text
stringlengths
69
4.31k
labels
stringclasses
2 values
There's news out regarding a 60-day extension for California residents "affected by the COVID-19 virus", but the wording they use is so vague. Everyone was affected. Do they mean directly contracted the virus? Or is this truly everyone in California can have an extra 60 days to file and pay?
virus
I own a condo apartment in Schaumburg Illinois. The tenant has lost her job because of COVID-2019 and is unable to pay the rent. I however have to pay the monthly installments as mortgage for this house. What are the options for me? Can i terminate the lease which currently ends on October 2020? Is there a law where i ...
would
I had symptoms that could have been corona symptoms last week. Unfortunately the testing capacity in my country (Germany) is not sufficient to test every person with symptoms at the moment, so only people who had verified contact can be tested, which I didn't. It would be very useful, though, to know in hindsight wheth...
virus
The government has issued guidelines saying that we must stay inside. I understand this has now passed into law. Can anyone please point me to a copy of the legislation, and point out which sections are the relevant ones?
would
On Friday, Russia declined to participate in a plan devised by the Saudi-led Organization of the Petroleum Exporting Countries (OPEC) to cut oil production levels, in order to keep oil prices steady in response to the COVID-19 outbreak. The article describes this refusal as the cause of the 10% oil price crash on Frida...
would
My u-GPA is about 2.8 and GRE is 330, from now on is a hypothetical scenario as I haven't done my masters yet so if you could treat it as an actual case and give me subjective answers that would be great. For the masters I have found this growing researcher who is doing amazing work and is eager for me to join his lab ...
would
My wife had a return flight ticket from Seoul to Barcelona via Istanbul at Turkish Airlines for March 6th. We received a mail today (March 2nd) saying please call our Call Center. We called and they said the flight was cancelled. They gave us the options for a refund or change. When asking which changes were possible, ...
would
Dr. Raoult, who promotes Hydroxychloroquine, has some really intriguing statement about statistics in the biomedical field: It's counterintuitive, but the smaller the sample size of a clinical test, the more significant its results are. The differences in a sample of 20 people may be more significant than in a sample o...
would
I understand that we say something as a gold standard when it involves human intervention/judgement/review. But can someone help me understand what's the difference between probabilistic gold standard and deterministic gold standard. For ex: Patient has cancer or not - binary response - Deterministic gold standard whic...
would
Not an economist by far, just a layman, and that's a layman question. How is this possible that it's difficult to find mask for the Corona Virus? I have been several times to 7/11, boots, Watson, and other pharmacies, and everytime they did not have it as they ran out. How is it possible that the producers of masks giv...
virus
There are several aggregate central trackers for the spread of COVID-19. Like this one, for example. Is there anything similar for trials? Or trials in the pipeline? Either vaccines or treatments?
virus
There has been some electron micrograph of SARS-COV-2 published; but are there any fluorescent/ confocal-fluorescent image of them? or is it possible to do them? I know that viruses are usually much smaller than capacity of light microscope but I think by using any immunofluorescent probe or FISH technique it is possib...
virus
Are there any open source projects that a novice data analyst and mathematician can do, to fight against covid-19 epidemic? I mean, I know that the best I can do is to stay away from people and now I have a laptop and plenty of time to work on some project. But the thing is that I don't know what kind of computations w...
virus
I live in a fairly desirable area with one drawback: my apartment overlooks a multi-lane restricted access parkway. I'd prefer not to say more for privacy reasons. Until recently, it's been only a minor annoyance. But since things have been locked down due to the coronavirus outbreak, I've been spending a lot more time...
would
In light of the coronavirus outbreak centred in Wuhan, many countries have taken steps to either prevent entry or require a quarantine period for arrivals from the affected area. Canada relies on arrivals declaring whether or not they have been to Wuhan in the past 14 days. Yes, some people will tell the truth. But som...
virus
A friend of mine is currently in Cuba and was due to return to the UK on 2 April travelling Holguin> Montreal with Air Canada, and onwards to London Gatwick with BA (single PNR, booking made direct via the Air Canada website). Yesterday she received an email cancelling her flight but without giving any alternative. Lon...
would
I have been an employee at the company for over 5-year and I had requested time off work (4-months) to do sabbatical with some travelling. It was granted by my line manager. The request was made in person and then finalised in email. However, fast-forward to now and due to the coronavirus pandemic, I have had to return...
