image image | latex string | filename string |
|---|---|---|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Feature} & \textbf{XL CGD} & \textbf{AR CGD} \\
\hline
Family history of lupus & 10\% & 3\% \\
\hline
Age at diagnosis & 3.01 years & 7.81 years \\
\hline
Perirectal abscess & 17\% & 7\% \\
\hline
Suppurative adenitis & 59\% & 32\% ... | PMC3128843_table_5 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Diagnosis} & \textbf{Number of diagnosis (\%)} & \textbf{Operated (\%)} & \textbf{Success (\%)} \\
\hline
Vesicovaginal & 28 (35) & 22 (79) & 20(91) \\
\hline
Rectovaginal & 4 (5) & 4 (100) & 4 (100) \\
\hline
Recto and vesicovagi... | PMC3607911_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Biochemical factor} & \multicolumn{2}{c|}{\textbf{category}} & \textbf{No.} & \textbf{\%} \\
\hline
\textbf{Baseline NTx} & \textbf{normal} & \textbf{18 nM BCE $\leq$} & \textbf{30} & \textbf{50} \\
\hline
& ab\textbf{normal} &... | PMC3196722_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Subject Characteristics} \\
\hline
& Boys & Girls & P-value* \\
\hline
N & 14 & 15 \\
\hline
Age (years) & 12.6 $\pm$ 0.3 & 11.7 $\pm$ 0.4 & 0.075 \\
\hline
Height (cm) & 156.0 $\pm$ 3.7 & 150.9 $\pm$ 2.6 & 0.28 \\
\hline
Weight ... | PMC2768671_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Clinical Parameters} & \multicolumn{2}{c|}{\textbf{UNIVARIATE}} & \multicolumn{2}{c|}{\textbf{MULTIVARIATE}} \\
\hline
& \textbf{\textbf{Risk Ratio (95\% CI)}} & \textbf{\textbf{P value}} & \textbf{\textbf{Risk Ratio (95\% CI)}... | PMC2754986_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Main analysis}} & \multicolumn{2}{c|}{\textbf{Depressive disorders spectrum analysis}} \\
\hline
& \textbf{\textbf{Coefficient}} & \textbf{\textbf{[95\% confidence interval]}} & \textbf{\textbf{Coefficien... | PMC3110792_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{True proportion in active control} & \textbf{Non-inferiority bound using 10\% margin} & \multicolumn{3}{c|}{\textbf{Approximate sample size per group assuming 1:1 randomization to new treatment and control required under:}} \\
\... | PMC3113981_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{MIGS ID} & \textbf{Property} & \textbf{Term} & \textbf{Evidence code} \\
\hline
& Classification & Domain Bacteria Phylum Actinobacteria Class Actinobacteria Order Actinomycetales Suborder Frankineae Family Nakamurellaceae Genus ... | PMC3035273_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Size of posterior fragment} & \textbf{N} & \textbf{AOFAS} & \textbf{VAS-pain} & \textbf{Dorsiflexion-restriction} & \textbf{OA grade 1} & \textbf{OA grade 2} & \textbf{OA grade 3} & \textbf{OA grade 4} \\
\hline
<5 \% & ... | PMC4548913_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & \textbf{N} & \textbf{Mean} & \textbf{Std. Deviation} & \textbf{Std. Error} & \textbf{Minimum} & \textbf{Maximum} \\
\hline
Stress to failure & Autoclave & 10 & .916 & .300 & .094 & .58 & 1.63 \\
\hline
\multirow{5}{*}{(MPa)}... | PMC2944266_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{mode based the olives percentage} & \textbf{Palmitic acid (\%)} & & \textbf{Stearic acid (\%)} & & & \textbf{Oleic acid (\%)} & & & \textbf{Linoleic acid (\%)} & & & \textbf{Free acidity (\... | PMC3361296_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{4}{c|}{\textbf{Testosterone}} \\
\hline
& \textbf{No.} & \textbf{\%} & \textbf{Mean $\pm$ SD (ng/ml)} & \textbf{P} \\
\hline
All natural menopause \\
\hline
AR expression \\
\hline
Absent & 59 & 13.1 & 0.434 $\pm$ 0.198... | PMC3554552_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Characteristics} & \textbf{Value} \\
\hline
Age \\
\hline
