham1]. Urethritis is the most common clinical presentation of *C. trachomatis* infection observed in men [@pone.0098862-Eley1], but it is normally an acute episode of chronic and silent genitourinary infection [@pone.0098862-Gonzales1]--[@pone.0098862-Kalwij1]. Evidence also suggests that upper genital tract infections in young men, including epididymitis, are attributable to *C. trachomatis* [@pone.0098862-Nadala1]--[@pone.0098862-Furuya1]. Epididymitis is thought to be important because fertility can be affected by inflammation and obstruction, especially when both testes are affected [@pone.0098862-Eley1].
Other STD pathogens were detected in lower abundances as follows: HSV-1 and *T. pallidum* (*n* = 4/76; 5.3% each), *M. genitalium* and *N. gonorrhoeae* (*n* = 3/76; 4.0% each) and HSV-2 (*n* = 2/76). No previous studies were found assessing the prevalence of *T. pallidum* in semen. Although a direct toxic effect of syphilis on male fertility has not been reported in the literature, it is known that complications of syphilis can affect fertility. Syphilitic epididymitis can cause obstruction of the epididymis. Chronic obliterative endarteritis and interstitial inflammation can occur in congenital or tertiary syphilis and lead to small, fibrotic testes [@pone.0098862-Cheng1]. Gummatous lesions cause destruction of local tissue and, when occurring in the testicles, may have an impact on testicular function and fertility [@pone.0098862-Brookings2].
Among men presenting persistent or recurrent urethritis, 19% to 41% are infected with *M. genitalium* [@pone.0098862-Wikstrm1]. This bacterium is a probable cause of non-gonococcal urethritis [@pone.0098862-Uuskla1], [@pone.0098862-Jensen1] and is also associated with prostatitis [@pone.0098862-Gdoura1], [@pone.0098862-Krieger1]--[@pone.0098862-Svenstrup1]. The detection of genital mycoplasmas only in semen may indicate that these organisms are harbored in the epididymis or seminal vesicles. The influence of mycoplasmas on semenology may come from their ability to attach to spermatozoa and directly affect cellular interactions, influencing vitality, motility, morphology, cellular integrity, molecular structure and the development of protective immunity to genital infection by the host or other host factors [@pone.0098862-Gdoura1].
*N. gonorrhoeae* infection in men can lead to genitourinary tract inflammation (e.g., urethritis and epididymitis), obstruction and infertility [@pone.0098862-Edwards1]--[@pone.0098862-Radek1]. Gonococcus is transmitted more efficiently from an infected male to a female (50% to 73% probability, independent of the number of exposures) [@pone.0098862-Edwards1], [@pone.0098862-Bolan1], [@pone.0098862-Hook1]. Because *N. gonorrhoeae* is mostly symptomatic in males, there have been very few studies regarding the relationship between this infection and male infertility. Surprisingly, we detected HSV-2 in semen less frequently than HSV-1. Most commonly, HSV-1 causes oral and genital sores, but HSV-2 is the most common cause of genital herpes. Generally, direct or indirect contact with herpetic lesions is infectious, but HSV-1 and HSV-2 have been detected in semen [@pone.0098862-Bezold2], [@pone.0098862-Zuckerman1] and in sperm, and HSV-2 has been transmitted through donor insemination [@pone.0098862-Kotronias1], [@pone.0098862-Kaspersen2]. DNA of HSV-1 and HSV-2 has been detected in the semen from 2-50% of men with no significant difference between fertile and infertile subjects [@pone.0098862-Bezold2], [@pone.0098862-Kotronias1], [@pone.0098862-Neofytou1]. Evidence indicates that HSV infections contribute to male factor infertility either by directly invading male genital tract cells or by indirectly causing local immune responses that can negatively affect reproduction [@pone.0098862-Ochsendorf2]. More specifically, HSV infection has been correlated to reduced sperm count, progressive motility, increased apoptosis and low sperm concentration [@pone.0098862-Monavari1], [@pone.0098862-Wu1].