would
I don't have any background in genetics and bioinformatics, so I ask you if you think that the arguments provided in the article The proximal origin of SARS-CoV-2 by Andersen et al. are convincing. In particular: While the analyses above suggest that SARS-CoV-2 may bind human ACE2 with high affinity, computational anal...
virus
On my 2019 Tax Return I claimed my 28 year old girlfriend as a dependent. This makes her ineligible to receive a COVID Stimulus Check. My return was already accepted and I have already received my refund. Should I amend my return, remove her as a dependent? Would she then be eligible to receive the stimulus check?
would
This article describes the efforts of several European Union countries to agree to issue "corona bonds" or "Eurobonds", which are a joint EU mechanism to issue joint debt shared between different countries. This measure is being proposed in order to "mitigate the economic impact of the coronavirus". It says: “We need t...
virus
As many flights are cancelled due to COVID-19, it can be sometimes difficult to find a flight between a given country becomes available. How can I get notified when a flight between from a given airport to a given country becomes available within the next n days (where n can be defined by the user, e.g. n=7)? Or otherw...
would
It is well-known that South-Korea has developed a powerful system of drive-through testing allowing them to test hundreds of thousands of person in the past two months. I was wondering whether the test-subjects all visit those testing stations on a voluntary basis (because they are worried about their health) or whethe...
virus
I found the there is a project Folding@home to fight against COVID-19. As far as I understand, it uses huge amount of computing power to find a cure. Why do we need such a huge number of potential candidates for compounds? I have understood that the limiting thing when developing drugs is the clinical tests, and one re...
virus
So a series of news articles are being spread around that purportedly attributes some of Bernie Sanders' losses in states due to low voter turnout. A quick search on Google reports tens of articles all claiming the same or similar findings: Google search However, I recently saw an article on Reddit that says this claim...
would
OK. Short version, I'm stuck on my PhD because of coronavirus. My university is giving me an extension to my thesis deadline, but I am going to run out of funding pretty soon. I'm looking at marketable skills I can use to generate a bit of income to bridge the gap, and one of these is scientific writing. I know that th...
would
I was on vacation in the US for 3 weeks. I am a Colombian citizen. Before I was to return on March 23 to Colombia my flight was cancelled due to Colombia closing its borders including to its citizens that were traveling overseas at the time. All international flights have been canceled. What happens if my visa travel d...
would
Many countries have instructed their elderly population to stay at home because of COVID-19. Young people like myself are starting to volunteer to help deliver food and other supplies. But given asymptomatic transmission and virus spread from contact with contaminated surfaces, how I can make sure I don't accidentally ...
virus
This is a strange case of difference in fatality rate between Chinese and Italian covid-19 outbreak. In my knowledge, fatality rate is a ratio between deaths from a certain disease compared to the total number of subjects diagnosed with the disease. Starting from this assumption, I attempted to analyze difference in fa...
virus
Recently, German Chancellor Angela Merkel gave a speech about the importance of slowing down Covid-19. Among her remarks were The most important thing, the chancellor said, is to slow down the spread of the coronavirus to win time for people to develop immunity How does that work? Can immunity be developed without actu...
virus
Pls ELI5. 2013 was last time I opened macroeconomics textbook! I just have a B.A. economics. On r/Economics, u/ComfortableCold9 asked From your point of view, at what point would we [the USA in 2020] be approaching weimar? A QE program of 15 trillion? 25 trillion? Right under, u/Bumblewurth answered From my point of vi...
would
We planned a 3-week trip to Japan in March, but because of the recent increase in infections over there, we started to wonder if it wouldn't be smarter to cancel. This is our travel plan: 06-03-2020: Munich -> London -> Tokyo 27-03-2020: Tokyo -> London -> Munich We are mainly worried about two possibilities: The airpo...
virus
I am looking for a maintained and updated data feed that has the times of all confirmed cases of COVID 19 and their Geo coordinates. Thanks.
virus
My flight is from Detroit to Haneda Airport to Manila. Do I need to get a transit visa for Japan, because my layover at Haneda is 19 hours? I am a citizen of the Philippines.
would
I read on https://immigration.go.th/content/visa_auto_extension (mirror): 👮‍♂️ The person whose visas has expired from 26th of March 2020 will be automatically extended to 30th of April 2020. There is no need to apply for a visa extension at Immigration Office for this period and will not be fined THB 500 per day for ...