Mean $\pm$ SD (years) & 52.1 $\pm$ 10.3 \\
\hline
Range & 22-66 \\
\hline
$\leq$50 years & 99 (45.8\%) \\
\hline
>50 years & 117 (54.2\%) \\
\hline
Primary tumor histology \\
\... | PMC4435774_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{c|}{\textbf{Expected genotype call (KASP)}} \\
\hline
\textbf{Genotyping-by-sequencing} & \textbf{Nulliplex} & \textbf{Simplex} & \textbf{Duplex} & \textbf{Triplex} & \textbf{Quadruplex} & \textbf{Total} \\
\hline... | PMC3648547_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{NWGP}} & \multicolumn{3}{c|}{\textbf{WYB}} \\
\hline
\textbf{\textbf{Variable}} & \textbf{\textbf{Available}} & \textbf{\textbf{Used}} & \textbf{\textbf{Variable}} & \textbf{\textbf{Available}} & \textbf{\t... | PMC4532434_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Bacteria (all natively sensitive to antibiotics)} & \textbf{Relevant Characteristics} & \textbf{Resistant or Sensitive} \\
\hline
Salmonella typhimurium; Salmonella paratyphi; Salmonella pullorum/pFimH; Salmonella javiana & Express ... | PMC3143092_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& & \multirow{3}{*}{\textbf{Test set n = 9 No. (\%)}} & \multirow{3}{*}{\textbf{Validation set n = 24 No. (\%)}} \\
\hline
\\
\hline
\multicolumn{2}{c|}{\textbf{Variable}} \\
\hline
\multirow{2}{*}{Age at surgery, years (mean)} & & 64... | PMC4605595_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
N1A—H1A···O1Ai & 0.85 (3) & 2.02 (3) & 2.852 (3) & 165 (2) \\
\hline
N1B—H1B···O1Bi & 0.83 (3) & 2.02 (3) & 2.833 (3) & 165 (2) \\
\hline
C7A—H72A···Cg1ii & 0.96 & 2.71 & 3.637 (3) & 163... | PMC3344021_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{All patients (n = 173)} & \textbf{IPAa Patients with (n = 15)} & \textbf{Patients without IPA (n = 158)} \\
\hline
Cultured samples & 298b & 37 & 261 \\
\hline
Positive (\% and 95\% CI) & 63 (21.1\% 16–26\%) & 27 (73\%, 58–88\%... | PMC3631214_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Diagnosis} & \textbf{Sex} & \textbf{Age} & \textbf{PaO2/FiO2} & \textbf{LIS} & \textbf{APACHEII} & \textbf{PEEP} & \textbf{Outcome} \\
\hline
Group A: FO \\
\hline
1. Pneumonia & M & 74 & 98 & 4 & 18 & 7 & D \\
\hline
2. P... | PMC3080285_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
Bruker SMART CCD area-detector diffractometer & 2501 independent reflections \\
\hline
Radiation source: fine-focus sealed tube & 1817 reflections with I > 2σ(I) \\
\hline
graphite & Rint = 0.058 \\
\hline
φ and ω scans & θmax = 26.1°, θmin =... | PMC3089252_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{ID} & \textbf{Phylum} & \textbf{Class} & \textbf{Order} & \textbf{Family} & \textbf{Genus} \\
\hline
& Cyanobacteria & Oscillatoriophycideae & Oscillatoriales & Microcoleus & Microcoleus \\
\hline
L1B56 & Proteobacteria & Alp... | PMC4595634_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Individual} & \textbf{Sex} & \textbf{Age} & \textbf{Mutation and origin} & \textbf{Pre-op Ct} & \textbf{US results} & \textbf{Histology} & \textbf{ADM (years)} & \textbf{LN+/resecteda} & \textbf{pTNM} \\
\hline
IV-10 &... | PMC3105051_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Strategies} & \textbf{Sn} & \textbf{Sp} & \textbf{Acc} & \textbf{MCC} \\
\hline
SEQ+WS & 0.688 & 0.941 & 0.857 & 0.669 \\
\hline
WS only & 0.627 & 0.960 & 0.849 & 0.652 \\
\hline
SEQ+WS, without AUTO-MUTE_RF & 0.658 & 0.925 & 0.... | PMC3549852_table_5 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{anti-PDI* Negative for (n = 848)} & \textbf{anti-PDI{ Positive for (n = 308)} & \textbf{p-value} \\
\hline
Age & 52.7 (7.9) & 52.0 (7.0) & 0.1354 \\
\hline
Male Sex & 454 (54\%) & 171 (56\%) & 0.5500 \\
\hline