Other viruses can be highly frequent in semen such as cytomegalovirus (CMV) [@pone.0098862-Garolla1], [@pone.0098862-Neofytou1] which is well known a STD pathogen [@pone.0098862-McIver1]. CMV could be one of the most frequent pathogens in semen. However it was not investigated in our study, since our aim was adapt the M-PCR assay for seven agents as used by Souza et al. [@pone.0098862-Souza1] in cervical samples to semen samples and we succeed. Thus, a new M-PCR assay allowing the detection of other STD agents would be interesting and a promising research to be standardized.
Despite being a secondary goal of our study some associations were observed between STDs and changes in semen parameters such as: decreased seminal volume in samples with 2 or 3 simultaneous STDs or *T. pallidum* alone; semen with simultaneous *T. vaginalis* and HPV infections with a 10-fold greater risk of teratospermia. Correlations were also observed in: *T. vaginalis* with necrospermia; *T. vaginalis* and HPV co-infections with oligospermia; HSV-1/-2 and HPV co-infections with teratospermia. These associations confirmed the involvement of STD pathogens with male infertility as described in few previous studies [@pone.0098862-Ochsendorf1]--[@pone.0098862-Bezold1].
[^1]: **Competing Interests:**Co-authors Marcia Lopes Edilaine Consolaro and Marcelo G Bonini are PLOS ONE Editorial Board members. This does not alter the authors\' adherence to PLOS ONE Editorial policies and criteria.
[^2]: Conceived and designed the experiments: MELC FG. Performed the experiments: FG FSM ALPA IBE NM VRBV MMTI. Analyzed the data: MELC FG MGD SSM-E MGB. Contributed reagents/materials/analysis tools: MELC MGB SSM-E. Wrote the paper: MELC FG FSM.
| {
"pile_set_name": "PubMed Central"
} |
pls find this article and print for me (sounds interesting--please give to
Soldano and Mike Moran also). Thanks. DF
---------------------- Forwarded by Drew Fossum/ET&S/Enron on 03/21/2000
03:17 PM ---------------------------
From: Michel Nelson 03/20/2000 09:44 AM
To: Bill Cordes/ET&S/Enron@ENRON, Drew Fossum/ET&S/Enron@ENRON, Steven
Harris/ET&S/Enron@ENRON
cc: Charlie Graham/ET&S/Enron@ENRON
Subject: PG&E
PGE story regarding release of movie and potential for additional news (bad)
out of their Topock location.
Steve
http://www.sfgate.com/cgi-bin/article.cgi?file=/chronicle/archive/2000/03/16/M
N30158.DTL | {
"pile_set_name": "Enron Emails"
} |
You will need to sign on with your LLLID (La Leche League ID) before you can post. If you have never claimed your LLLID, create your LLLID now. To sign in, click the LLLID Sign On button in the upper right corner. Enter your LLLID Alias and click the button again.
Solids..?
Dear all, my lo is 5 mo and our paediatrician says we should start on solids. She has been exclusively breastfeeding up until now and is doing great on weight and height.
I want to keep her another month on exclusive breastfeeding but she is really eager to start eating. She goes crazy when she sees food on the table and everytime i'm ready to take a bite she opens her mouth waiting for it!
What should i do?I dont want to deprive her of food if she wants it that bad but then again i want to do the best possible for her.
Re: Solids..?
Feel free to wait a month. It's wonderful that your baby is excited to join in at mealtimes, but that doesn't mean you have to start solids now. If she's getting impatient, hand her an empty spoon, bowl, or cup to play with at mealtimes. That way she'll feel like she is just like the big people, with their fancy utensils!
When you start solids, I highly recommend and approach called Baby-Led Weaning or Baby-Led Solids, where you don't spoon-feed your child purees or cereals. You just put a selection of healthy, baby-friendly solids in front of your LO and let her experiment with getting them into her own mouth. Good starter foods include things like steamed mashed veggies (carrots, peas, sweet potatoes), cheerios, and whole peeled apples (babies generally have a greattime licking and tasting them).
Re: Solids..?
Breastmilk is so healthy and breastmilk really does contain all the nutrients a healthy baby needs.
I avoided all the pureed baby foods and cereals and I waited until my LO's could self feed.
I did nurse around the clock and my lo's were in arms reach all day.