would
My neighbor who also bakes has run out of yeast and can't find any in the store. We went shopping this afternoon and couldn't find any either. I have a fair-sized jar of the stuff in my fridge, but I'm also baking a lot. I'm worried about it running out, plus I'd like to share with my neighbor. Is there a recommended t...
would
I had a ski trip planned from 14th March - 21st March. I arrived in the French ski resort at 15:00 on 14th March and by 23:00 the French government went into lock down and ordered all non-essential businesses to close immediately - including ski resorts. Fearing being stuck in the resort, the next morning I changed my ...
would
I am wondering if ICE has the legal authority to immediately arrest illegal immigrants after they have received medical care at U.S. hospitals for COVID-19. I am referring to people who voluntarily came into U.S. hospitals to receive this medical treatment. Moreover, if ICE does have the legal authority to do this, do ...
would
What would be the situation for a visitor should they contract Covid-19 and require hospitalisation whilst in the US? Would it be classed as an emergency or secondary care? Does the US provide emergency care free of charge? Do charges vary e.g. by state or hospital? My question was prompted by this one Is it safe for a...
virus
In the UK, the Prime Minister has stated Restaurants, pubs and clubs must close Although our wedding venue has a bar, serves food and has a dance floor in the marquee, they have not closed and therefore our insurance is not paying out as the wedding can technically still go ahead. Is the Prime minister’s closure statem...
would
This may seem off-topic question but I am really wondering how CS folks could help in situations like coronavirus. What novel problems arise from such disease? From CS and ML/AI perspectives, is there anything that Computer Scientists could do to better combat the coronavirus?
virus
In 2019 I booked a flight ticket with SAS to Svalbard. Unfortunately Covid19 happened. My ticket is from a flight outside the nordic countries, with a layover in Oslo. I'll be prevented from entering Norway, since I'm not a resident. Moreover, even if I was already in Norway right now, I'd be prevented from boarding th...
would
I am flying this week from Munich to London, and Bavaria just got the first contaminated person, who now has the Coronavirus 2019-nCoV after interacting with Chinese colleague. Two cases of the novel coronavirus have been confirmed in the UK, and the number of cases in Germany has grown. Moreover, the Coronavirus has n...
virus
Italy now has the most deaths from COVID. It's even above China in that list. Italian government asked for international help, some countries responded: At first, China provided huge help then, suddenly, Cuba send medical crew and then Russia send military virusologists It is a very surprising to me, that western media...
virus
On Monday, 06 April, 2020 the Financial Times reported that the Federal Reserve balance sheet could increase to $9 trillion. This is partly due to the myriad of initiatives, some new, to protect the economy of the United States during the 2020 Coronavirus Pandemic. A lot of online commentary is alarmist and centres on ...
would
There is a lockdown in the UK. I'm a student living at Warwickshire. I planned a 2 day trip a long time ago to the south of England, and I will be travelling by car with my friend (only 1 friend). With the current lockdown rules, will I be stopped and fined? What are the possible consequences? Update: I'm not going any...
would
It looks like I may completely write a paper while in coronavirus-related quarantine. Would it be appropriate to thank my local government in the acknowledgements? If I'm honest with myself, I don't think I would have been able to do this with such focus and efficiency if all other aspects of my life hadn't been sudden...
virus
Is there anything known about the RNA structures of coronaviruses? More specifically - do they have any interesting known structures in the translatable region, like RRE of HIV or the double loops in flaviviruses? Update Here is a recent development on the side of structure prediction.
virus
The corona virus appearantly does not like high temperature: High Temperature and High Humidity Reduce the Transmission of COVID-19 Also it seems that higher body temperatures helps the immune system to work better: Elevated body temperature helps certain types of immune cells to work better, evidence suggests Should t...
virus
Pictures of people clad in white protective gear, looking like SciFy and sparying streets, offices, factories and people have emerged in the media. What are they spraying and is there any evidence it will help stop or slow the spread of the disease? Making such large quantities of disinfectant must be costly, still the...
virus
Has anyone had success getting airlines to issue refunds, or at least extend the value of unused tickets, for upcoming travel that had been booked long before the COVID-19 outbreak? My question specifically concerns United Airlines and non-refundable tickets to destinations that are not otherwise covered by any explici...
would
I started grad school last September, and so far have been primarily busy with courses, but have been trying to do a little research on the side whenever I can. I recently finished all my courses though, and now I'm expected to dive into research. My advisor hasn't assigned me a project and expects me to come up with o...