BMI & 31.0 (6.8) ... | PMC3176794_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Article section} & \multicolumn{2}{c|}{\textbf{Main fact}} & \multicolumn{2}{c|}{\textbf{Subfact}} & \multicolumn{2}{c|}{\textbf{Synonym fact}} & \multicolumn{2}{c|}{\textbf{Extra fact}} \\
\hline
\textbf{Title} & \textb... | PMC2761905_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Substrate} & \textbf{Residual glucose (g/L)} & \textbf{Residual starch (g/L)} & \textbf{Total ABE produced (g/L broth)} & \textbf{Yield (g/g)} & \textbf{Productivity (g/L/h)} \\
\hline
Glucose (control) & 16.2 & – & 14.2 & 0.3... | PMC4572674_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Agent}} & \multirow{2}{*}{\textbf{Strain E. coli MG1655}} & \multirow{2}{*}{\textbf{EAEC 042}} \\
\hline
\\
\hline
Chloramphenicol & 4a & .32 \\
\hline
Tetracyline & 2 & .32 \\
\hline
Streptomycin & 2 & .128 \\
\hli... | PMC2808357_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
A Category & Functional annotation & p-value & # genes \\
\hline
Cellular development & development of lymphocytes & 8.17E-03 & 6 \\
\hline
\multirow{3}{*}{Cellular movement} & cell movement of neutrophils & 2.14E-04 & 6 \\
\hline
chemota... | PMC4532500_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Number of stool samples (ss) collected} & \textbf{Men/women/not known} & \textbf{Children/adults/not known} & \textbf{Number of detected A. baumannii (locations)} & \textbf{blaOXA23-like-positive A. baumannii} \\
\hline
Year 200... | PMC3380006_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Functional cluster1} & \textbf{Gene ontology (GO)} & \textbf{Gene IDs identified in the functional cluster} \\
\hline
Vascular development & GO:0001568 blood vessel development GO:0001944 vasculature development GO:0048514 blood ves... | PMC4637310_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Provider assesses 100\% of women (n = 96)} & \textbf{Provider assesses fewer than 100\% of women (n = 26)} \\
\hline
& Correct n (\%) & Correct n (\%) & p- valuea \\
\hline
Knowledge of risk \\
\hline
Smoking during pregnancy ... | PMC3311138_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Technical validation step} & \textbf{ELM-2} \\
\hline
Target & MMP-9 and 212 degraded human elastin at amino acid number 552 \\
\hline
Detection range/standard curve & 1.82–250ng/mL \\
\hline
Dilution range of serum samples & 1:2 is r... | PMC3689773_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene Symbol} & \textbf{Ensembl ID} & \textbf{Description} \\
\hline
PTH & ENSG00000152266 & Parathyroid hormone precursor (Parathyrin) (PTH) (Parathormone) \\
\hline
AGTR1 & ENSG00000144891 & Type-1 angiotensin II receptor (AT1) (AT... | PMC2946338_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{SFA} & \textbf{SMA} & \textbf{AI} & \textbf{AO} & \textbf{AC} & \textbf{TDCE} & \textbf{logSOL} & \textbf{awake} \\
\hline
\textbf{SFA} & 1 & -0.882*** & 0.515*** & -0.031 & 0.170* & 0.172* & 0.218* & 0.076 \\
\hline
... | PMC2770539_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Parameters} & \textbf{Group} & \textbf{Total} & \multicolumn{2}{c|}{\textbf{lncRNA ANRIL}} & \textbf{P value} \\
\hline
& & & \textbf{Low} & \textbf{High} \\
\hline
\multirow{2}{*}{Gender} & \multirow{2}{*}{Male 51 23 28 Fe... | PMC4599723_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Spacegroup}} & \multirow{2}{*}{\textbf{PkAMA1 C2}} & \multirow{2}{*}{\textbf{PkAMA1-FabR31C2 C2}} \\
\hline
\\
\hline
a, b, c (Å) & 90.32, 105.70, 104.75 & 165.86, 71.81, 90.69 \\
\hline
(deg.) β & 98.04 & 116.37 \\... | PMC4401722_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Crude odds ratio (95\% CI)} & \textbf{Adjusted odds ratio (95\% CI)} \\
\hline
Characteristics at ART initiation \\