If you baby can sit up w/o slouching and if you baby can bring her thumb and pointer finger together to pick up a piece of soft food, like cooled potato, avocado, banana then go for it. Sometimes food is more like a learning activity than a true meal.
Re: Solids..?
My son showed several signs of readiness before 6 months. We gave him just a couple bites of solids around 5.5 months and it really bothered his tummy, so we stopped and waited until 6.5 months to start back up with it. I think sometimes babies brains are ready for solids a little early, but most of the time their tummies are not. My son still mostly just played with his food until 8 months, when he started taking a few bites here and here.
There's no hurry to start solids. You're not depriving your baby of anything; you are providing her with the best possible nutrition.
Re: Solids..?
If Dr. is saying go for it - I would say nurse LO before meal time to make sure she is adequately nurished and if she still acts like she is interested in food put a few items (easy to "chew" (or gum rather) and swallow of course) in front of her to see what she does. However, I know my biggest fear with starting solids (when we get to that point) is allergies since they run in my family horribly and babies are more prone to food allergies before 6 months. So be cautious.
~ Andrea
Happily married to Scott (11-28-09)Proud mama of Brielle Morgan (3-7-12). Bent on breastfeeding - no matter how many hurdles we have to jump over. Working full time so we're "winging it" with everything else and doing what works best for us.
Re: Solids..?
Thank you all for your answers and input. I am in no rush to start solids (my husband is, he thinks she will sleep longer) but since she is so eager and our doctor said so this is why i am asking. I was planning on starting before 6 months since i am enjoying breastfeeding her a lot. Another thing that confuses me is the difference of opinions when it comes to what she should start with. My doctor wants to give her rice flour (i am not sure this is the right name since i'm greek) but it is a sort of puree. We don't have any allergies in the family so i'm not concerned but still why the difference of opinions?
Re: Solids..?
Rice cereal is often recommended as a first food because it is bland and because it is often fortified with vitamins and minerals. Many moms and some doctors don't recommend cereals as first foods for three reasons: one, babies don't necessarily like bland foods, particularly if they are breastfed (since breastmilk is flavored by what you eat, which means baby has been exposed to flavorful food since birth), two, the vitamins and minerals in rice cereal are easily obtained from more nutritious foods like fruits, veggies, and meats, and three, rice cereal may have vitamins and minerals but aside from that it's just pure starch. No fiber, no fat, no protein. It's not the healthiest stuff!
Re: Solids..?
If things are going well for baby with EBF, and you are happy with it, and your LO is only 5 mo, I would wonder what the rush is. For some additional personal perspective on baby seeming interested in food - our LO started grabbing for my husband's coffee cup when he was something like 5 mo old or even younger. It's not because he wanted to have (or should have, of course!) coffee - it's because he wants to be more like the people he spends the most time with and start doing what they're doing. So my husband while holding him would let our LO copy him and put his mouth on the mug to "take a sip" - obviously not to drink any, and LO wasn't even trying to do that in the beginning - just to make him feel like he was part of the experience.
I've also read that in the beginning of moving to solids, babies are just as interested in empty cups and (safe) utensils as they are in the food, as mommal mentioned.
I like to think of it this way - just because my baby starts pounding on my laptop keyboard if I happen to sit with him in front of it, does not mean he intends to send an email.
Re: Solids..?
Oh! I forgot to mention the AAP guidelines, which do recommend EBF for 6 mo:
"The American Academy of Pediatrics reaffirms its recommendation of exclusive breastfeeding for about 6 months, followed by continued breastfeeding as complementary foods are introduced, with continuation of breastfeeding for 1 year or longer as mutually desired by mother and infant." | {
"pile_set_name": "Pile-CC"
} |
1984 Australian Open – Women's Doubles
Martina Navratilova and Pam Shriver were the defending champions and won in the final 6–3, 6–4 against Claudia Kohde-Kilsch and Helena Suková. They thus completed the 1984 Calendar Slam in Women's Doubles.
Seeds
Champion seeds are indicated in bold text while text in italics indicates the round in which those seeds were eliminated.