would
I have heard about the saying “It’s the economy stupid”, but I’m not sure about how true it is now. Let’s use Trump’s approval as an example. Even though there is a “rally around the flag effect” that is typical of leaders during crises (it is a lot smaller than governors and foreign leaders and especially President Bu...
would
COVID-19 has caused many large-caps' stocks to tumble like Spirit, Husky Energy ($2.75). Why don't they reverse stock split to uplift their share prices? Here are some benefits of unsplitting: A high stock price can make the company look prestigious. E.g. A company trading at $1,000 per share will be perceived as more ...
would
How many SARS-CoV-2 viruses are in circulation at the moment? And what is their total mass? To clarify: if there are 10 000 viruses on average in an infected human and 100 000 humans are infected the answer would be (if all viruses are in humans, which probably isn't true) 10^4 x 10^5 = 10^9 viruses. Of course I am onl...
virus
New York City's Department of Health has issued a warning against performing rim jobs on other people, saying that it might be a means of transferring the COVID-19 virus to others: Rimming (mouth on anus) might spread COVID-19. Virus in feces may enter your mouth,” the city warned in the section titled, “Take care duri...
virus
Oseltamivir (tamiflu) is an antiviral medication used to treat and prevent influenza A and influenza B (flu). It is said (https://www.ncbi.nlm.nih.gov/pubmed/27660842) to reduce symptom duration even when initiated more than 2 days after symptom onset. Oseltamivir inhibits influenza virus replication and transmission f...
virus
The US government suspended travel from Europe to US, except for countries which are not in the Schengen area such as the UK and Ireland. Many comments from EU leader seem to assume that this is a political decision rather than a health-based decision, especially with regard to this exception. Is there any official rat...
would
I am a STEM teaching assistant. I know some professors were using physical class materials in engineering classes. How do you think they should respond to COVID-19-forced online education and still ensure the quality of their classes? It is a purposefully broad question. I was curious to hear what you think about the n...
would
Could one be injected with an infinitesimal amount of Covid-19 viral particles, in a way that it would trigger an immune response long enough before the virus overran the body? Could it be injected into tissue that was far enough away from the lungs, so that some immunity could build up before the virus reached the lun...
virus
Somewhat controversially, China has had temporarily relocated those infected with Covid-19 in the Wuhan area to so-called Fangcang hospitals, large communal areas transformed into make-shift hospitals. Although there were up to 13 Fangcang hospitals opened at one point in Wuhan, these were apparently all closed by Marc...
virus
For context, Australia, where I live, currently sits at ~130 confirmed cases, which makes me feel relatively safe for now, but naturally this will get worse with time as other countries' examples suggest. I will be working from home, avoiding public transport and limiting shopping to the minimum. I live in suburban Syd...
virus
I have a question about the novel coronavirus and swine flu. How do the death rates compare between the two diseases? How do the transmissions and rate of transmission compare? Was a vaccine developed quicker for swine flu? I ask because I don't recall this level of global disruption during the swine flu outbreak.
virus
I am trying to calculate the basic reproduction number $R_0$ of the new 2019-nCoV virus by fitting a SIR model to the current data. My code is based on https://arxiv.org/pdf/1605.01931.pdf, p. 11ff: library(deSolve) library(RColorBrewer) #https://en.wikipedia.org/wiki/Timeline_of_the_2019%E2%80%9320_Wuhan_coronavirus_o...
virus
I have been hearing a lot of people say that it is recommended to wash your hands thoroughly in order to maximise protection against COVID-19 infection. I also heard that the washing hands rumours are just a way to make people believe that they are protecting themselves and that the washing hands thing is actually not ...
virus
I have a train travel booked through Germany, Switzerland and Italy. All three legs of the travel are booked through bahn.de, and the Germany into Switzerland leg I can find back on the system of that site. I have asked a question and they will (or at least should) get back to me on that. The other two legs, (one from ...
would
Why are vaccines required for our body's immune system to destroy viruses that cause the likes of Covid-19 or Polio, while viruses that cause the common-cold are self-limiting (go away on their own)? What is so different about viruses that cause diseases requiring vaccines?
virus
During July 2019, I booked flight UA7938 for March 30 through United Airlines for my honeymoon. With everything involving Covid-19 happening, I'm trying to see if I can get a refund for the ticket or an extension on the ticket. My main issue is that I do not know who is responsible for a potential refund. United is the...