\hline
Female & 0.69 (0.25, 1.94) \\
\hline
Age \\
\hline
,1 yr & 0.32 (0.05, 2.07) & 1.01 (0.05, 2.82) \\
\hline... | PMC3084269_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{\% agreement with established EBV status}} \\
\hline
& \multirow{2}{*}{\textbf{Negative (N = 39) [95\% CI]}} & \multirow{2}{*}{\textbf{Acute infection (N = 15) [95\% CI]}} & \multirow{2}{*}{\textbf{Past inf... | PMC3679805_table_6 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
Age groups & 6 (n = 11) & 7 (n = 10) & 8 (n = 15) & 9 (n = 13) & 10 (n = 12) \\
\hline
Mean $\pm$ SD & 6.5460.27 & 7.6860.24 & 8.4660.30 & 9.5960.28 & 10.2560.24 \\
\hline
Range & 6.1–6.9 & 7.27–7.96 & 8.00–8.94 & 9.12–9.96 & 10.02–10... | PMC3315543_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{HCV related HCC (\%)} & \textbf{HCV related chronic hepatitis (\%)} & \textbf{P} \\
\hline
Anti HCV positive/ HCV RNA positive & 68 & 55 \\
\hline
HCV Genotyping done & 50 (73.53) & 42 (73.36) & 0.3637 \\
\hline
Genotype 1 & 14... | PMC3643662_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{mM \% Response to 10 RG2833}} \\
\hline
& \textbf{1.5-Fold Increase in Frataxin} & \textbf{2.0-Fold Increase in Frataxin} \\
\hline
Protein & 58 & 23 \\
\hline
mRNA & 72 & 50 \\
\hline
\end{tabular}
\end{table} | PMC3656936_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{interRAI PURS Score} & \textbf{Proportion of residents at baseline} & \textbf{Pressure ulcer rate at reassessment} & \textbf{Odds ratio, 95\% confidence} \\
\hline
0 & 18.9\% & 0.8\% & Reference \\
\hline
1 & 22.3\% & 2.0\% & 2.53... | PMC2955034_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Plant species} & \textbf{Tissue/organelle} & \textbf{Treatment} & \textbf{No. of identified candidates} & \textbf{Reference} \\
\hline
Arabidopsis thaliana & Cell cultures & GSNO-treated protein extracts & 63 & Lindermayr et al. ... | PMC3653056_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{VAD group} & \textbf{Control group} \\
\hline
Pregnant rate & 45.9\% (11/24) & 75.0\% (6/8) \\
\hline
Incidence of embryos dead & 45.5\% (5/11) & 0\% \\
\hline
Filial No. of embryonic & 10.1761.47 (61/6) & 9.8360.75 (59/6) \\
\hl... | PMC3465343_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Year of outbreak} & \textbf{Number of cases} & \textbf{Serotype} & \textbf{Implicated source} & \textbf{Reference} \\
\hline
1993 & 18 & 1/2b & Rice salad & [41] \\
\hline
1994 & 45 & 1/2b & Chocolate milk & [30] \\
\hline
1997 ... | PMC3003996_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Plasmodium falciparum FCB1} & \textbf{0.53 $\pm$ 0.2} \\
\hline
Leishmania donovani & IC50 > 100 \\
\hline
NSCLC-N6 & IC50 > 35 \\
\hline
A 549 & IC50 > 35 \\
\hline
KMS-11 & IC50 > 60 \\
\hline
GBM & IC50 > 60 \\
\hline
HCT-116 & IC5... | PMC3705406_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Aptamer} & \textbf{Sequence} \\
\hline
30-14 & 59AGATGCCTGTCGAGCATGCTGTTGTGGTAGGGTTAGGGATGGTAGCGGTTGTAGCTAAACTGCTTTGTCGACGG93 \\
\hline
30-16/27 & 59TACCGTGGTAGGGAAGGTTGGAGTGTA93 \\
\hline
30-38/27 & 59ACCCGTGGTAGGGTAGGATGGGGTGGT93 \\... | PMC3288073_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Group} & \textbf{Isoform} & \textbf{Average} & \textbf{Median} & \textbf{Range} & \textbf{St. dev.} \\
\hline
\multirow{2}{*}{A} & VDRl & 2368 & 2368 & 987 - 3749 & 1953.6 \\
\hline
VDRs & 751 & 654 & 407-1371 & 401.7 \\
\hlin... | PMC3532837_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Domain} & \textbf{Question (Q) or instrument (I) in CGA} & \textbf{Condition/disease} \\
\hline
Physical \\
\hline