Draw
Final
Top Half
Bottom Half
External links
Women's Doubles
Category:Australian Open (tennis) by year – Women's Doubles | {
"pile_set_name": "Wikipedia (en)"
} |
Rep. Dana Rohrabacher (Calif.), a one-time confidant to former Speaker Newt Gingrich (Ga.), is no longer starry-eyed about the GOP presidential hopeful and believes his moon base plan is a bust.
Rohrabacher has endorsed former Massachusetts Gov. Mitt Romney in the Republican nomination contest.
For the record: Rohrabacher is absolutely starry-eyed about all things relating to space exploration. He’s just not convinced that Gingrich is the rocket man to lead us there.
“I think that it is unrealistic to think that we could establish a moon base by 2020, even if we spent all the money in the world. ... [It’s] just going to bankrupt every other program,” Rohrabacher warned of Gingrich’s bombastic plan, which he flogged in Florida last week, to jump-start the battle for the stars.
The plan, even on Florida’s Space Coast, didn’t seem to impress as Gingrich got trounced in Tuesday’s GOP primary in the Sunshine State.
According to Rohrabacher, the former Speaker’s major strength — visionary thinking — has time and again been undermined by less-than-exemplary follow-through.
“The trouble is, it’s never part of Newt’s calculation whether or not something can be realistically accomplished,” the House Science, Space and Technology Committee member charged.
Rohrabacher would, however, be fine with having Gingrich spew out big ideas ad infinitum. As long as someone else ultimately pilots them home.
“He should go on a lecture as being a futurologist who can paint pictures for people of what a bright future we could have,” Rohrabacher counseled. “But he doesn’t have the management and leadership abilities to lead those to fruition.” | {
"pile_set_name": "Pile-CC"
} |
Wednesday, August 31, 2011
14 said: bucolic those in the bath
Period: 1900
Creator: Ludwig von Hofmann, Germany
Specification: 65cm × 96cm
Materials: fabric paint
Keep possession at: private possession
This is a decorative painting style symbolism. Decorative pattern in the border, the show is a bath in the joy of rural scenery in the picture. Border of the left and right for men and women of the naked, who points out symmetrically on both sides, means that the world balance. The picture of the girl playing the bathing water, relative to communication with the frame in the Watermark, metaphor for life because of love and youth access to energy. From the picture, we can see the artist inherent in ideological and philosophical.
Monday, August 29, 2011
This is a rich portrait of the plot of a girl sitting cross-legged on the stall, carefully, intently reading the album. Girl dressed in a yellow dress very texture, in contrast with the dark background, more dedicated to bring out the girls look. Johnson faces a good girl, pure and serious, showing a good upbringing. Reflect the whole picture of a kind of academic rigor and elegance.
The painting from the 1980s model Dorothy Dene (nineteenth century), after a mid-Leiden source of inspiration for many works. Unique perspective, coupled with beautiful curved body models (many of Raphael's works so successful, critics call it the rhythm of the female body) to make this painting unique. Bright colors makes the painting is particularly eye-catching.
Extremely rigorous academic Leiden to describe the attitude of the music lesson scene. Female teachers debug strings slightly bent to help girls, girls, female teachers in the chest are plucked by a vielle. This is just an ordinary music lesson scene scene, he was the artist has depicted very aesthetic charm. Elegant and beautiful face of female teachers, long skirts, pattern, texture is very realistic painter depicted; depicted a little girl was innocent, pure and innocent, earnest expression, it is extremely cute. Clothing, face and background of the picture, all reflect the academic style, but the painting is intrinsically fulfilling.
Thursday, August 18, 2011
Bowl near Paris, France Aoni Ai Island is an island park, summer is the summer resort community in Paris. "Bowl Island Sunday afternoon," the new Impressionist painting the most representative work, it is an art history _ seven in the world has a landmark work. Canvas, Seurat depicts a number of people on weekends to play here, the artist intends to be sunlight the screen is divided into the grass, water, people, and obscured by trees shade the crowd, grass, etc., such a treatment to produce a picture kind of strong and sharp contrast. There are those Zhanli with the audience, lying on the grass on the leisure as well as a variety of dynamic characters, especially children just wandering on the grassland of small animals, so that the whole picture in contrast to constitute Hexie unity.