would
The "Daily" NY Times podcast for 3/12/20 described two effective management schemes for handling the epidemic. Briefly: Chinese: Check everyone's temperature frequently on a massive scale. Track individuals with QR codes. Use a flow chart procedure to confirm or eliminate a COVID hypothesis, and put affected individual...
virus
There seems to be a bit of a conspiracy theory brewing over some data in the NCBI database, and I don't have the necessary knowledge to make sense of it. It basically goes like this: Go to NCBI BLAST Click on the big Protein BLAST button Enter AVP78033 in the main search box and click BLAST Click on the first result th...
virus
I am from Bangladesh. I recently applied for a non-immigrant type visa for entering Thailand for WordCamp Asia 2020 event. However, the event was cancelled recently for coronavirus outbreak. Since my air ticket is non-refundable and hotel refund cost etc are too much, I thought why not to go there still and spend a wee...
would
(This is not about the coronavirus pandemic, which I understand is a different issue, but about the six countries that had already been maintaining border controls since related to migration and terrorism since 2016.) Could someone explain to me the legal basis of Germany, Austria, Denmark, Sweden, and Norway's extensi...
would
Disclaimer: My PhD supervisor, while not a bad person, is a bad mentor and has given me bad advice in the past. So discussing this with him isn't really productive. I have talked to other people in real life about this, and the opinion of this community would also be welcome. I'm set to finish my PhD in theoretical phy...
would
News about Romania's COVID-19-driven, reverse diaspora: Over 200,000 Romanians who worked abroad have returned to the country since the outbreak of the novel coronavirus, with many of them coming from those EU countries strongly affected by the pandemic, PM Ludovic Orban said on Friday [March 27]. “On February 25 there...
virus
I'm planning a trip to the Netherlands mid-April, and I've already made reservations. I understand that because of the current coronavirus pandemic, I may have to postpone my trip or cancel it entirely. However, instead of deciding now, I'd like to decide later (in April) if I should continue with my trip plans or canc...
would
Due to the outbreak of nCoV-19 (Novel Coronavirus) many Countries have imposed several entry restrictions. But these are quite confusing for a lot of people. Some countries allow transit through parts of China (like Shanghai) but some restrict transit even through Hong Kong/Macau. Philippines restricted passengers comi...
virus
In the last couple of days, WHO officials have criticised the UK government's approach to the COVID-19 pandemic, describing the government's reliance on developing herd-immunity amongst the British population, and apparent reluctance to put in place quarantines as "ridiculous". China has also been criticised for its in...
virus
Currently there are talks of issuing a $1000 payout to all American citizens earning less than $130,000. Presuming the final number of recepients is 200 million people, this is equivalent to injecting 200 billion dollars into the economy out of thin air. But of course money cannot be artificially increased without caus...
would
Central Banks around the world have cut interest rates in the past few days in response to the COVID-19 pandemic, including the US Federal Reserve (0-0.25%), the Bank of England (0.1%), and the Reserve Bank of Australia (0.25%). Notably, the European Central Bank has not yet cut interest rates further, but this is part...
virus
According to this article, chloroquine and hydroxychloroquine could be effective treatments for Covid-19. Assuming the drugs are well tolerated in clinical trials and seem effective at treating COVID-19, the FDA will take measures to increase the nation's supply, according to Hahn. Assuming best case scenario, when cou...
virus
im new in data sience and machine learning but i have some mathematical and statistics backgroud. I really just want some information about models (like papers or raw models). So if you have any information please share them with me. thank you
would
Two academic hospitals in The Netherlands (Nijmegen and Utrecht) just got approval to experiment with using a tuberculosis vaccine (BCG) to try to better protect hospital workers against coronavirus. I assume that "protect hospital workers" means something like decreasing the severity of the infection. Apparently the B...
virus
I was waiting with bated breath for the CDC update on cases of COVID-19 in the U.S. by date of onset. To my eyes this looks like absolutely wonderful news - that it means that the exponential growth of the virus has been "flattened" - but I'm still afraid I may be misinterpreting what I see. It bothers me that the head...
virus
My prefix means to work together, and when written in full words, it means something almost rectangular. My infix is neves semit thgie semit enin in Italy, and when written in full words, it means something usually rectangular. My suffix is indivisible, and when written in full words, it can end its own suffix. My whol...
would
Coronavirus, HIV, 1918 Flu, etc. They all come from animals. Do any infectious diseases (in humans) come from plants? More specifically, are there viruses that infect plants that can mutate to infect humans?