Medication & Do you experience difficulties or side effect with medication use? Polypharmacy defined as the use or th... | PMC3374886_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{RAST Pathway} & \textbf{Description} & \textbf{ORF(s)} \\
\hline
\multirow{8}{*}{Citrate Metabolism, Transport, and Regulation} & 2-(50-triphosphoribosyl)-39-dephosphocoenzyme-A synthase (EC 2.7.8.25) & YP_810049.1a \\
\hline
Apo-ci... | PMC3250461_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\multicolumn{4}{c|}{\textbf{Recipient information}} & \multicolumn{4}{c|}{\textbf{Donor (ELA-A2) information}} \\
\hline
\textbf{\textbf{Horsea}} & \textbf{Breed} & \textbf{Age (years)} & \textbf{Sex} & \textbf{\textbf{Horsea}} & ... | PMC4414005_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{90\%}} & \multicolumn{3}{c|}{\textbf{95\%}} & \multicolumn{3}{c|}{\textbf{99\%}} \\
\hline
& \textbf{\textbf{\textbf{TL}}} & \textbf{\textbf{\textbf{IE}}} & \textbf{\textbf{\textbf{FEM}}} & \tex... | PMC4401437_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
[Cu(C4H2O4)(C3H10N2)(H2O)]·H2O & F(000) = 596 \\
\hline
Mr = 286.76 & m−3 Dx = 1.701 Mg \\
\hline
Orthorhombic, Pmc21 & Mo Kα radiation, λ = 0.71073 Å \\
\hline
Hall symbol: P 2c -2 & Cell parameters from 6311 reflections \\
\hline
a = 14.993... | PMC2960309_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Pt-miRNAs} & \textbf{(59R39) GSP1} & \textbf{(59R39) GSP2} & \textbf{(59R39) GSP3} \\
\hline
ptrmir156 & TTTTTTTTTTGTGCTCACTCTCTTCTG & GGAGTAGAAATGACAGAAGAGAGTGAG & TGACAGAAGAGAGTGAGCAC \\
\hline
ptrmir164 & TTTTTTTTTTGCACGTGCCCTG... | PMC2881865_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Variable}} & \multirow{2}{*}{\textbf{Urban (n=1,805)}} & \multirow{2}{*}{\textbf{Rural (n=1,684)}} \\
\hline
\\
\hline
Mean age (years) & 37.8 ($\pm$1.36) & 37.5 ($\pm$1.36) \\
\hline
Age-group (years) (\%) \\
\hlin... | PMC3702362_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Study year}} & \multirow{2}{*}{\textbf{Total number of}} & \multicolumn{8}{c|}{\textbf{Ever-smokers}} \\
\hline
\textbf{N} & \textbf{\%} & \multicolumn{2}{c|}{\textbf{Gender}} & \multicolumn{2}{c|}{\tex... | PMC4349467_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Ferret} & \textbf{Proximal latency (ms)} & \textbf{Proximal duration (ms)} & \textbf{Proximal amplitude (mV)} & \textbf{Proximal area (mV/ms)} & \textbf{Distal latency (ms)} & \textbf{Distal duration (ms)} & \textbf{Di... | PMC2913798_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Proteins} & \textbf{Number of Hits Antibiotic Treated} & \textbf{Number of Hits No Antibiotics} \\
\hline
superoxide dismutase [Acinetobacter baumannii ACICU] & 40 & 1 \\
\hline
outer membrane protein, related peptidoglycan-associat... | PMC3409086_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Study and location} & \textbf{Surveillance tool} & \textbf{Implementation platforms} & \textbf{Quality assurance} & \textbf{Number of cluster} & \textbf{Sampling sites per cluster} & \textbf{Trap-nights per month} & \t... | PMC3475008_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Early 1980s} & \textbf{Gabrielle Carlson et al. observe that bipolar symptomatology in preadolescent children can include severe irritability and emotional lability (as opposed to the classic symptoms that appear in adults and adolesc... | PMC2846895_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Group} & \multicolumn{2}{c|}{\textbf{ROS}} & \multicolumn{2}{c|}{\textbf{MDA}} & \multicolumn{2}{c|}{\textbf{GSH}} & \multicolumn{2}{c|}{\textbf{SOD}} \\
\hline
& \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \... | PMC4451149_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene present in # genomes} & \textbf{# of genes} & \textbf{Prominent functions (remainder are hypothetical proteins)} \\
\hline