From the technical analysis, the painting on the use of a composition major at the most vertical and horizontal lines, so that the configuration of the scene and characters arranged in a strict relationship between the child what separated them. In color processing, using different Dingliang Seurat's yellow, blue and rose water performance, and then also use different Dingliang performance of yellow and green grass, in Seurat's elaborate design and arrangement, they are embedded in a very precise manner This constitutes a relationship with a geometric framework, and very accurate figures arranged in proportion and perspective on the relationship to follow, therefore, the entire screen to show a lively and flowing poetry. In addition, from a mathematical point of view, the "bowl Island Sunday afternoon," the whole lot of painting is the result of the artist carefully calculated, that is, mixed in the ratio of seven color vision is the result of accurate calculation of the "measure" out of the .
Thursday, August 11, 2011
From the perspective of modern art history, British and American pop art in their different orbits parallel to develop. British Pop Art has two characteristics: First, its emergence and early development in the United States, that is a romantic and exciting way to stimulate the daily life of praise: the other major artists in general is that it was "Pop" is the word suited to their ideas and art. Strictly speaking, Hamilton is a new Dada artists, especially in painting, the old Sunburst than the United States has a more academic means and didactic components. Hamilton on the development of Pop Art in the UK to play the role of innovation and open up, especially for the 1950s of Hamilton, the definition of tomorrow's world is inevitable woman, food, newspapers and magazines, movies, cars, houses, comedy and television. Since then, his personal influence in the United States and Europe continues to expand.
After the 1960s, Hamilton rarely exhibited his work, but the main focus and interest into the form of commercial advertising and to explore materials, to develop a variety of works of art reproduction technology. Such as photography and printing. In 1968, he was the "Beatles" designed "white songbook," the album covers, with a unique style widely popular. His work always reflected in contemporary popular culture, and then again, he also uses computer technology to create a revolutionary work, deeply influenced a whole generation of British artists, including well-known painter and later • Mark Lancaster, Stephen • Buckley, Tim • Hede, care management • Carter, etc., of which there are his second wife, Lida • Donna. He broke the traditional art beyond the reach of the channel, the arts closer to everyday life. Especially today, is still the development of Western contemporary art has a huge impact.
Hamilton (Richard I Hamilton, 1922 ---), was born in London, England, from age 12 to enter a particular stage of a long arts education, especially when he entered an adult education institutions tutorial, he was a child . 14-year-old primary school to Westminster College and Saint Martins School of Art evening classes during the day and do odd jobs at a company office, but also as an advertising company to do the exhibition assistant. Later entered the Royal Academy of Fine Arts to study painting in 1946, was expelled from school because the school is not in accordance with the teaching of classes. And then later into another one of Fine Arts to study painting, learning the art of painting in the process of the Second World War to stop. In 1953, Doohan became a lecturer at the University of Hopkins Art Institute in 1957 in the United Kingdom Royal College of Art professor interior decoration course. After the 1960s, his paintings are widely recognized, has held solo exhibitions in many places, the 1980s, Hamilton has been using the computer's digital technology to create new works of pop art. | {
"pile_set_name": "Pile-CC"
} |
Note: Javascript is disabled or is not supported by your browser. For this reason, some items on this page will be unavailable. For more information about this message, please visit this page:
About CDC.gov
On March 19, 2013, a patient from United Arab Emirates who had severe respiratory infection was transferred to a hospital in Germany, 11 days after symptom onset. Infection with Middle East respiratory syndrome coronavirus (MERS-CoV) was suspected on...
To investigate potential transmission of Middle East respiratory syndrome coronavirus (MERS-CoV) to health care workers in a hospital, we serologically tested hospital contacts of the index case-patient in Saudi Arabia, 4 months after his death. None...
Healthcare settings can amplify transmission of Middle East respiratory syndrome coronavirus (MERS-CoV), but knowledge gaps about the epidemiology of transmission remain. We conducted a retrospective cohort study among healthcare personnel in hospita...