virus
As education moves to the internet, so are research seminars. Some of these seminars are regular and others appear to be temporary due to the covid-19 and the lockdown. Here are some examples from the American Economic Association Regular seminar(s) The Chamberlain Seminar - A regular open online international inter-in...
would
I'm finding it hard to grasp the current status of the $2 trillion stimulus bill because news about the approval process frequently seem to contradict each other. As far as I'm aware, Bernie Sanders has threatened to stop the bill after Senate had already approved it. How would this be possible? What is the bill's curr...
would
Disclaimer: I am a scientist, but this is not my main field so sorry if I've not used the correct terminology at this busy time... Since the coronavirus protein bonds with and gains entry to the cell by bonding to ACE2 receptor, does anyone happen to be currently working upon inhibition of the ACE2 receptor? Obviously ...
virus
I'm looking at a genome sequence for 2019-nCoV on NCBI. The FASTA sequence looks like this: >MN988713.1 Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-IL1/2020, complete genome ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA CGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAG...
virus
I used a Log-Likelihood Estimation (Poisson) Objective Function to estimate and fit a curve to a data of reported infected cases of COVID-19 using SEIR model in order to estimate its coefficients. How can I calculate the 95% confidence intervals for these estimated coefficients? Thank you
virus
I'm an undergraduate in the US. My professor just told us via email that he will not be able to grade an exam until next week because his family member died from complications due to COVID-19. I don't care much about the delay, but I do like my professor, both as a person and an educator. Would it be out of line for me...
would
As specified in this link, COVID-19 tests start with taking samples from the nose or back or throat of people. Based on growth rate of this disease, I thought what if those samples are not positive (showing infection with COVID-19), but that person has that virus in other parts of his body, because he's in the early st...
virus
My indoor cat has a (rotating) variety of toys, things to climb on and scratch, and places to run around; I'm not concerned about him getting enough physical stimulation. But I've heard that cats also need mental stimulation. How do I best provide that, both when I'm playing with him and when he's alone in the house? I...
would
The protease inhibitor lopinavir, originally developed as a cure against AIDS and HIV, has been shown efficient against SARS Coronavirus SARS-CoV. Dayer M R, Taleb-Gassabi S, Dayer M S. Lopinavir; A Potent Drug against Coronavirus Infection: Insight from Molecular Docking Study, Arch Clin Infect Dis. 2017 ; 12(4):e1382...
virus
Because ACE2 is used by SARS-NCoV-2 to enter the cell, I am curious what factors determine its expression. Interestingly, myocardial infarction increases ACE2 expression in the heart in an animal model ( https://www.ncbi.nlm.nih.gov/pubmed/15671045 ). The paper found no significant effect from ramipril, an ACE inhibito...
virus
I assumed a virus to be something with a very specific geometry, similar to a crystal, but more complex. In an answer to What is the size (diameter) of the SARS-CoV-2 virus? some SARS-CoV-2 virus particles are shown. It looks like they do not have the same geometry. They may be soft and influenced by external forces, b...
virus
We have one two year old Persian cat with some kidney problems. We live in Iran, which these days is not a good place relative to potential coronavirus outbreaks because of the government not giving true information about i. We think we will get the virus some time in the future. In this condition we would like to know...
virus
Quote: We found 4 insertions in the spike glycoprotein (S) which are unique to the 2019-nCoV and are not present in other coronaviruses. Importantly, amino acid residues in all the 4 inserts have identity or similarity to those in the HIV-1 gp120 or HIV-1 Gag. Interestingly, despite the inserts being discontinuous on t...
virus
Some news reports suggested Czech Republic stopped issuing visa to Chinese citizens/nationals and closed visa centres in China after the outbreak of the novel coronavirus. The latter is of course understandable. But are all Chinese nationals, regardless of travel history/place of residence, affected by this? https://ne...
virus
Suppose I get infected by covid-19. I am a healthy person but with weight issues, according to the standard weight tables. Can my immune system cure me by itself? That is, without the need of medications or drugs? and by only resting and eating healthy? I have read this page https://www.healthline.com/health/coronaviru...
virus
Is it possible to extend the 14-day visa free entry in Vietnam? I have a Swedish passport, so I can enter Vietnam for 14 days without a visa. Is it possible to extend that for another 14 days or less somewhere near Saigon? Or at all?
would