4 & 26 & petF, ho1, carbamoyltransferase, pebS, 5 virion structural proteins \\
\hline
5 & 17 & Enase VI... | PMC3037559_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{Question} \\
\hline
1 & What are the major health issues and challenges affecting Nsuta and/or Jansa? \\
\hline
2 & How do people commonly obtain health services? How do they obtain medications and/or pharmacy services? \\
\hline
3... | PMC3639358_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{PET/CT positive/MRI positive} & \textbf{PET/CT negative/MRI positive} & \textbf{PET/CT positive/MRI negative} \\
\hline
Spinal lesions & 14 & 54 & 24 \\
\hline
SIJ lesions & 13 & 6 & 4 \\
\hline
\end{tabular}
\end{table} | PMC3472173_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Gene} Function & \textbf{Abiotic Stress Tolerance} & \textbf{Reference} \\
\hline
Aldehyde dehydrogenase family 7 member (ALDH7) & Oxygen radical detoxification & Extenuated oxidative stress & [51,93] \\
\hline
Asc... | PMC4519955_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Com\textbf{p}onent} & \textbf{Collective} & \textbf{Mean} & \textbf{SD} & \textbf{p} \\
\hline
IL-6 & Daytime workers Shift workers & 2.30 2.67 & 1.54 3.79 & 0.276 \\
\hline
TNF-a & Daytime workers Shift workers & 5.58 5.68 & 2.... | PMC2914774_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{No of annotation terms matched (/40} & \textbf{HGNC symbol} & \textbf{gene1 XLMR} & \textbf{kb2 50} & \textbf{kb2 100} & \textbf{(kb)3 Dist} & \textbf{Strata} \\
\hline
24 & DMD & 1 & NX & NX & 71.7 & XAR \\
\hline
23 & GPM6... | PMC3142252_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Descriptors} & \textbf{Characterization} & \multicolumn{2}{c|}{\textbf{Median/Mean}} & \textbf{valued P} \\
\hline
& & \textbf{Anaerobic metabolites (n = 1174)} & \textbf{Aerobic metabolites (n = 520)} \\
\hline
MWa & Molecula... | PMC3305344_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Māori N (\%)}} & \multirow{2}{*}{\textbf{Pacific N (\%)}} & \multirow{2}{*}{Non-Māori/ non-\textbf{Pacific N (\%)}} \\
\hline
\\
\hline
Total & 302 (100) & 70 (100) & 1427 (100) \\
\hline
Age (years) \\
\hline
... | PMC4575458_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Citation} & \textbf{Country (WHO Region)*} & \textbf{N} & \textbf{Facility Infrastructure Level} & \textbf{Prospective vs Retrospective} & \textbf{Population Based vs Sample} & \textbf{Denominator description} & \textbf{\%... | PMC3253732_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Characteristcs} & \textbf{Number of patients} & \textbf{(\%)} \\
\hline
Total number of patients & 19 \\
\hline
Age (years) \\
\hline
$\pm$ Mean SD (range) & $\pm$ 61.3 1.4(38-75) \\
\hline
Sex \\
\hline
Male & 13 & 68.4 \\
\hline
F... | PMC3161668_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Variable} & \textbf{Value} \\
\hline
Sample size & 1,018 \\
\hline
Age (years) & 56)a 48 (41, \\
\hline
Male:Female & 419:599 \\
\hline
Percent African ancestry & 82.0 (74.7, 87.5) \\
\hline
Serum creatinine (mg/dL) & 0.9 (0.7, 1.0) \... | PMC3441677_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Variables} & \multicolumn{2}{c|}{\textbf{WRMSDs (n = 376)}} & \textbf{P-value+} \\
\hline
& \textbf{Yes (n = 275)} & \textbf{No (n = 101)} \\
\hline
& \multicolumn{2}{c|}{Mean (SD)} \\
\hline
Age (yr) & 29.62 (7.13) & 30.21 (6.7... | PMC4387780_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
O1 & 0.0185 (4) & 0.0326 (5) & 0.0136 (4) & 0.0000 & −0.0019 (4) & 0.0000 \\
\hline
O2 & 0.0169 (4) & 0.0368 (6) & 0.0242 (5) & 0.0... | PMC3254460_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{L} & \textbf{N} & \textbf{Coefficients} \\
\hline
3 & 3 & ς12 = 0.681306, ς13 = 0.444312, ς23 = 0.679452 \\