Risk factors for primary Middle East respiratory syndrome coronavirus (MERS-CoV) illness in humans are incompletely understood. We identified all primary MERS-CoV cases reported in Saudi Arabia during March-November 2014 by excluding those with histo... | {
"pile_set_name": "Pile-CC"
} |
Bishop Philip visits the Bournemouth Oratory in Formation
1 Aug 2017
The Bournemouth Oratory-in-Formation received its first visit, on Tuesday, from Bishop Philip (accompanied by Fr JP), who was delighted and encouraged by all that is happening. In the two months since the Oratorians’ arrival at Sacred Heart, the Community has already grown from four to five, with last week’s arrival of a third Brother.
In the photograph, from left to right: Brother Andrew Wagstaff (of Southampton, just arrived from 5 years at the Birmingham Oratory), Fr JP, Fr Dominic Jacob (Moderator of the Community), Bishop Philip, Fr Peter Edwards (Parish Priest), and Postulant Kari Hintikka (from Finland).
The Oratory Fathers have increased the number of weekday Masses with a 7.30 Mass on most mornings (in addition to the 12.15pm daily Mass). In the usual style of the English Oratories, Confessions are heard 20 minutes before every Mass; also on Wednesdays from 11am to 12 noon, on Saturdays 11am to 12 noon, and from 4 to 5pm. There’s now Eucharistic Adoration all morning on Wednesdays (and planned to expand). Benediction has begun on Sundays at 6pm; and the usual Blessing with the Relic of Saint Philip at the end of the Monday Masses.
Last month the Oratory began hosting “Hope for Food” – feeing 80-90 of Bournemouth’s homeless, from the Catholic Institute beneath the church, every Tuesday and Thursday evening (with provision elsewhere on the other five days).
The Oratory Parish has just registered participation in the worldwide “40 Days for Life” campaign of prayer, fasting, community out-reach, and peaceful vigils at one of Bournemouth’s five abortion clinics (27th September – 5th November). Bring your pro-life friends (whether Catholic or not) to the next preparatory meeting on Sunday 13th August immediately after 6pm Benediction.
The Parish Fellowship Group – eager to be reformed into the Secular (or Little) Oratory, following the pattern and principles of St Philip Neri in 16th century Rome – has just outlined its summer / autumn programme including Street Evangelization amid the summer holiday-makers, the Universities’ Freshers Fairs, Night Fever, DVDs and talks on St Philip, the Oratory, prayer and the spiritual life.
Fr Dominic has just returned from conducting the Hallam Diocesan Priests’ Retreat. The Oratory Fathers are supplying during the interregnum in their neighbouring parish of Westbourne. From previously derelict areas of the house, guest rooms, and a new bathroom are being prioritised for Priests who may like a short Retreat or few days of quiet prayer, as the Oratorians seek to be hospitable and of service to their diocesan brethren.
Sacred Heart TV
Bishop Philip Twitter
The Sacred Heart Church has long been a beacon of faith in the heart of Bournemouth and renowned for its beauty worldwide. The arrival of the Oratorian community of St Philip Neri has brought many developments, including an increasingly dignified liturgy. | {
"pile_set_name": "Pile-CC"
} |
When I am preparing an entire region for player characters to explore I try to have a good mix of ideas. In the Evermore region of Nevermore, large story ideas like the Eldest Empire will help catch the PC’s interest in maybe checking out the area while smaller hooks like Edinnu gives me something to blindside them with when they actually get there. I use this same concept of moving from large to small scale story hooks when making adventures for my campaigns too.
In fact, that’s perhaps the biggest secret to success when creating a setting: it should be written like an adventure. When your players hear about the places and the people in your setting, they should be itching to get directly involved in one conflict or another. That’s the reason your setting exists! Nothing excites me more than players resolving the inherent problems of the setting in ways I hadn’t expected them to.
At the heart of Nevermore is the Evermore region, so named because in ancient times it created ever more of the world with each passing day. This region consists of the Worldsbirth Caldera, a massive crater continent at the heart of the world, the Great Seal, a mystical ward restricting the flow of ichor, and the Caul, a mercurial region of islands immediately surrounding the Worldsbirth Caldera.
Nevermore: the Evermore
If you like what you’ve read here at the Sterling Vermin Adventuring Co. we hope you’ll consider liking us on facebook, following us on twitter, and subscribing to our subreddit. You can support us on Patreon or by purchasing our products on DM’s Guild. | {
"pile_set_name": "OpenWebText2"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.