\hline
4 & 4 & ς12 = 0.739716, ς13 = 0.432467, ς14 = 516734, ς23 = 0.571812, ς24 = 0.4434453, ς34 = 0.737795 \\
\hline
5 & 5... | PMC4367419_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{-NH2 groups} & \textbf{Frequencies/cm-} & \textbf{Amide N-H} & \textbf{Frequencies/cm-}1 & \textbf{C=O groups} & \textbf{Frequencies/cm-}1 \\
\hline
υasN(99)-H & 3670vw & υN(23)-H & 3446w & υC(11)-O(12) & 1639w \\
\hline
υasN(... | PMC2812828_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Thickness (µm)} & \textbf{Stiffness Coefficient (N·m)} & \textbf{Sensitivity(rad/(°/s))} \\
\hline
25 & 10−4 4.443 × & 10−5 1.822 × \\
\hline
48 & 10−3 3.145 × & 10−5 1.808 × \\
\hline
75 & 10−2 1.200 × & 10−5 1.643 × \\
\hline
\end... | PMC4481988_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Variables} & \textbf{Mean (SD)} \\
\hline
Haematological Parameters \\
\hline
Haemoglobin (gm/dl) & 10.65 (1.65) \\
\hline
White cell count(per cmm) & 6.08 (3.28) \\
\hline
Platelets * & *87.00 (87;135) \\
\hline
Prothrombin Time(Sec)... | PMC3542150_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Gene} & \textbf{Sequence} \\
\hline
Aromatase & Forward primer gcttctcatcgcagagtatccgg Reverse primer caagggtaaattcattgggcttgg \\
\hline
Bax & Forward primer ggggacgaactggacagtaa Reverse primer cagttgaagttgccgtcaga \\
\hline
Bcl-2 & F... | PMC3354660_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{First author} & \textbf{Settings} & \textbf{IGRA method} & \textbf{Samples} & \multicolumn{4}{c|}{\textbf{Test results}} & \textbf{QUADAS score} \\
\hline
& & & & \textbf{TP} & \textbf{FP} & \textbf{FN} & \textbf{TN}... | PMC4451019_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{Controls (n = 14)} \\
\hline
Females & 4 (29\%) \\
\hline
Median age in months (range) & 12 (1–64) \\
\hline
Exclusion tracheal/bronchial malformation & 7 (50\%) \\
\hline
Foreign body aspiration/ Aspiration & 5 (36\%) \\
\hline
At... | PMC3226624_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Pt} & \textbf{Age/gender/Spa type} & \textbf{Type of infection} & \textbf{Treatment} & \textbf{Animal contact} & \textbf{Extra} \\
\hline
1 & 40/male/t011 & External otitis & Surgical cleansing, no antibiotic treatment & Pig f... | PMC4407377_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& & \multicolumn{2}{c|}{\textbf{(50→30) Sequence}} \\
\hline
& & \textbf{Forward} & \textbf{Reverse} \\
\hline
Anthocyanin & biosynthesis \\
\hline
CHS & Chalcone synthase & TGTGCAAAGTTGATTTTATTCGAC & ATGTCAGAAAGGAGGGTCCAATGG \\
\hlin... | PMC3561071_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Variables} & \textbf{Categories} & \multicolumn{3}{c|}{\textbf{Univariate analysis}} & \multicolumn{3}{c|}{\textbf{analysisb Multivariate}} \\
\hline
& & \textbf{\textbf{HR}} & \textbf{\textbf{95\% CI}} & \textbf{\textbf... | PMC4406128_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{length (bp)} & \textbf{Sn (\%)} & \textbf{Sp (\%)} & \textbf{time (s)} & \textbf{memory (MB)} \\
\hline
Blastz (default) & 5,643,656 & 97.4 & 44.4 & 72 & 348 \\
\hline
Blastz (T = 2 C = 2) & 4,035,271 & 95.3 & 60.0 & 22 & 3... | PMC2873541_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Primer name} & \textbf{Sequence (5′-3′)} & \textbf{Application} \\
\hline
T7 & TAATACGACTCACTATAGG & cDNA cloning \\
\hline
SP6 & ATTTAGGTGACACTATAGAA & cDNA cloning \\
\hline
5′SP1 & CCCACAGCACTGAGCCCAATC & Genome walking \\
\hline... | PMC2949604_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Enzyme} & \textbf{Substrate} & \textbf{kcat} \\
\hline
TrCel7A & PASC (1 g/L) & 0.44/second \\
\hline
TrCel7A core & PASC (1 g/L) & 0.24/second \\
\hline
TrCel7A & pNP-lac (0.5 mM) & 0.07/second \\
\hline
TrCel7A core & pNP-lac (0.5... | PMC3257202_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Treatment outcome}} & \multirow{2}{*}{\textbf{Intervention group (\%) (n = 2,107)}} & \multirow{2}{*}{\textbf{Control group (\%) (n = 1,984)}} \\
\hline
\\
\hline
Treatment completed & 911 (43.2) & 694 (35.0) \\
\hl... | PMC3680200_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Experiment Name} & \textbf{Concentration HPRT in ng/μl} & \textbf{Concentration HA in ng/μl} & \textbf{Denaturation CT} & \textbf{Extension CT} \\
\hline
1:0 & 6.25 × 10−7 & 0 & 26.5 & 21.3 \\
\hline
1:1 & 6.25 10−7 × & 6.25 10−... | PMC4515875_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Condition} & \textbf{Parameters} \\
\hline
Cell temperature (°C) & 60 \\
\hline
Gas dew point (°C) & 41 (40\% RH) \\
\hline
Gas flow rate (L/min) & 1, 2, 4 \\
\hline
\end{tabular}
\end{table} | PMC3279239_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Analyte} & \textbf{Dogs (n)} & \textbf{Median (Range)} & \textbf{2.5th Percentile (90\% CI)} & \textbf{97.5th Percentile (90\% CI)} & \textbf{Normality (p)} \\
\hline
uNAG/c (U/g) & 17 & 5.74 (2.75–13.396) & ND & ND & 0.003 \\... | PMC4504498_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Digoxin-exposed} & \textbf{Person-years} & \textbf{Relapse, number} & \textbf{Hazard ratio (95\% CI)} & \textbf{P-value1} \\
\hline
\multirow{2}{*}{All} & Yes & 1,872 & 69 & 1.13 (0.88, 1.46) & 0.04 \\
\hline
No & 148,034 &... | PMC3672748_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{18–60 Years} & \textbf{> 60 Years} \\
\hline
\textbf{Seroconversion rate > 40\%} & \textbf{Seroconversion rate > 30\%} \\
\hline
Mean geometric increase > 2.5 & Mean geometric increase > 2.0 \\
\hline
Seroprotection rate > 70\% & Sero... | PMC4494249_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
F2 Refinement on & Primary atom site location: structure-invariant direct methods \\
\hline
Least-squares matrix: full & Secondary atom site location: difference Fourier map \\
\hline
R[F2 2σ(F2)] > = 0.046 & Hydrogen site location: inferred ... | PMC3008119_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable} & \textbf{Frequency} & \textbf{Percentage} \\
\hline
\multicolumn{2}{c|}{Effect of MMC on the risk of acquiring HIV} \\
\hline
No effect & 11 & 2.8 \\
\hline
It increases the risk of acquiring HIV & 6 & 1.5 \\
\hline
It re... | PMC4564906_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variables} & \multicolumn{2}{c|}{\textbf{Sense of contribution to society}} & \multicolumn{2}{c|}{\textbf{Sense of bonding with work\textbf{\textbf{p}}lace}} \\
\hline
& \textbf{\textbf{Value}} & \textbf{\textbf{p}} & \textbf{\... | PMC3369557_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{DSI vs. DSU}} & \multicolumn{2}{c|}{\textbf{L1I vs. L1U}} & \multicolumn{2}{c|}{\textbf{B713I vs. B713U}} \\
\hline
\textbf{Families} & \textbf{\textbf{\textbf{Up}}} & \textbf{\textbf{\textbf{Down}}}... | PMC4646469_table_6 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Bangladesh Sera} & \textbf{\% Sensitivity} & \textbf{\textbf{95\% Confidence Interval}} & \textbf{\% Specificity} & \textbf{\textbf{95\% Confidence Interval}} \\
\hline
K28-LF* & 98.1 & 89.93–99.95\% & 92.5 & 79.61–98.43\% \\
\h... | PMC2939046_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\multicolumn{2}{c|}{\textbf{Determine which impacts to marine mammals need to be monitored:}} \\
\hline
\textbf{The energy resource is} \\
\hline
Wind & Go to A \\
\hline
Tidal & Go to B \\
\hline
Waves & Go to C \\
\hline
(A) The stage of th... | PMC3540755_table_4 |
End of preview. Expand in Data Studio
README.md exists but content is empty.
- Downloads last month
- 25